data_8VQV # _entry.id 8VQV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.404 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8VQV pdb_00008vqv 10.2210/pdb8vqv/pdb WWPDB D_1000280506 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-06-11 ? 2 'Structure model' 1 1 2025-08-06 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.title' 3 2 'Structure model' '_citation_author.identifier_ORCID' 4 2 'Structure model' '_citation_author.name' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8VQV _pdbx_database_status.recvd_initial_deposition_date 2024-01-19 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email adrian.ferre@gmail.com _pdbx_contact_author.name_first Adrian _pdbx_contact_author.name_last "Ferre-D'Amare" _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-4549-1619 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Jones, C.P.' 1 0000-0001-7780-5278 ;Ferre D'Amare, A.R. ; 2 0000-0003-4549-1619 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country GE _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev Angew.Chem.Int.Ed.Engl. _citation.journal_id_ASTM ACIEAY _citation.journal_id_CSD 0179 _citation.journal_id_ISSN 1521-3773 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 64 _citation.language ? _citation.page_first e202505971 _citation.page_last e202505971 _citation.title ;Machine Learning-Augmented Molecular Dynamics Simulations (MD) Reveal Insights Into the Disconnect Between Affinity and Activation of ZTP Riboswitch Ligands. ; _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/anie.202505971 _citation.pdbx_database_id_PubMed 40310613 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Fullenkamp, C.R.' 1 ? primary 'Mehdi, S.' 2 ? primary 'Jones, C.P.' 3 ? primary 'Tenney, L.' 4 ? primary 'Pichling, P.' 5 ? primary 'Prestwood, P.R.' 6 ? primary ;Ferre-D'Amare, A.R. ; 7 ? primary 'Tiwary, P.' 8 0000-0002-2412-6922 primary 'Schneekloth, J.S.' 9 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (64-MER)' 20782.453 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn '5-amino-1-(pyridin-3-yl)-1H-imidazole-4-carboxamide' 203.201 1 ? ? ? ? 4 water nat water 18.015 23 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCUUGCCGCCCGCCUGGGCAA _entity_poly.pdbx_seq_one_letter_code_can GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCUUGCCGCCCGCCUGGGCAA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 '5-amino-1-(pyridin-3-yl)-1H-imidazole-4-carboxamide' UG4 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 C n 1 6 G n 1 7 U n 1 8 G n 1 9 A n 1 10 C n 1 11 U n 1 12 G n 1 13 G n 1 14 C n 1 15 G n 1 16 A n 1 17 A n 1 18 C n 1 19 A n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 G n 1 25 G n 1 26 A n 1 27 A n 1 28 A n 1 29 C n 1 30 C n 1 31 A n 1 32 C n 1 33 C n 1 34 G n 1 35 G n 1 36 G n 1 37 G n 1 38 A n 1 39 G n 1 40 C n 1 41 G n 1 42 A n 1 43 C n 1 44 C n 1 45 C n 1 46 U n 1 47 U n 1 48 G n 1 49 C n 1 50 C n 1 51 G n 1 52 C n 1 53 C n 1 54 C n 1 55 G n 1 56 C n 1 57 C n 1 58 U n 1 59 G n 1 60 G n 1 61 G n 1 62 C n 1 63 A n 1 64 A n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 64 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Schaalia odontolytica' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1660 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 UG4 non-polymer . '5-amino-1-(pyridin-3-yl)-1H-imidazole-4-carboxamide' ? 'C9 H9 N5 O' 203.201 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 C 5 5 5 C C A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 G 8 8 8 G G A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 U 11 11 11 U U A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 C 14 14 14 C C A . n A 1 15 G 15 15 15 G G A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 A 19 19 19 A A A . n A 1 20 G 20 20 20 G G A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 G 23 23 23 G G A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 A 28 28 28 A A A . n A 1 29 C 29 29 29 C C A . n A 1 30 C 30 30 30 C C A . n A 1 31 A 31 31 31 A A A . n A 1 32 C 32 32 32 C C A . n A 1 33 C 33 33 33 C C A . n A 1 34 G 34 34 34 G G A . n A 1 35 G 35 35 35 G G A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 A 38 38 38 A A A . n A 1 39 G 39 39 39 G G A . n A 1 40 C 40 40 40 C C A . n A 1 41 G 41 41 41 G G A . n A 1 42 A 42 42 42 A A A . n A 1 43 C 43 43 43 C C A . n A 1 44 C 44 44 44 C C A . n A 1 45 C 45 45 45 C C A . n A 1 46 U 46 46 46 U U A . n A 1 47 U 47 47 47 U U A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 C 50 50 50 C C A . n A 1 51 G 51 51 51 G G A . n A 1 52 C 52 52 52 C C A . n A 1 53 C 53 53 53 C C A . n A 1 54 C 54 54 54 C C A . n A 1 55 G 55 55 55 G G A . n A 1 56 C 56 56 56 C C A . n A 1 57 C 57 57 57 C C A . n A 1 58 U 58 58 58 U U A . n A 1 59 G 59 59 59 G G A . n A 1 60 G 60 60 60 G G A . n A 1 61 G 61 61 61 G G A . n A 1 62 C 62 62 62 C C A . n A 1 63 A 63 63 63 A A A . n A 1 64 A 64 64 64 A A A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id UG4 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id UG4 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG A . C 2 MG 1 102 2 MG MO6 A . D 3 UG4 1 103 1 UG4 ZBY A . E 4 HOH 1 201 19 HOH HOH A . E 4 HOH 2 202 16 HOH HOH A . E 4 HOH 3 203 22 HOH HOH A . E 4 HOH 4 204 2 HOH MO6 A . E 4 HOH 5 205 25 HOH HOH A . E 4 HOH 6 206 15 HOH HOH A . E 4 HOH 7 207 4 HOH HOH A . E 4 HOH 8 208 8 HOH HOH A . E 4 HOH 9 209 5 HOH HOH A . E 4 HOH 10 210 24 HOH HOH A . E 4 HOH 11 211 11 HOH HOH A . E 4 HOH 12 212 2 HOH MO6 A . E 4 HOH 13 213 2 HOH HOH A . E 4 HOH 14 214 23 HOH HOH A . E 4 HOH 15 215 3 HOH HOH A . E 4 HOH 16 216 20 HOH HOH A . E 4 HOH 17 217 2 HOH MO6 A . E 4 HOH 18 218 2 HOH MO6 A . E 4 HOH 19 219 21 HOH HOH A . E 4 HOH 20 220 6 HOH HOH A . E 4 HOH 21 221 18 HOH HOH A . E 4 HOH 22 222 2 HOH MO6 A . E 4 HOH 23 223 2 HOH MO6 A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.19.2_4158: ???)' 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8VQV _cell.details ? _cell.formula_units_Z ? _cell.length_a 41.035 _cell.length_a_esd ? _cell.length_b 41.035 _cell.length_b_esd ? _cell.length_c 237.398 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8VQV _symmetry.cell_setting ? _symmetry.Int_Tables_number 96 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 43 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8VQV _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.40 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 48.84 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details TBD _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 294 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-03-15 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.105030 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 24-ID-C' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.105030 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 24-ID-C _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8VQV _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.43 _reflns.d_resolution_low 40.44 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 14549 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.63 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 12.0 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 16.27 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.998 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.09664 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.43 _reflns_shell.d_res_low 2.517 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 788 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.854 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8VQV _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.43 _refine.ls_d_res_low 40.44 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 14549 _refine.ls_number_reflns_R_free 1448 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.78 _refine.ls_percent_reflns_R_free 9.95 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2116 _refine.ls_R_factor_R_free 0.2556 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2068 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.36 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.28 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.49 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.43 _refine_hist.d_res_low 40.44 _refine_hist.number_atoms_solvent 17 _refine_hist.number_atoms_total 1416 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1376 _refine_hist.pdbx_number_atoms_ligand 23 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1562 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.073 ? 2440 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 14.650 ? 766 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.041 ? 319 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 67 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.43 2.52 . . 144 1295 100.00 . . . . 0.4953 . . . . . . . . . . . 0.5558 'X-RAY DIFFRACTION' 2.52 2.62 . . 148 1307 100.00 . . . . 0.3790 . . . . . . . . . . . 0.3647 'X-RAY DIFFRACTION' 2.62 2.74 . . 153 1320 100.00 . . . . 0.3475 . . . . . . . . . . . 0.3206 'X-RAY DIFFRACTION' 2.74 2.88 . . 140 1300 100.00 . . . . 0.3128 . . . . . . . . . . . 0.3766 'X-RAY DIFFRACTION' 2.88 3.06 . . 147 1313 100.00 . . . . 0.2920 . . . . . . . . . . . 0.3850 'X-RAY DIFFRACTION' 3.06 3.30 . . 143 1298 100.00 . . . . 0.2120 . . . . . . . . . . . 0.2722 'X-RAY DIFFRACTION' 3.30 3.63 . . 143 1321 100.00 . . . . 0.1968 . . . . . . . . . . . 0.2374 'X-RAY DIFFRACTION' 3.63 4.15 . . 144 1332 100.00 . . . . 0.1994 . . . . . . . . . . . 0.2507 'X-RAY DIFFRACTION' 4.15 5.23 . . 135 1311 100.00 . . . . 0.1696 . . . . . . . . . . . 0.2040 'X-RAY DIFFRACTION' 5.23 40.44 . . 151 1304 100.00 . . . . 0.1472 . . . . . . . . . . . 0.2000 # _struct.entry_id 8VQV _struct.title 'Structure of S. odontolytica ZTP riboswitch bound to m-1-pyridinyl-AICA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8VQV _struct_keywords.text 'riboswitch, drug, synthetic, aptamer, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8VQV _struct_ref.pdbx_db_accession 8VQV _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8VQV _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 64 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8VQV _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 64 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 64 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4550 ? 1 MORE -68 ? 1 'SSA (A^2)' 19320 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'isothermal titration calorimetry' _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 7_555 y,x,-z 0.0000000000 1.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 11 OP1 ? ? ? 1_555 B MG . MG ? ? A U 11 A MG 101 7_555 ? ? ? ? ? ? ? 2.071 ? ? metalc2 metalc ? ? A C 29 OP2 ? ? ? 1_555 B MG . MG ? ? A C 29 A MG 101 7_555 ? ? ? ? ? ? ? 1.929 ? ? metalc3 metalc ? ? B MG . MG ? ? ? 1_555 D UG4 . O06 ? ? A MG 101 A UG4 103 1_555 ? ? ? ? ? ? ? 2.067 ? ? metalc4 metalc ? ? B MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 101 A HOH 207 1_555 ? ? ? ? ? ? ? 2.240 ? ? metalc5 metalc ? ? B MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 101 A HOH 213 1_555 ? ? ? ? ? ? ? 2.017 ? ? metalc6 metalc ? ? B MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 101 A HOH 215 7_555 ? ? ? ? ? ? ? 2.288 ? ? metalc7 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 204 1_555 ? ? ? ? ? ? ? 2.184 ? ? metalc8 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 212 1_555 ? ? ? ? ? ? ? 2.190 ? ? metalc9 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 217 1_555 ? ? ? ? ? ? ? 2.190 ? ? metalc10 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 218 1_555 ? ? ? ? ? ? ? 2.184 ? ? metalc11 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 222 1_555 ? ? ? ? ? ? ? 2.181 ? ? metalc12 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 223 1_555 ? ? ? ? ? ? ? 2.183 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 45 N3 ? ? A G 1 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 45 O2 ? ? A G 1 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 1 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 2 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 2 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 2 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 3 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 3 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 3 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 4 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 4 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 41 N1 ? ? A C 5 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 41 O6 ? ? A C 5 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 41 N2 ? ? A C 5 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 6 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 6 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 6 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 N3 ? ? ? 1_555 A G 39 O6 ? ? A U 7 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A U 7 O2 ? ? ? 1_555 A G 39 N1 ? ? A U 7 A G 39 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 8 N2 ? ? ? 1_555 A A 38 N7 ? ? A G 8 A A 38 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog21 hydrog ? ? A G 8 N3 ? ? ? 1_555 A A 38 N6 ? ? A G 8 A A 38 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog22 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 37 N3 ? ? A A 9 A G 37 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog23 hydrog ? ? A A 9 N7 ? ? ? 1_555 A G 37 N2 ? ? A A 9 A G 37 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 10 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 10 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 10 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A U 11 N3 ? ? ? 1_555 A G 35 O6 ? ? A U 11 A G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog28 hydrog ? ? A U 11 O2 ? ? ? 1_555 A G 35 N1 ? ? A U 11 A G 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A G 12 N2 ? ? ? 1_555 A A 28 N3 ? ? A G 12 A A 28 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog30 hydrog ? ? A A 19 N3 ? ? ? 1_555 A G 34 N2 ? ? A A 19 A G 34 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog31 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 20 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 20 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 20 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 21 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 21 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 21 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 31 N1 ? ? A U 22 A A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 31 N6 ? ? A U 22 A A 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 23 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 23 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 23 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 24 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 24 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 24 A C 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 46 N3 ? ? ? 1_555 A A 64 N1 ? ? A U 46 A A 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 46 O4 ? ? ? 1_555 A A 64 N6 ? ? A U 46 A A 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 47 N3 ? ? ? 1_555 A A 63 N1 ? ? A U 47 A A 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A U 47 O4 ? ? ? 1_555 A A 63 N6 ? ? A U 47 A A 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 48 N1 ? ? ? 1_555 A C 62 N3 ? ? A G 48 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 48 N2 ? ? ? 1_555 A C 62 O2 ? ? A G 48 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 48 O6 ? ? ? 1_555 A C 62 N4 ? ? A G 48 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 49 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 49 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 49 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 50 N3 ? ? ? 1_555 A G 60 N1 ? ? A C 50 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 50 N4 ? ? ? 1_555 A G 60 O6 ? ? A C 50 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 50 O2 ? ? ? 1_555 A G 60 N2 ? ? A C 50 A G 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 51 O6 ? ? ? 1_555 A G 59 N1 ? ? A G 51 A G 59 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 11 ? A U 11 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 OP2 ? A C 29 ? A C 29 ? 1_555 173.6 ? 2 OP1 ? A U 11 ? A U 11 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O06 ? D UG4 . ? A UG4 103 ? 1_555 22.0 ? 3 OP2 ? A C 29 ? A C 29 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O06 ? D UG4 . ? A UG4 103 ? 1_555 154.5 ? 4 OP1 ? A U 11 ? A U 11 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 207 ? 1_555 19.5 ? 5 OP2 ? A C 29 ? A C 29 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 207 ? 1_555 156.6 ? 6 O06 ? D UG4 . ? A UG4 103 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 207 ? 1_555 3.0 ? 7 OP1 ? A U 11 ? A U 11 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 213 ? 1_555 23.6 ? 8 OP2 ? A C 29 ? A C 29 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 213 ? 1_555 152.4 ? 9 O06 ? D UG4 . ? A UG4 103 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 213 ? 1_555 2.9 ? 10 O ? E HOH . ? A HOH 207 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 213 ? 1_555 4.2 ? 11 OP1 ? A U 11 ? A U 11 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 215 ? 7_555 22.1 ? 12 OP2 ? A C 29 ? A C 29 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 215 ? 7_555 153.4 ? 13 O06 ? D UG4 . ? A UG4 103 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 215 ? 7_555 4.7 ? 14 O ? E HOH . ? A HOH 207 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 215 ? 7_555 3.8 ? 15 O ? E HOH . ? A HOH 213 ? 1_555 MG ? B MG . ? A MG 101 ? 7_555 O ? E HOH . ? A HOH 215 ? 7_555 2.9 ? 16 O ? E HOH . ? A HOH 204 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 212 ? 1_555 91.5 ? 17 O ? E HOH . ? A HOH 204 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 217 ? 1_555 90.1 ? 18 O ? E HOH . ? A HOH 212 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 217 ? 1_555 178.5 ? 19 O ? E HOH . ? A HOH 204 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 218 ? 1_555 90.7 ? 20 O ? E HOH . ? A HOH 212 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 218 ? 1_555 91.0 ? 21 O ? E HOH . ? A HOH 217 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 218 ? 1_555 89.0 ? 22 O ? E HOH . ? A HOH 204 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 222 ? 1_555 88.0 ? 23 O ? E HOH . ? A HOH 212 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 222 ? 1_555 88.5 ? 24 O ? E HOH . ? A HOH 217 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 222 ? 1_555 91.6 ? 25 O ? E HOH . ? A HOH 218 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 222 ? 1_555 178.6 ? 26 O ? E HOH . ? A HOH 204 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 223 ? 1_555 179.6 ? 27 O ? E HOH . ? A HOH 212 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 223 ? 1_555 88.8 ? 28 O ? E HOH . ? A HOH 217 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 223 ? 1_555 89.7 ? 29 O ? E HOH . ? A HOH 218 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 223 ? 1_555 89.6 ? 30 O ? E HOH . ? A HOH 222 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 223 ? 1_555 91.6 ? # _pdbx_entry_details.entry_id 8VQV _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined -24.7525 -3.0186 -17.6655 0.6068 ? -0.0125 ? -0.1398 ? 0.5653 ? 0.0132 ? 0.5175 ? 2.0149 ? -0.1541 ? -0.6723 ? 3.7085 ? 0.0554 ? 2.7772 ? 0.1079 ? 0.1599 ? -0.1906 ? 0.1867 ? -0.2908 ? -0.2344 ? -0.0420 ? 0.3352 ? 0.2094 ? 2 'X-RAY DIFFRACTION' ? refined -30.7307 -6.9515 -16.9506 0.5414 ? 0.0738 ? -0.1004 ? 0.5070 ? -0.0244 ? 0.6245 ? 1.7222 ? 0.0400 ? -1.0869 ? 4.4784 ? -0.0748 ? 2.7813 ? -0.0580 ? 0.0592 ? -0.6513 ? 0.1690 ? -0.0963 ? 0.7766 ? 0.1919 ? -0.2502 ? 0.1390 ? 3 'X-RAY DIFFRACTION' ? refined 2.2278 -24.6410 6.6367 0.5325 ? -0.0197 ? -0.0888 ? 1.1888 ? 0.2565 ? 0.6362 ? 0.4231 ? -0.0420 ? -0.6269 ? 0.6918 ? 1.0482 ? 2.4301 ? -0.0154 ? 1.6926 ? 0.8024 ? -0.2802 ? -0.0743 ? 0.2102 ? -0.1280 ? 0.1165 ? 0.0542 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 1 through 20 ) ; 2 'X-RAY DIFFRACTION' 2 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 21 through 45 ) ; 3 'X-RAY DIFFRACTION' 3 ? ? ? ? ? ? ? ? ? ? ? ;chain 'A' and (resid 46 through 64 ) ; # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 MG MG MG N N 114 U OP3 O N N 115 U P P N N 116 U OP1 O N N 117 U OP2 O N N 118 U "O5'" O N N 119 U "C5'" C N N 120 U "C4'" C N R 121 U "O4'" O N N 122 U "C3'" C N S 123 U "O3'" O N N 124 U "C2'" C N R 125 U "O2'" O N N 126 U "C1'" C N R 127 U N1 N N N 128 U C2 C N N 129 U O2 O N N 130 U N3 N N N 131 U C4 C N N 132 U O4 O N N 133 U C5 C N N 134 U C6 C N N 135 U HOP3 H N N 136 U HOP2 H N N 137 U "H5'" H N N 138 U "H5''" H N N 139 U "H4'" H N N 140 U "H3'" H N N 141 U "HO3'" H N N 142 U "H2'" H N N 143 U "HO2'" H N N 144 U "H1'" H N N 145 U H3 H N N 146 U H5 H N N 147 U H6 H N N 148 UG4 C10 C Y N 149 UG4 N12 N Y N 150 UG4 C13 C Y N 151 UG4 C15 C Y N 152 UG4 C02 C Y N 153 UG4 C03 C Y N 154 UG4 C04 C N N 155 UG4 C08 C Y N 156 UG4 C11 C Y N 157 UG4 C14 C Y N 158 UG4 N01 N N N 159 UG4 N05 N N N 160 UG4 N07 N Y N 161 UG4 N09 N Y N 162 UG4 O06 O N N 163 UG4 H1 H N N 164 UG4 H2 H N N 165 UG4 H3 H N N 166 UG4 H4 H N N 167 UG4 H5 H N N 168 UG4 H6 H N N 169 UG4 H7 H N N 170 UG4 H8 H N N 171 UG4 H9 H N N 172 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 UG4 N01 C02 sing N N 153 UG4 O06 C04 doub N N 154 UG4 C04 N05 sing N N 155 UG4 C04 C03 sing N N 156 UG4 C02 C03 doub Y N 157 UG4 C02 N09 sing Y N 158 UG4 N12 C13 doub Y N 159 UG4 N12 C11 sing Y N 160 UG4 C13 C14 sing Y N 161 UG4 C11 C10 doub Y N 162 UG4 C14 C15 doub Y N 163 UG4 C03 N07 sing Y N 164 UG4 C10 C15 sing Y N 165 UG4 C10 N09 sing N N 166 UG4 N09 C08 sing Y N 167 UG4 N07 C08 doub Y N 168 UG4 C13 H1 sing N N 169 UG4 C15 H2 sing N N 170 UG4 C08 H3 sing N N 171 UG4 C11 H4 sing N N 172 UG4 C14 H5 sing N N 173 UG4 N01 H6 sing N N 174 UG4 N01 H7 sing N N 175 UG4 N05 H8 sing N N 176 UG4 N05 H9 sing N N 177 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8VQV 'double helix' 8VQV 'a-form double helix' 8VQV 'hairpin loop' 8VQV 'bulge loop' 8VQV 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 12 1_555 A A 28 1_555 -2.239 6.964 -1.756 -38.457 3.606 150.239 1 A_G12:A28_A A 12 ? A 28 ? ? 11 1 A C 29 1_555 A G 24 1_555 0.719 -0.054 -0.622 22.707 -25.748 3.904 2 A_C29:G24_A A 29 ? A 24 ? 19 1 1 A C 30 1_555 A G 23 1_555 0.032 -0.569 -0.666 9.835 -14.945 0.767 3 A_C30:G23_A A 30 ? A 23 ? 19 1 1 A A 31 1_555 A U 22 1_555 0.017 -0.328 0.186 3.843 -7.373 3.529 4 A_A31:U22_A A 31 ? A 22 ? 20 1 1 A C 32 1_555 A G 21 1_555 -0.147 -0.272 -0.093 8.372 -10.529 -1.183 5 A_C32:G21_A A 32 ? A 21 ? 19 1 1 A C 33 1_555 A G 20 1_555 0.616 -0.043 -0.604 12.229 -15.753 2.753 6 A_C33:G20_A A 33 ? A 20 ? 19 1 1 A G 34 1_555 A A 19 1_555 -2.467 -7.053 2.096 -52.069 4.054 -149.341 7 A_G34:A19_A A 34 ? A 19 ? ? 6 1 A G 35 1_555 A U 11 1_555 -2.216 -0.303 -0.401 -24.181 -16.974 8.238 8 A_G35:U11_A A 35 ? A 11 ? 28 1 1 A G 36 1_555 A C 10 1_555 -0.070 0.007 0.184 -3.973 -7.525 3.397 9 A_G36:C10_A A 36 ? A 10 ? 19 1 1 A G 37 1_555 A A 9 1_555 6.907 -4.957 0.144 0.969 -11.823 -9.839 10 A_G37:A9_A A 37 ? A 9 ? 11 10 1 A A 38 1_555 A G 8 1_555 -6.777 -4.700 -0.281 7.998 -1.651 -12.774 11 A_A38:G8_A A 38 ? A 8 ? 11 10 1 A G 39 1_555 A U 7 1_555 -2.254 -0.548 0.289 10.802 -14.597 0.831 12 A_G39:U7_A A 39 ? A 7 ? 28 1 1 A C 40 1_555 A G 6 1_555 -0.276 -0.119 0.208 2.435 -11.995 2.715 13 A_C40:G6_A A 40 ? A 6 ? 19 1 1 A G 41 1_555 A C 5 1_555 -0.065 -0.124 0.297 3.134 -5.744 5.447 14 A_G41:C5_A A 41 ? A 5 ? 19 1 1 A A 42 1_555 A U 4 1_555 -0.181 -0.089 0.074 9.151 -19.938 -0.554 15 A_A42:U4_A A 42 ? A 4 ? 20 1 1 A C 43 1_555 A G 3 1_555 0.262 0.054 -0.584 23.454 -22.177 7.526 16 A_C43:G3_A A 43 ? A 3 ? 19 1 1 A C 44 1_555 A G 2 1_555 -0.146 -0.430 0.234 1.691 -8.172 0.956 17 A_C44:G2_A A 44 ? A 2 ? 19 1 1 A C 45 1_555 A G 1 1_555 0.296 -0.068 0.638 -8.785 -12.000 5.657 18 A_C45:G1_A A 45 ? A 1 ? 19 1 1 A U 46 1_555 A A 64 1_555 -0.240 0.145 0.275 -26.596 -6.197 8.210 19 A_U46:A64_A A 46 ? A 64 ? 20 1 1 A U 47 1_555 A A 63 1_555 -0.267 0.211 0.118 0.894 -6.231 0.876 20 A_U47:A63_A A 47 ? A 63 ? 20 1 1 A G 48 1_555 A C 62 1_555 -0.427 -0.099 0.026 3.546 -12.575 2.287 21 A_G48:C62_A A 48 ? A 62 ? 19 1 1 A C 49 1_555 A G 61 1_555 0.386 -0.477 -0.258 4.127 -10.510 -2.912 22 A_C49:G61_A A 49 ? A 61 ? 19 1 1 A C 50 1_555 A G 60 1_555 0.233 0.011 -0.032 3.170 8.755 0.803 23 A_C50:G60_A A 50 ? A 60 ? 19 1 1 A G 51 1_555 A G 59 1_555 -1.606 -2.654 0.724 3.295 -44.192 124.075 24 A_G51:G59_A A 51 ? A 59 ? ? 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 29 1_555 A G 24 1_555 A C 30 1_555 A G 23 1_555 -1.080 -1.635 3.489 -1.569 16.177 27.365 -5.801 1.701 2.253 30.973 3.004 31.748 1 AA_C29C30:G23G24_AA A 29 ? A 24 ? A 30 ? A 23 ? 1 A C 30 1_555 A G 23 1_555 A A 31 1_555 A U 22 1_555 -0.091 -1.291 3.578 -4.538 10.973 30.495 -4.257 -0.649 2.934 19.938 8.245 32.674 2 AA_C30A31:U22G23_AA A 30 ? A 23 ? A 31 ? A 22 ? 1 A A 31 1_555 A U 22 1_555 A C 32 1_555 A G 21 1_555 0.060 -1.317 3.195 3.200 10.996 30.166 -4.158 0.412 2.564 20.234 -5.889 32.220 3 AA_A31C32:G21U22_AA A 31 ? A 22 ? A 32 ? A 21 ? 1 A C 32 1_555 A G 21 1_555 A C 33 1_555 A G 20 1_555 0.646 -1.625 3.071 5.793 9.659 32.284 -4.127 -0.286 2.568 16.747 -10.044 34.143 4 AA_C32C33:G20G21_AA A 32 ? A 21 ? A 33 ? A 20 ? 1 A C 33 1_555 A G 20 1_555 A G 34 1_555 A A 19 1_555 -3.228 1.248 3.774 17.920 31.212 112.134 0.349 2.127 3.588 18.542 -10.646 115.865 5 AA_C33G34:A19G20_AA A 33 ? A 20 ? A 34 ? A 19 ? 1 A G 34 1_555 A A 19 1_555 A G 35 1_555 A U 11 1_555 1.409 -4.559 4.658 -4.580 -9.150 -36.705 8.487 1.412 3.603 14.194 -7.104 -38.057 6 AA_G34G35:U11A19_AA A 34 ? A 19 ? A 35 ? A 11 ? 1 A G 35 1_555 A U 11 1_555 A G 36 1_555 A C 10 1_555 -1.111 -2.243 2.819 -5.353 4.049 23.591 -6.340 1.220 2.589 9.655 12.765 24.515 7 AA_G35G36:C10U11_AA A 35 ? A 11 ? A 36 ? A 10 ? 1 A G 36 1_555 A C 10 1_555 A G 37 1_555 A A 9 1_555 -1.096 -0.353 3.392 1.964 3.892 68.537 -0.462 1.047 3.342 3.452 -1.742 68.658 8 AA_G36G37:A9C10_AA A 36 ? A 10 ? A 37 ? A 9 ? 1 A G 37 1_555 A A 9 1_555 A A 38 1_555 A G 8 1_555 -0.415 -0.810 3.270 2.163 1.812 -34.898 1.071 -0.362 3.325 -3.015 3.599 -35.009 9 AA_G37A38:G8A9_AA A 37 ? A 9 ? A 38 ? A 8 ? 1 A A 38 1_555 A G 8 1_555 A G 39 1_555 A U 7 1_555 1.214 -0.979 3.352 -4.780 -0.115 56.795 -1.020 -1.539 3.250 -0.120 5.016 56.980 10 AA_A38G39:U7G8_AA A 38 ? A 8 ? A 39 ? A 7 ? 1 A G 39 1_555 A U 7 1_555 A C 40 1_555 A G 6 1_555 -0.148 -1.368 3.394 -2.203 1.695 44.649 -1.957 -0.013 3.346 2.228 2.896 44.731 11 AA_G39C40:G6U7_AA A 39 ? A 7 ? A 40 ? A 6 ? 1 A C 40 1_555 A G 6 1_555 A G 41 1_555 A C 5 1_555 -0.508 -1.991 2.974 -1.701 10.381 29.990 -5.195 0.675 2.204 19.328 3.167 31.741 12 AA_C40G41:C5G6_AA A 40 ? A 6 ? A 41 ? A 5 ? 1 A G 41 1_555 A C 5 1_555 A A 42 1_555 A U 4 1_555 -0.205 -1.103 3.148 4.216 5.562 29.671 -3.130 1.171 2.844 10.676 -8.092 30.462 13 AA_G41A42:U4C5_AA A 41 ? A 5 ? A 42 ? A 4 ? 1 A A 42 1_555 A U 4 1_555 A C 43 1_555 A G 3 1_555 0.552 -0.826 2.766 5.131 12.105 31.724 -2.955 -0.278 2.362 21.049 -8.923 34.276 14 AA_A42C43:G3U4_AA A 42 ? A 4 ? A 43 ? A 3 ? 1 A C 43 1_555 A G 3 1_555 A C 44 1_555 A G 2 1_555 -0.512 -2.106 3.718 -11.910 15.107 31.046 -5.541 -0.890 2.497 25.400 20.024 36.398 15 AA_C43C44:G2G3_AA A 43 ? A 3 ? A 44 ? A 2 ? 1 A C 44 1_555 A G 2 1_555 A C 45 1_555 A G 1 1_555 0.483 -1.855 3.240 -1.223 7.390 35.941 -3.890 -0.924 2.799 11.817 1.955 36.688 16 AA_C44C45:G1G2_AA A 44 ? A 2 ? A 45 ? A 1 ? 1 A C 45 1_555 A G 1 1_555 A U 46 1_555 A A 64 1_555 1.720 -0.616 3.591 7.878 3.353 41.707 -1.235 -1.463 3.782 4.651 -10.927 42.539 17 AA_C45U46:A64G1_AA A 45 ? A 1 ? A 46 ? A 64 ? 1 A U 46 1_555 A A 64 1_555 A U 47 1_555 A A 63 1_555 0.050 -1.498 2.655 1.364 0.266 26.496 -3.321 0.182 2.640 0.579 -2.974 26.532 18 AA_U46U47:A63A64_AA A 46 ? A 64 ? A 47 ? A 63 ? 1 A U 47 1_555 A A 63 1_555 A G 48 1_555 A C 62 1_555 0.301 -1.533 3.229 -0.289 3.234 30.651 -3.492 -0.620 3.052 6.097 0.544 30.818 19 AA_U47G48:C62A63_AA A 47 ? A 63 ? A 48 ? A 62 ? 1 A G 48 1_555 A C 62 1_555 A C 49 1_555 A G 61 1_555 -0.973 -1.791 3.225 -2.900 -0.170 35.773 -2.882 1.164 3.300 -0.276 4.711 35.887 20 AA_G48C49:G61C62_AA A 48 ? A 62 ? A 49 ? A 61 ? 1 A C 49 1_555 A G 61 1_555 A C 50 1_555 A G 60 1_555 -0.241 -2.280 3.378 -1.154 10.299 31.078 -5.696 0.243 2.521 18.585 2.082 32.720 21 AA_C49C50:G60G61_AA A 49 ? A 61 ? A 50 ? A 60 ? 1 A C 50 1_555 A G 60 1_555 A G 51 1_555 A G 59 1_555 -1.631 -2.673 0.034 -164.834 50.807 98.246 -1.369 0.716 0.530 25.673 83.291 175.085 22 AA_C50G51:G59G60_AA A 50 ? A 60 ? A 51 ? A 59 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 4XWF _pdbx_initial_refinement_model.details 'Ions and ligands removed' # _atom_sites.entry_id 8VQV _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.024369 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.024369 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004212 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #