data_8TDT # _entry.id 8TDT # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.383 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8TDT pdb_00008tdt 10.2210/pdb8tdt/pdb WWPDB D_1000275303 ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8TDT _pdbx_database_status.recvd_initial_deposition_date 2023-07-04 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Simmons, C.R.' 1 0000-0002-2290-6132 'MacCulloch, T.' 2 0000-0001-5875-3361 'Stephanopoulos, N.' 3 0000-0001-7859-410X 'Yan, H.' 4 0000-0001-7397-9852 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 145 _citation.language ? _citation.page_first 26075 _citation.page_last 26085 _citation.title ;Site-Specific Arrangement and Structure Determination of Minor Groove Binding Molecules in Self-Assembled Three-Dimensional DNA Crystals. ; _citation.year 2023 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.3c07802 _citation.pdbx_database_id_PubMed 37987645 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Simmons, C.R.' 1 0000-0002-2290-6132 primary 'Buchberger, A.' 2 ? primary 'Henry, S.J.W.' 3 0000-0002-5132-3948 primary 'Novacek, A.' 4 ? primary 'Fahmi, N.E.' 5 ? primary 'MacCulloch, T.' 6 ? primary 'Stephanopoulos, N.' 7 0000-0001-7859-410X primary 'Yan, H.' 8 0000-0001-7397-9852 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 8TDT _cell.details ? _cell.formula_units_Z ? _cell.length_a 68.487 _cell.length_a_esd ? _cell.length_b 68.487 _cell.length_b_esd ? _cell.length_c 56.749 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 3 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8TDT _symmetry.cell_setting ? _symmetry.Int_Tables_number 145 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 32' _symmetry.pdbx_full_space_group_name_H-M ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*GP*AP*AP*AP*TP*TP*A)-3') ; 6505.238 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*GP*TP*CP*A)-3') ; 1769.193 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(*TP*CP*TP*AP*AP*TP*TP*T)-3') ; 2391.602 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') ; 2129.409 1 ? ? ? ? 5 non-polymer syn 'CACODYLATE ION' 136.989 4 ? ? ? ? 6 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 7 non-polymer syn '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' 277.324 1 ? ? ? ? 8 water nat water 18.015 3 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DA)(DC)(DC)(DT)(DG)(DA)(DC)(DG)(DG)(DA)(DA)(DA)(DT)(DT) (DA) ; GAGCAGACCTGACGGAAATTA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DG)(DT)(DC)(DA)' CCGTCA B ? 3 polydeoxyribonucleotide no no '(DT)(DC)(DT)(DA)(DA)(DT)(DT)(DT)' TCTAATTT C ? 4 polydeoxyribonucleotide no no '(DG)(DG)(DT)(DC)(DT)(DG)(DC)' GGTCTGC D ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DC n 1 10 DT n 1 11 DG n 1 12 DA n 1 13 DC n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DA n 1 18 DA n 1 19 DT n 1 20 DT n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DG n 2 4 DT n 2 5 DC n 2 6 DA n 3 1 DT n 3 2 DC n 3 3 DT n 3 4 DA n 3 5 DA n 3 6 DT n 3 7 DT n 3 8 DT n 4 1 DG n 4 2 DG n 4 3 DT n 4 4 DC n 4 5 DT n 4 6 DG n 4 7 DC n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 6 'synthetic construct' ? 32630 ? 3 1 sample 1 8 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 8TDT 8TDT ? 1 ? 1 2 PDB 8TDT 8TDT ? 2 ? 1 3 PDB 8TDT 8TDT ? 3 ? 1 4 PDB 8TDT 8TDT ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 8TDT A 1 ? 21 ? 8TDT 1 ? 21 ? 1 21 2 2 8TDT B 1 ? 6 ? 8TDT 0 ? 5 ? 0 5 3 3 8TDT C 1 ? 8 ? 8TDT 1 ? 8 ? 1 8 4 4 8TDT D 1 ? 7 ? 8TDT 10 ? 16 ? 10 16 # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight CAC non-polymer . 'CACODYLATE ION' dimethylarsinate 'C2 H6 As O2 -1' 136.989 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DAP non-polymer . '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' ? 'C16 H15 N5' 277.324 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8TDT _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 6.01 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 79.52 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details 'temperature gradient generated from 60 to 25 C at 0.3 degrees per hour' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.5 mL of 0.05 M Na Cacodylate pH 6.0 with 200 mM MgCl2 and 2.5 M KCl was added to the reservoir with 2 uL added to the drop containing 4 uL of DNA stock. ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 298 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS3 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-09-17 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.92 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 19-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.92 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 19-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8TDT _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.00 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5644 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 95.2 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 8.2 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 5.6 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 2.693 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.177 _reflns.pdbx_Rpim_I_all 0.059 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all 46135 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.973 _reflns.pdbx_CC_star 0.993 _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.166 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 3.00 3.05 ? ? ? ? ? ? 219 ? ? ? ? ? ? ? ? ? ? ? 6.3 0.433 ? ? 2.374 0.826 ? 1 1 0.806 0.945 ? 72.0 ? 2.221 ? ? ? ? ? ? ? ? ? 3.05 3.11 ? ? ? ? ? ? 220 ? ? ? ? ? ? ? ? ? ? ? 6.3 0.562 ? ? 0.901 0.308 ? 2 1 0.931 0.982 ? 78.9 ? 0.844 ? ? ? ? ? ? ? ? ? 3.11 3.17 ? ? ? ? ? ? 247 ? ? ? ? ? ? ? ? ? ? ? 5.9 1.081 ? ? 0.384 0.129 ? 3 1 0.976 0.994 ? 84.0 ? 0.361 ? ? ? ? ? ? ? ? ? 3.17 3.23 ? ? ? ? ? ? 260 ? ? ? ? ? ? ? ? ? ? ? 6.2 2.137 ? ? 0.240 0.082 ? 4 1 0.983 0.996 ? 87.8 ? 0.225 ? ? ? ? ? ? ? ? ? 3.23 3.30 ? ? ? ? ? ? 291 ? ? ? ? ? ? ? ? ? ? ? 6.1 1.742 ? ? 0.234 0.085 ? 5 1 0.975 0.994 ? 93.6 ? 0.218 ? ? ? ? ? ? ? ? ? 3.30 3.38 ? ? ? ? ? ? 267 ? ? ? ? ? ? ? ? ? ? ? 7.8 1.455 ? ? 0.300 0.097 ? 6 1 0.985 0.996 ? 93.0 ? 0.284 ? ? ? ? ? ? ? ? ? 3.38 3.46 ? ? ? ? ? ? 291 ? ? ? ? ? ? ? ? ? ? ? 7.8 1.478 ? ? 0.328 0.110 ? 7 1 0.943 0.985 ? 98.0 ? 0.308 ? ? ? ? ? ? ? ? ? 3.46 3.56 ? ? ? ? ? ? 302 ? ? ? ? ? ? ? ? ? ? ? 8.2 1.583 ? ? 0.279 0.091 ? 8 1 0.981 0.995 ? 98.1 ? 0.264 ? ? ? ? ? ? ? ? ? 3.56 3.66 ? ? ? ? ? ? 283 ? ? ? ? ? ? ? ? ? ? ? 8.3 1.347 ? ? 0.275 0.089 ? 9 1 0.977 0.994 ? 99.6 ? 0.260 ? ? ? ? ? ? ? ? ? 3.66 3.78 ? ? ? ? ? ? 304 ? ? ? ? ? ? ? ? ? ? ? 8.4 1.182 ? ? 0.275 0.092 ? 10 1 0.977 0.994 ? 99.3 ? 0.259 ? ? ? ? ? ? ? ? ? 3.78 3.91 ? ? ? ? ? ? 275 ? ? ? ? ? ? ? ? ? ? ? 8.5 1.322 ? ? 0.273 0.092 ? 11 1 0.980 0.995 ? 100.0 ? 0.257 ? ? ? ? ? ? ? ? ? 3.91 4.07 ? ? ? ? ? ? 305 ? ? ? ? ? ? ? ? ? ? ? 7.9 1.552 ? ? 0.232 0.078 ? 12 1 0.989 0.997 ? 99.7 ? 0.218 ? ? ? ? ? ? ? ? ? 4.07 4.26 ? ? ? ? ? ? 303 ? ? ? ? ? ? ? ? ? ? ? 9.7 2.123 ? ? 0.220 0.070 ? 13 1 0.980 0.995 ? 100.0 ? 0.208 ? ? ? ? ? ? ? ? ? 4.26 4.48 ? ? ? ? ? ? 286 ? ? ? ? ? ? ? ? ? ? ? 9.4 1.897 ? ? 0.198 0.063 ? 14 1 0.983 0.996 ? 100.0 ? 0.187 ? ? ? ? ? ? ? ? ? 4.48 4.76 ? ? ? ? ? ? 304 ? ? ? ? ? ? ? ? ? ? ? 9.3 2.009 ? ? 0.184 0.060 ? 15 1 0.988 0.997 ? 100.0 ? 0.174 ? ? ? ? ? ? ? ? ? 4.76 5.13 ? ? ? ? ? ? 297 ? ? ? ? ? ? ? ? ? ? ? 9.1 2.735 ? ? 0.164 0.054 ? 16 1 0.989 0.997 ? 99.7 ? 0.155 ? ? ? ? ? ? ? ? ? 5.13 5.64 ? ? ? ? ? ? 301 ? ? ? ? ? ? ? ? ? ? ? 8.9 4.530 ? ? 0.157 0.052 ? 17 1 0.984 0.996 ? 99.7 ? 0.148 ? ? ? ? ? ? ? ? ? 5.64 6.46 ? ? ? ? ? ? 294 ? ? ? ? ? ? ? ? ? ? ? 9.5 3.364 ? ? 0.137 0.044 ? 18 1 0.988 0.997 ? 100.0 ? 0.130 ? ? ? ? ? ? ? ? ? 6.46 8.13 ? ? ? ? ? ? 298 ? ? ? ? ? ? ? ? ? ? ? 8.9 4.825 ? ? 0.107 0.036 ? 19 1 0.995 0.999 ? 99.7 ? 0.101 ? ? ? ? ? ? ? ? ? 8.13 50.00 ? ? ? ? ? ? 297 ? ? ? ? ? ? ? ? ? ? ? 9.4 11.389 ? ? 0.136 0.045 ? 20 1 0.977 0.994 ? 100.0 ? 0.128 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8TDT _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.007 _refine.ls_d_res_low 41.004 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5479 _refine.ls_number_reflns_R_free 283 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 92.66 _refine.ls_percent_reflns_R_free 5.17 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2008 _refine.ls_R_factor_R_free 0.2312 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1992 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.96 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 24.57 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.25 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 855 _refine_hist.pdbx_number_atoms_ligand 27 _refine_hist.number_atoms_solvent 3 _refine_hist.number_atoms_total 885 _refine_hist.d_res_high 3.007 _refine_hist.d_res_low 41.004 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.014 ? 980 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.413 ? 1500 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 35.176 ? 409 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.067 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.009 ? 46 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.007 3.7879 . . 125 2416 86.00 . . . . 0.2731 . . . . . . . . . . . 0.3020 'X-RAY DIFFRACTION' 3.7879 41.004 . . 158 2780 99.00 . . . . 0.1763 . . . . . . . . . . . 0.2098 # _struct.entry_id 8TDT _struct.title ;Sequence specific (AATT) orientation of DAPI molecules at a unique minor groove binding site (position2) within a self-assembled 3D DNA lattice (4x6) ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8TDT _struct_keywords.text ;Self-Assembly, DNA Nanotechnology, DNA Scaffold, Crystal Lattice, DNA, Minor Groove Binders, Netropsin, DAPI, Hoechst, ImPyPy, polyamide, host-guest ; _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? F N N 5 ? G N N 5 ? H N N 6 ? I N N 6 ? J N N 7 ? K N N 5 ? L N N 8 ? M N N 8 ? # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A DG 11 "O4'" ? ? ? 1_555 H MG . MG ? ? A DG 11 A MG 104 1_555 ? ? ? ? ? ? ? 2.766 ? ? hydrog1 hydrog ? ? A DG 3 N1 ? ? ? 1_555 D DC 7 N3 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 3 N2 ? ? ? 1_555 D DC 7 O2 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 O6 ? ? ? 1_555 D DC 7 N4 ? ? A DG 3 D DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DC 4 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DC 4 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 4 D DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 5 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 5 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 5 D DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 6 N1 ? ? ? 1_555 D DC 4 N3 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 6 N2 ? ? ? 1_555 D DC 4 O2 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 O6 ? ? ? 1_555 D DC 4 N4 ? ? A DG 6 D DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DA 7 N1 ? ? ? 1_555 D DT 3 N3 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DA 7 N6 ? ? ? 1_555 D DT 3 O4 ? ? A DA 7 D DT 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 8 N3 ? ? ? 1_555 D DG 2 N1 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 8 N4 ? ? ? 1_555 D DG 2 O6 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 O2 ? ? ? 1_555 D DG 2 N2 ? ? A DC 8 D DG 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 9 N3 ? ? ? 1_555 D DG 1 N1 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 9 N4 ? ? ? 1_555 D DG 1 O6 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 9 O2 ? ? ? 1_555 D DG 1 N2 ? ? A DC 9 D DG 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 6 N1 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 6 N6 ? ? A DT 10 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 11 N1 ? ? ? 1_555 B DC 5 N3 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 B DC 5 O2 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 11 O6 ? ? ? 1_555 B DC 5 N4 ? ? A DG 11 B DC 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT 4 N3 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT 4 O4 ? ? A DA 12 B DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 13 N3 ? ? ? 1_555 B DG 3 N1 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 13 N4 ? ? ? 1_555 B DG 3 O6 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DC 13 O2 ? ? ? 1_555 B DG 3 N2 ? ? A DC 13 B DG 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 0 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 16 N1 ? ? ? 1_555 C DT 8 N3 ? ? A DA 16 C DT 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 16 N6 ? ? ? 1_555 C DT 8 O4 ? ? A DA 16 C DT 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 17 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 17 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 17 C DT 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 18 N1 ? ? ? 1_555 C DT 6 N3 ? ? A DA 18 C DT 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DA 18 N6 ? ? ? 1_555 C DT 6 O4 ? ? A DA 18 C DT 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DT 19 N3 ? ? ? 1_555 C DA 5 N1 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DT 19 O4 ? ? ? 1_555 C DA 5 N6 ? ? A DT 19 C DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DT 20 N3 ? ? ? 1_555 C DA 4 N1 ? ? A DT 20 C DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DT 20 O4 ? ? ? 1_555 C DA 4 N6 ? ? A DT 20 C DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DA 21 N1 ? ? ? 1_555 C DT 3 N3 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DA 21 N6 ? ? ? 1_555 C DT 3 O4 ? ? A DA 21 C DT 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _atom_sites.entry_id 8TDT _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.fract_transf_matrix[1][1] 0.014601 _atom_sites.fract_transf_matrix[1][2] 0.008430 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.016860 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.017621 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol AS C MG N O P # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DA 7 7 7 DA DA A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DA 12 12 12 DA DA A . n A 1 13 DC 13 13 13 DC DC A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DT 20 20 20 DT DT A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 0 0 DC DC B . n B 2 2 DC 2 1 1 DC DC B . n B 2 3 DG 3 2 2 DG DG B . n B 2 4 DT 4 3 3 DT DT B . n B 2 5 DC 5 4 4 DC DC B . n B 2 6 DA 6 5 5 DA DA B . n C 3 1 DT 1 1 1 DT DT C . n C 3 2 DC 2 2 2 DC DC C . n C 3 3 DT 3 3 3 DT DT C . n C 3 4 DA 4 4 4 DA DA C . n C 3 5 DA 5 5 5 DA DA C . n C 3 6 DT 6 6 6 DT DT C . n C 3 7 DT 7 7 7 DT DT C . n C 3 8 DT 8 8 8 DT DT C . n D 4 1 DG 1 10 10 DG DG D . n D 4 2 DG 2 11 11 DG DG D . n D 4 3 DT 3 12 12 DT DT D . n D 4 4 DC 4 13 13 DC DC D . n D 4 5 DT 5 14 14 DT DT D . n D 4 6 DG 6 15 15 DG DG D . n D 4 7 DC 7 16 16 DC DC D . n # _pdbx_contact_author.id 2 _pdbx_contact_author.email hao.yan@asu.edu _pdbx_contact_author.name_first Hao _pdbx_contact_author.name_last Yan _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7397-9852 # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code E 5 CAC 1 101 2 CAC AS A . F 5 CAC 1 102 3 CAC AS A . G 5 CAC 1 103 4 CAC AS A . H 6 MG 1 104 2 MG MG A . I 6 MG 1 101 4 MG MG B . J 7 DAP 1 101 1 DAP DAP C . K 5 CAC 1 101 1 CAC AS D . L 8 HOH 1 201 2 HOH HOH A . L 8 HOH 2 202 5 HOH HOH A . M 8 HOH 1 201 3 HOH HOH B . # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2023-12-20 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.11.1_2575: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-2000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _pdbx_entry_details.entry_id 8TDT _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O2 C DT 7 ? ? "C6'" C DAP 101 ? ? 1.40 2 1 O2 C DT 7 ? ? "C5'" C DAP 101 ? ? 2.19 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DA 18 ? ? "C3'" A DA 18 ? ? 1.382 1.419 -0.037 0.006 N 2 1 "O3'" A DT 19 ? ? "C3'" A DT 19 ? ? 1.365 1.419 -0.054 0.006 N 3 1 "O3'" A DT 20 ? ? "C3'" A DT 20 ? ? 1.377 1.419 -0.042 0.006 N 4 1 "O3'" B DC 4 ? ? "C3'" B DC 4 ? ? 1.374 1.419 -0.045 0.006 N 5 1 "O3'" B DA 5 ? ? "C3'" B DA 5 ? ? 1.361 1.419 -0.058 0.006 N 6 1 C2 C DT 7 ? ? O2 C DT 7 ? ? 1.298 1.220 0.078 0.008 N 7 1 "O3'" C DT 8 ? ? "C3'" C DT 8 ? ? 1.366 1.419 -0.053 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DA 2 ? ? "C1'" A DA 2 ? ? N9 A DA 2 ? ? 110.11 108.30 1.81 0.30 N 2 1 "C3'" A DG 11 ? ? "C2'" A DG 11 ? ? "C1'" A DG 11 ? ? 97.59 102.40 -4.81 0.80 N 3 1 "O4'" B DA 5 ? ? "C1'" B DA 5 ? ? N9 B DA 5 ? ? 110.46 108.30 2.16 0.30 N 4 1 N3 C DT 7 ? ? C4 C DT 7 ? ? O4 C DT 7 ? ? 123.66 119.90 3.76 0.60 N 5 1 "O4'" D DG 10 ? ? "C4'" D DG 10 ? ? "C3'" D DG 10 ? ? 102.01 104.50 -2.49 0.40 N # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 N 1 A CAC 101 ? O1 ? E CAC 1 O1 2 1 N 1 A CAC 101 ? O2 ? E CAC 1 O2 3 1 N 1 A CAC 101 ? C1 ? E CAC 1 C1 4 1 N 1 A CAC 101 ? C2 ? E CAC 1 C2 5 1 N 1 A CAC 102 ? O1 ? F CAC 1 O1 6 1 N 1 A CAC 102 ? O2 ? F CAC 1 O2 7 1 N 1 A CAC 102 ? C1 ? F CAC 1 C1 8 1 N 1 A CAC 102 ? C2 ? F CAC 1 C2 9 1 N 1 A CAC 103 ? O1 ? G CAC 1 O1 10 1 N 1 A CAC 103 ? O2 ? G CAC 1 O2 11 1 N 1 A CAC 103 ? C1 ? G CAC 1 C1 12 1 N 1 A CAC 103 ? C2 ? G CAC 1 C2 13 1 N 1 D CAC 101 ? O1 ? K CAC 1 O1 14 1 N 1 D CAC 101 ? O2 ? K CAC 1 O2 15 1 N 1 D CAC 101 ? C1 ? K CAC 1 C1 16 1 N 1 D CAC 101 ? C2 ? K CAC 1 C2 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal CAC AS AS N N 1 CAC O1 O N N 2 CAC O2 O N N 3 CAC C1 C N N 4 CAC C2 C N N 5 CAC H11 H N N 6 CAC H12 H N N 7 CAC H13 H N N 8 CAC H21 H N N 9 CAC H22 H N N 10 CAC H23 H N N 11 DA OP3 O N N 12 DA P P N N 13 DA OP1 O N N 14 DA OP2 O N N 15 DA "O5'" O N N 16 DA "C5'" C N N 17 DA "C4'" C N R 18 DA "O4'" O N N 19 DA "C3'" C N S 20 DA "O3'" O N N 21 DA "C2'" C N N 22 DA "C1'" C N R 23 DA N9 N Y N 24 DA C8 C Y N 25 DA N7 N Y N 26 DA C5 C Y N 27 DA C6 C Y N 28 DA N6 N N N 29 DA N1 N Y N 30 DA C2 C Y N 31 DA N3 N Y N 32 DA C4 C Y N 33 DA HOP3 H N N 34 DA HOP2 H N N 35 DA "H5'" H N N 36 DA "H5''" H N N 37 DA "H4'" H N N 38 DA "H3'" H N N 39 DA "HO3'" H N N 40 DA "H2'" H N N 41 DA "H2''" H N N 42 DA "H1'" H N N 43 DA H8 H N N 44 DA H61 H N N 45 DA H62 H N N 46 DA H2 H N N 47 DAP N1 N Y N 48 DAP C2 C Y N 49 DAP C3 C Y N 50 DAP C4 C Y N 51 DAP C5 C Y N 52 DAP C6 C Y N 53 DAP C7 C Y N 54 DAP C8 C Y N 55 DAP C9 C Y N 56 DAP C10 C N N 57 DAP N2 N N N 58 DAP N3 N N N 59 DAP "C1'" C Y N 60 DAP "C2'" C Y N 61 DAP "C3'" C Y N 62 DAP "C4'" C Y N 63 DAP "C5'" C Y N 64 DAP "C6'" C Y N 65 DAP C11 C N N 66 DAP N4 N N N 67 DAP N5 N N N 68 DAP HN1 H N N 69 DAP H3 H N N 70 DAP H4 H N N 71 DAP H5 H N N 72 DAP H7 H N N 73 DAP HN2 H N N 74 DAP HN31 H N N 75 DAP HN32 H N N 76 DAP "H2'" H N N 77 DAP "H3'" H N N 78 DAP "H5'" H N N 79 DAP "H6'" H N N 80 DAP HN4 H N N 81 DAP HN51 H N N 82 DAP HN52 H N N 83 DC OP3 O N N 84 DC P P N N 85 DC OP1 O N N 86 DC OP2 O N N 87 DC "O5'" O N N 88 DC "C5'" C N N 89 DC "C4'" C N R 90 DC "O4'" O N N 91 DC "C3'" C N S 92 DC "O3'" O N N 93 DC "C2'" C N N 94 DC "C1'" C N R 95 DC N1 N N N 96 DC C2 C N N 97 DC O2 O N N 98 DC N3 N N N 99 DC C4 C N N 100 DC N4 N N N 101 DC C5 C N N 102 DC C6 C N N 103 DC HOP3 H N N 104 DC HOP2 H N N 105 DC "H5'" H N N 106 DC "H5''" H N N 107 DC "H4'" H N N 108 DC "H3'" H N N 109 DC "HO3'" H N N 110 DC "H2'" H N N 111 DC "H2''" H N N 112 DC "H1'" H N N 113 DC H41 H N N 114 DC H42 H N N 115 DC H5 H N N 116 DC H6 H N N 117 DG OP3 O N N 118 DG P P N N 119 DG OP1 O N N 120 DG OP2 O N N 121 DG "O5'" O N N 122 DG "C5'" C N N 123 DG "C4'" C N R 124 DG "O4'" O N N 125 DG "C3'" C N S 126 DG "O3'" O N N 127 DG "C2'" C N N 128 DG "C1'" C N R 129 DG N9 N Y N 130 DG C8 C Y N 131 DG N7 N Y N 132 DG C5 C Y N 133 DG C6 C N N 134 DG O6 O N N 135 DG N1 N N N 136 DG C2 C N N 137 DG N2 N N N 138 DG N3 N N N 139 DG C4 C Y N 140 DG HOP3 H N N 141 DG HOP2 H N N 142 DG "H5'" H N N 143 DG "H5''" H N N 144 DG "H4'" H N N 145 DG "H3'" H N N 146 DG "HO3'" H N N 147 DG "H2'" H N N 148 DG "H2''" H N N 149 DG "H1'" H N N 150 DG H8 H N N 151 DG H1 H N N 152 DG H21 H N N 153 DG H22 H N N 154 DT OP3 O N N 155 DT P P N N 156 DT OP1 O N N 157 DT OP2 O N N 158 DT "O5'" O N N 159 DT "C5'" C N N 160 DT "C4'" C N R 161 DT "O4'" O N N 162 DT "C3'" C N S 163 DT "O3'" O N N 164 DT "C2'" C N N 165 DT "C1'" C N R 166 DT N1 N N N 167 DT C2 C N N 168 DT O2 O N N 169 DT N3 N N N 170 DT C4 C N N 171 DT O4 O N N 172 DT C5 C N N 173 DT C7 C N N 174 DT C6 C N N 175 DT HOP3 H N N 176 DT HOP2 H N N 177 DT "H5'" H N N 178 DT "H5''" H N N 179 DT "H4'" H N N 180 DT "H3'" H N N 181 DT "HO3'" H N N 182 DT "H2'" H N N 183 DT "H2''" H N N 184 DT "H1'" H N N 185 DT H3 H N N 186 DT H71 H N N 187 DT H72 H N N 188 DT H73 H N N 189 DT H6 H N N 190 HOH O O N N 191 HOH H1 H N N 192 HOH H2 H N N 193 MG MG MG N N 194 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal CAC AS O1 doub N N 1 CAC AS O2 sing N N 2 CAC AS C1 sing N N 3 CAC AS C2 sing N N 4 CAC C1 H11 sing N N 5 CAC C1 H12 sing N N 6 CAC C1 H13 sing N N 7 CAC C2 H21 sing N N 8 CAC C2 H22 sing N N 9 CAC C2 H23 sing N N 10 DA OP3 P sing N N 11 DA OP3 HOP3 sing N N 12 DA P OP1 doub N N 13 DA P OP2 sing N N 14 DA P "O5'" sing N N 15 DA OP2 HOP2 sing N N 16 DA "O5'" "C5'" sing N N 17 DA "C5'" "C4'" sing N N 18 DA "C5'" "H5'" sing N N 19 DA "C5'" "H5''" sing N N 20 DA "C4'" "O4'" sing N N 21 DA "C4'" "C3'" sing N N 22 DA "C4'" "H4'" sing N N 23 DA "O4'" "C1'" sing N N 24 DA "C3'" "O3'" sing N N 25 DA "C3'" "C2'" sing N N 26 DA "C3'" "H3'" sing N N 27 DA "O3'" "HO3'" sing N N 28 DA "C2'" "C1'" sing N N 29 DA "C2'" "H2'" sing N N 30 DA "C2'" "H2''" sing N N 31 DA "C1'" N9 sing N N 32 DA "C1'" "H1'" sing N N 33 DA N9 C8 sing Y N 34 DA N9 C4 sing Y N 35 DA C8 N7 doub Y N 36 DA C8 H8 sing N N 37 DA N7 C5 sing Y N 38 DA C5 C6 sing Y N 39 DA C5 C4 doub Y N 40 DA C6 N6 sing N N 41 DA C6 N1 doub Y N 42 DA N6 H61 sing N N 43 DA N6 H62 sing N N 44 DA N1 C2 sing Y N 45 DA C2 N3 doub Y N 46 DA C2 H2 sing N N 47 DA N3 C4 sing Y N 48 DAP N1 C2 sing Y N 49 DAP N1 C8 sing Y N 50 DAP N1 HN1 sing N N 51 DAP C2 C3 doub Y N 52 DAP C2 "C1'" sing Y N 53 DAP C3 C9 sing Y N 54 DAP C3 H3 sing N N 55 DAP C4 C5 doub Y N 56 DAP C4 C9 sing Y N 57 DAP C4 H4 sing N N 58 DAP C5 C6 sing Y N 59 DAP C5 H5 sing N N 60 DAP C6 C7 doub Y N 61 DAP C6 C10 sing N N 62 DAP C7 C8 sing Y N 63 DAP C7 H7 sing N N 64 DAP C8 C9 doub Y N 65 DAP C10 N2 doub N N 66 DAP C10 N3 sing N N 67 DAP N2 HN2 sing N N 68 DAP N3 HN31 sing N N 69 DAP N3 HN32 sing N N 70 DAP "C1'" "C2'" doub Y N 71 DAP "C1'" "C6'" sing Y N 72 DAP "C2'" "C3'" sing Y N 73 DAP "C2'" "H2'" sing N N 74 DAP "C3'" "C4'" doub Y N 75 DAP "C3'" "H3'" sing N N 76 DAP "C4'" "C5'" sing Y N 77 DAP "C4'" C11 sing N N 78 DAP "C5'" "C6'" doub Y N 79 DAP "C5'" "H5'" sing N N 80 DAP "C6'" "H6'" sing N N 81 DAP C11 N4 doub N N 82 DAP C11 N5 sing N N 83 DAP N4 HN4 sing N N 84 DAP N5 HN51 sing N N 85 DAP N5 HN52 sing N N 86 DC OP3 P sing N N 87 DC OP3 HOP3 sing N N 88 DC P OP1 doub N N 89 DC P OP2 sing N N 90 DC P "O5'" sing N N 91 DC OP2 HOP2 sing N N 92 DC "O5'" "C5'" sing N N 93 DC "C5'" "C4'" sing N N 94 DC "C5'" "H5'" sing N N 95 DC "C5'" "H5''" sing N N 96 DC "C4'" "O4'" sing N N 97 DC "C4'" "C3'" sing N N 98 DC "C4'" "H4'" sing N N 99 DC "O4'" "C1'" sing N N 100 DC "C3'" "O3'" sing N N 101 DC "C3'" "C2'" sing N N 102 DC "C3'" "H3'" sing N N 103 DC "O3'" "HO3'" sing N N 104 DC "C2'" "C1'" sing N N 105 DC "C2'" "H2'" sing N N 106 DC "C2'" "H2''" sing N N 107 DC "C1'" N1 sing N N 108 DC "C1'" "H1'" sing N N 109 DC N1 C2 sing N N 110 DC N1 C6 sing N N 111 DC C2 O2 doub N N 112 DC C2 N3 sing N N 113 DC N3 C4 doub N N 114 DC C4 N4 sing N N 115 DC C4 C5 sing N N 116 DC N4 H41 sing N N 117 DC N4 H42 sing N N 118 DC C5 C6 doub N N 119 DC C5 H5 sing N N 120 DC C6 H6 sing N N 121 DG OP3 P sing N N 122 DG OP3 HOP3 sing N N 123 DG P OP1 doub N N 124 DG P OP2 sing N N 125 DG P "O5'" sing N N 126 DG OP2 HOP2 sing N N 127 DG "O5'" "C5'" sing N N 128 DG "C5'" "C4'" sing N N 129 DG "C5'" "H5'" sing N N 130 DG "C5'" "H5''" sing N N 131 DG "C4'" "O4'" sing N N 132 DG "C4'" "C3'" sing N N 133 DG "C4'" "H4'" sing N N 134 DG "O4'" "C1'" sing N N 135 DG "C3'" "O3'" sing N N 136 DG "C3'" "C2'" sing N N 137 DG "C3'" "H3'" sing N N 138 DG "O3'" "HO3'" sing N N 139 DG "C2'" "C1'" sing N N 140 DG "C2'" "H2'" sing N N 141 DG "C2'" "H2''" sing N N 142 DG "C1'" N9 sing N N 143 DG "C1'" "H1'" sing N N 144 DG N9 C8 sing Y N 145 DG N9 C4 sing Y N 146 DG C8 N7 doub Y N 147 DG C8 H8 sing N N 148 DG N7 C5 sing Y N 149 DG C5 C6 sing N N 150 DG C5 C4 doub Y N 151 DG C6 O6 doub N N 152 DG C6 N1 sing N N 153 DG N1 C2 sing N N 154 DG N1 H1 sing N N 155 DG C2 N2 sing N N 156 DG C2 N3 doub N N 157 DG N2 H21 sing N N 158 DG N2 H22 sing N N 159 DG N3 C4 sing N N 160 DT OP3 P sing N N 161 DT OP3 HOP3 sing N N 162 DT P OP1 doub N N 163 DT P OP2 sing N N 164 DT P "O5'" sing N N 165 DT OP2 HOP2 sing N N 166 DT "O5'" "C5'" sing N N 167 DT "C5'" "C4'" sing N N 168 DT "C5'" "H5'" sing N N 169 DT "C5'" "H5''" sing N N 170 DT "C4'" "O4'" sing N N 171 DT "C4'" "C3'" sing N N 172 DT "C4'" "H4'" sing N N 173 DT "O4'" "C1'" sing N N 174 DT "C3'" "O3'" sing N N 175 DT "C3'" "C2'" sing N N 176 DT "C3'" "H3'" sing N N 177 DT "O3'" "HO3'" sing N N 178 DT "C2'" "C1'" sing N N 179 DT "C2'" "H2'" sing N N 180 DT "C2'" "H2''" sing N N 181 DT "C1'" N1 sing N N 182 DT "C1'" "H1'" sing N N 183 DT N1 C2 sing N N 184 DT N1 C6 sing N N 185 DT C2 O2 doub N N 186 DT C2 N3 sing N N 187 DT N3 C4 sing N N 188 DT N3 H3 sing N N 189 DT C4 O4 doub N N 190 DT C4 C5 sing N N 191 DT C5 C7 sing N N 192 DT C5 C6 doub N N 193 DT C7 H71 sing N N 194 DT C7 H72 sing N N 195 DT C7 H73 sing N N 196 DT C6 H6 sing N N 197 HOH O H1 sing N N 198 HOH O H2 sing N N 199 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8TDT 'double helix' 8TDT 'a-form double helix' 8TDT 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 3 1_555 D DC 7 1_555 -0.201 -0.170 0.535 1.465 -15.388 -5.126 1 A_DG3:DC16_D A 3 ? D 16 ? 19 1 1 A DC 4 1_555 D DG 6 1_555 0.214 -0.115 0.242 -3.251 -10.302 0.899 2 A_DC4:DG15_D A 4 ? D 15 ? 19 1 1 A DA 5 1_555 D DT 5 1_555 0.169 -0.060 0.648 -1.170 -12.250 -5.778 3 A_DA5:DT14_D A 5 ? D 14 ? 20 1 1 A DG 6 1_555 D DC 4 1_555 -0.112 -0.328 0.679 0.191 -11.536 -2.379 4 A_DG6:DC13_D A 6 ? D 13 ? 19 1 1 A DA 7 1_555 D DT 3 1_555 0.050 -0.163 0.415 1.019 -7.316 -0.884 5 A_DA7:DT12_D A 7 ? D 12 ? 20 1 1 A DC 8 1_555 D DG 2 1_555 0.285 -0.215 0.102 13.979 -5.542 0.570 6 A_DC8:DG11_D A 8 ? D 11 ? 19 1 1 A DC 9 1_555 D DG 1 1_555 0.163 -0.214 0.006 -0.495 -4.273 -0.218 7 A_DC9:DG10_D A 9 ? D 10 ? 19 1 1 A DT 10 1_555 B DA 6 1_555 -0.252 0.037 0.384 -6.030 -1.817 3.916 8 A_DT10:DA5_B A 10 ? B 5 ? 20 1 1 A DG 11 1_555 B DC 5 1_555 -0.159 -0.162 0.282 6.183 0.084 1.531 9 A_DG11:DC4_B A 11 ? B 4 ? 19 1 1 A DA 12 1_555 B DT 4 1_555 0.339 -0.110 0.427 0.906 -5.683 -5.644 10 A_DA12:DT3_B A 12 ? B 3 ? 20 1 1 A DC 13 1_555 B DG 3 1_555 0.119 -0.199 0.236 -4.483 -6.164 -4.051 11 A_DC13:DG2_B A 13 ? B 2 ? 19 1 1 A DG 14 1_555 B DC 2 1_555 -0.164 -0.093 0.382 8.213 -8.336 -1.925 12 A_DG14:DC1_B A 14 ? B 1 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.063 -0.171 0.316 6.709 -12.452 0.944 13 A_DG15:DC0_B A 15 ? B 0 ? 19 1 1 A DA 16 1_555 C DT 8 1_555 0.118 -0.111 0.668 8.412 -9.519 2.307 14 A_DA16:DT8_C A 16 ? C 8 ? 20 1 1 A DA 17 1_555 C DT 7 1_555 0.503 -0.169 0.176 2.396 -19.587 -2.302 15 A_DA17:DT7_C A 17 ? C 7 ? 20 1 1 A DA 18 1_555 C DT 6 1_555 -0.121 -0.327 -0.103 -4.771 -9.304 -1.507 16 A_DA18:DT6_C A 18 ? C 6 ? 20 1 1 A DT 19 1_555 C DA 5 1_555 -0.041 -0.324 -0.296 -1.331 -11.965 5.104 17 A_DT19:DA5_C A 19 ? C 5 ? 20 1 1 A DT 20 1_555 C DA 4 1_555 -0.029 -0.020 -0.456 -0.172 -20.322 4.654 18 A_DT20:DA4_C A 20 ? C 4 ? 20 1 1 A DA 21 1_555 C DT 3 1_555 0.078 -0.050 -0.476 -5.302 -16.690 5.172 19 A_DA21:DT3_C A 21 ? C 3 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 3 1_555 D DC 7 1_555 A DC 4 1_555 D DG 6 1_555 -0.054 -0.750 3.485 3.063 -2.896 37.560 -0.757 0.507 3.516 -4.480 -4.738 37.787 1 AA_DG3DC4:DG15DC16_DD A 3 ? D 16 ? A 4 ? D 15 ? 1 A DC 4 1_555 D DG 6 1_555 A DA 5 1_555 D DT 5 1_555 -0.488 0.362 3.265 -4.324 3.066 33.767 0.125 0.138 3.319 5.238 7.387 34.169 2 AA_DC4DA5:DT14DG15_DD A 4 ? D 15 ? A 5 ? D 14 ? 1 A DA 5 1_555 D DT 5 1_555 A DG 6 1_555 D DC 4 1_555 0.361 -0.888 3.276 -1.415 1.459 30.895 -1.943 -0.947 3.212 2.736 2.653 30.960 3 AA_DA5DG6:DC13DT14_DD A 5 ? D 14 ? A 6 ? D 13 ? 1 A DG 6 1_555 D DC 4 1_555 A DA 7 1_555 D DT 3 1_555 0.286 -0.699 3.267 0.446 -1.235 34.278 -0.991 -0.415 3.293 -2.094 -0.757 34.302 4 AA_DG6DA7:DT12DC13_DD A 6 ? D 13 ? A 7 ? D 12 ? 1 A DA 7 1_555 D DT 3 1_555 A DC 8 1_555 D DG 2 1_555 0.398 -0.614 3.002 1.293 3.123 35.028 -1.439 -0.482 2.950 5.174 -2.141 35.186 5 AA_DA7DC8:DG11DT12_DD A 7 ? D 12 ? A 8 ? D 11 ? 1 A DC 8 1_555 D DG 2 1_555 A DC 9 1_555 D DG 1 1_555 -0.475 -2.032 3.551 -4.524 4.342 33.284 -4.230 0.045 3.302 7.497 7.812 33.853 6 AA_DC8DC9:DG10DG11_DD A 8 ? D 11 ? A 9 ? D 10 ? 1 A DC 9 1_555 D DG 1 1_555 A DT 10 1_555 B DA 6 1_555 -0.892 -1.431 3.547 -1.904 -3.489 25.984 -2.094 1.386 3.758 -7.703 4.204 26.282 7 AA_DC9DT10:DA5DG10_BD A 9 ? D 10 ? A 10 ? B 5 ? 1 A DT 10 1_555 B DA 6 1_555 A DG 11 1_555 B DC 5 1_555 0.049 0.986 3.158 1.150 3.657 26.757 1.193 0.183 3.260 7.850 -2.469 27.025 8 AA_DT10DG11:DC4DA5_BB A 10 ? B 5 ? A 11 ? B 4 ? 1 A DG 11 1_555 B DC 5 1_555 A DA 12 1_555 B DT 4 1_555 -0.853 0.233 3.486 -3.486 6.112 40.292 -0.393 0.807 3.542 8.792 5.014 40.877 9 AA_DG11DA12:DT3DC4_BB A 11 ? B 4 ? A 12 ? B 3 ? 1 A DA 12 1_555 B DT 4 1_555 A DC 13 1_555 B DG 3 1_555 0.615 -1.116 3.353 1.358 1.066 32.568 -2.177 -0.854 3.338 1.899 -2.419 32.613 10 AA_DA12DC13:DG2DT3_BB A 12 ? B 3 ? A 13 ? B 2 ? 1 A DC 13 1_555 B DG 3 1_555 A DG 14 1_555 B DC 2 1_555 -0.360 0.246 3.109 -2.116 3.912 31.302 -0.243 0.284 3.132 7.205 3.898 31.608 11 AA_DC13DG14:DC1DG2_BB A 13 ? B 2 ? A 14 ? B 1 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.340 -0.831 3.298 -3.291 4.619 34.939 -2.040 -1.038 3.122 7.631 5.436 35.382 12 AA_DG14DG15:DC0DC1_BB A 14 ? B 1 ? A 15 ? B 0 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 C DT 8 1_555 -0.600 -0.638 3.136 -3.789 -2.236 33.011 -0.749 0.432 3.218 -3.914 6.631 33.295 13 AA_DG15DA16:DT8DC0_CB A 15 ? B 0 ? A 16 ? C 8 ? 1 A DA 16 1_555 C DT 8 1_555 A DA 17 1_555 C DT 7 1_555 -1.004 0.062 3.462 -1.586 -4.072 37.808 0.646 1.326 3.475 -6.258 2.438 38.050 14 AA_DA16DA17:DT7DT8_CC A 16 ? C 8 ? A 17 ? C 7 ? 1 A DA 17 1_555 C DT 7 1_555 A DA 18 1_555 C DT 6 1_555 0.225 -0.663 3.258 -2.432 2.328 36.723 -1.359 -0.682 3.191 3.686 3.851 36.872 15 AA_DA17DA18:DT6DT7_CC A 17 ? C 7 ? A 18 ? C 6 ? 1 A DA 18 1_555 C DT 6 1_555 A DT 19 1_555 C DA 5 1_555 0.263 -0.707 3.105 1.401 0.779 33.962 -1.328 -0.238 3.096 1.333 -2.397 33.998 16 AA_DA18DT19:DA5DT6_CC A 18 ? C 6 ? A 19 ? C 5 ? 1 A DT 19 1_555 C DA 5 1_555 A DT 20 1_555 C DA 4 1_555 -0.218 -0.006 3.225 3.639 0.726 32.317 -0.135 1.014 3.182 1.299 -6.512 32.523 17 AA_DT19DT20:DA4DA5_CC A 19 ? C 5 ? A 20 ? C 4 ? 1 A DT 20 1_555 C DA 4 1_555 A DA 21 1_555 C DT 3 1_555 0.044 2.063 3.510 -0.208 2.731 43.337 2.500 -0.081 3.627 3.693 0.281 43.420 18 AA_DT20DA21:DT3DA4_CC A 20 ? C 4 ? A 21 ? C 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' 1360635 1 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R01GM104960 2 'National Science Foundation (NSF, United States)' 'United States' NSF2004250 3 # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 5 'CACODYLATE ION' CAC 6 'MAGNESIUM ION' MG 7 '6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE' DAP 8 water HOH # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 5VY6 _pdbx_initial_refinement_model.details ? #