data_8XZO # _entry.id 8XZO # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8XZO pdb_00008xzo 10.2210/pdb8xzo/pdb WWPDB D_1300044558 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-07-24 2 'Structure model' 1 1 2024-08-21 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # _pdbx_audit_revision_category.ordinal 1 _pdbx_audit_revision_category.revision_ordinal 2 _pdbx_audit_revision_category.data_content_type 'Structure model' _pdbx_audit_revision_category.category citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8XZO _pdbx_database_status.recvd_initial_deposition_date 2024-01-21 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, C.Y.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 52 _citation.language ? _citation.page_first 8454 _citation.page_last 8465 _citation.title 'Structure-based characterization and compound identification of the wild-type THF class-II riboswitch.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkae377 _citation.pdbx_database_id_PubMed 38769061 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, C.' 1 ? primary 'Xu, X.' 2 ? primary 'Geng, Z.' 3 ? primary 'Zheng, L.' 4 ? primary 'Song, Q.' 5 ? primary 'Shen, X.' 6 ? primary 'Wu, J.' 7 ? primary 'Zhao, J.' 8 ? primary 'Li, H.' 9 ? primary 'He, M.' 10 ? primary 'Tai, X.' 11 ? primary 'Zhang, L.' 12 0000-0001-8139-0474 primary 'Ma, J.' 13 ? primary 'Dong, Y.' 14 ? primary 'Ren, A.' 15 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (53-MER)' 17174.043 1 ? ? ? ? 2 non-polymer syn SPERMINE 202.340 1 ? ? ? ? 3 non-polymer syn GUANINE 151.126 1 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 4 ? ? ? ? 5 water nat water 18.015 24 ? ? ? ? # _entity_name_com.entity_id 1 _entity_name_com.name env6 # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGUGUGUACCGUUCAACUCGUCCCAGCUUCGACUGGGACUACGGGAGCGCCU' _entity_poly.pdbx_seq_one_letter_code_can GGGUGUGUACCGUUCAACUCGUCCCAGCUUCGACUGGGACUACGGGAGCGCCU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 SPERMINE SPM 3 GUANINE GUN 4 'MAGNESIUM ION' MG 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 U n 1 5 G n 1 6 U n 1 7 G n 1 8 U n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 U n 1 14 U n 1 15 C n 1 16 A n 1 17 A n 1 18 C n 1 19 U n 1 20 C n 1 21 G n 1 22 U n 1 23 C n 1 24 C n 1 25 C n 1 26 A n 1 27 G n 1 28 C n 1 29 U n 1 30 U n 1 31 C n 1 32 G n 1 33 A n 1 34 C n 1 35 U n 1 36 G n 1 37 G n 1 38 G n 1 39 A n 1 40 C n 1 41 U n 1 42 A n 1 43 C n 1 44 G n 1 45 G n 1 46 G n 1 47 A n 1 48 G n 1 49 C n 1 50 G n 1 51 C n 1 52 C n 1 53 U n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 53 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'unidentified eubacterium clone A70' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 41312 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 GUN non-polymer . GUANINE ? 'C5 H5 N5 O' 151.126 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 SPM non-polymer . SPERMINE ? 'C10 H26 N4' 202.340 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 U 8 8 8 U U A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 C 28 28 28 C C A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 C 34 34 34 C C A . n A 1 35 U 35 35 35 U U A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 U 41 41 41 U U A . n A 1 42 A 42 42 42 A A A . n A 1 43 C 43 43 43 C C A . n A 1 44 G 44 44 44 G G A . n A 1 45 G 45 45 45 G G A . n A 1 46 G 46 46 46 G G A . n A 1 47 A 47 47 47 A A A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 G 50 50 50 G G A . n A 1 51 C 51 51 51 C C A . n A 1 52 C 52 52 52 C C A . n A 1 53 U 53 53 53 U U A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SPM 1 201 201 SPM SPM A . C 3 GUN 1 202 101 GUN GUN A . D 4 MG 1 203 1 MG MG A . E 4 MG 1 204 2 MG MG A . F 4 MG 1 205 3 MG MG A . G 4 MG 1 206 4 MG MG A . H 5 HOH 1 301 1 HOH HOH A . H 5 HOH 2 302 12 HOH HOH A . H 5 HOH 3 303 8 HOH HOH A . H 5 HOH 4 304 17 HOH HOH A . H 5 HOH 5 305 5 HOH HOH A . H 5 HOH 6 306 16 HOH HOH A . H 5 HOH 7 307 7 HOH HOH A . H 5 HOH 8 308 19 HOH HOH A . H 5 HOH 9 309 3 HOH HOH A . H 5 HOH 10 310 20 HOH HOH A . H 5 HOH 11 311 9 HOH HOH A . H 5 HOH 12 312 13 HOH HOH A . H 5 HOH 13 313 24 HOH HOH A . H 5 HOH 14 314 2 HOH HOH A . H 5 HOH 15 315 23 HOH HOH A . H 5 HOH 16 316 10 HOH HOH A . H 5 HOH 17 317 6 HOH HOH A . H 5 HOH 18 318 11 HOH HOH A . H 5 HOH 19 319 4 HOH HOH A . H 5 HOH 20 320 21 HOH HOH A . H 5 HOH 21 321 15 HOH HOH A . H 5 HOH 22 322 14 HOH HOH A . H 5 HOH 23 323 22 HOH HOH A . H 5 HOH 24 324 18 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.18.2_3874: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8XZO _cell.details ? _cell.formula_units_Z ? _cell.length_a 50.018 _cell.length_a_esd ? _cell.length_b 57.795 _cell.length_b_esd ? _cell.length_c 62.454 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8XZO _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8XZO _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.71 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 54.58 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.08 M Sodium chloride, 0.04 M Sodium cacodylate trihydrate pH 7.0, 30% v/v MPD, 0.012 M Spermine tetrahydrochloride' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-09-03 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97853 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97853 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8XZO _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 1.26 _reflns.d_resolution_low 37.82 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 34010 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 67.4 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.8 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 12.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.75 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.056 _reflns.pdbx_Rpim_I_all 0.017 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all 367905 _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.054 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 1.26 _reflns_shell.d_res_low 1.32 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1286 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy 2.6 _reflns_shell.pdbx_chi_squared 0.64 _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all 0.199 _reflns_shell.pdbx_Rpim_I_all 0.790 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.303 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.603 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8XZO _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 1.97 _refine.ls_d_res_low 26.23 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 12267 _refine.ls_number_reflns_R_free 1214 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 91.46 _refine.ls_percent_reflns_R_free 9.90 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2126 _refine.ls_R_factor_R_free 0.2416 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2094 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.38 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.85 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.28 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1104 _refine_hist.pdbx_number_atoms_ligand 61 _refine_hist.number_atoms_solvent 24 _refine_hist.number_atoms_total 1189 _refine_hist.d_res_high 1.97 _refine_hist.d_res_low 26.23 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1290 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.072 ? 1999 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 14.941 ? 646 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.042 ? 264 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 54 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 1.97 2.04 . . 145 1301 100.00 . . . . 0.2831 . . . . . . . . . . . 0.3507 'X-RAY DIFFRACTION' 2.04 2.14 . . 90 808 61.00 . . . . 0.2856 . . . . . . . . . . . 0.3364 'X-RAY DIFFRACTION' 2.14 2.24 . . 132 1265 100.00 . . . . 0.2886 . . . . . . . . . . . 0.3360 'X-RAY DIFFRACTION' 2.26 2.39 . . 136 1156 100.00 . . . . 0.2890 . . . . . . . . . . . 0.2733 'X-RAY DIFFRACTION' 2.39 2.57 . . 151 1318 100.00 . . . . 0.3034 . . . . . . . . . . . 0.3213 'X-RAY DIFFRACTION' 2.57 2.83 . . 116 1170 87.00 . . . . 0.3272 . . . . . . . . . . . 0.3755 'X-RAY DIFFRACTION' 2.83 3.24 . . 150 1335 100.00 . . . . 0.2564 . . . . . . . . . . . 0.3150 'X-RAY DIFFRACTION' 3.24 4.08 . . 138 1260 92.00 . . . . 0.1858 . . . . . . . . . . . 0.2248 'X-RAY DIFFRACTION' 4.08 26.23 . . 156 1440 100.00 . . . . 0.1407 . . . . . . . . . . . 0.1570 # _struct.entry_id 8XZO _struct.title 'Crystal structure of folE riboswitch with Guanine' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8XZO _struct_keywords.text 'riboswitch, Guanine, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 4 ? F N N 4 ? G N N 4 ? H N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8XZO _struct_ref.pdbx_db_accession 8XZO _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8XZO _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 53 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8XZO _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 53 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 53 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'isothermal titration calorimetry' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.607 ? ? metalc1 metalc ? ? A G 5 O6 ? ? ? 1_555 E MG . MG ? ? A G 5 A MG 204 1_555 ? ? ? ? ? ? ? 2.830 ? ? metalc2 metalc ? ? A G 38 O6 ? ? ? 1_555 F MG . MG ? ? A G 38 A MG 205 1_555 ? ? ? ? ? ? ? 2.693 ? ? metalc3 metalc ? ? A U 53 "O3'" ? ? ? 1_555 G MG . MG ? ? A U 53 A MG 206 1_555 ? ? ? ? ? ? ? 2.845 ? ? metalc4 metalc ? ? A U 53 "O2'" ? ? ? 1_555 G MG . MG ? ? A U 53 A MG 206 1_555 ? ? ? ? ? ? ? 1.873 ? ? metalc5 metalc ? ? D MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 203 A HOH 308 1_555 ? ? ? ? ? ? ? 1.952 ? ? metalc6 metalc ? ? D MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 203 A HOH 310 1_555 ? ? ? ? ? ? ? 1.982 ? ? metalc7 metalc ? ? E MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 204 A HOH 319 1_555 ? ? ? ? ? ? ? 2.239 ? ? metalc8 metalc ? ? E MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 204 A HOH 320 1_555 ? ? ? ? ? ? ? 2.793 ? ? metalc9 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 205 A HOH 303 1_555 ? ? ? ? ? ? ? 2.540 ? ? metalc10 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 205 A HOH 313 1_555 ? ? ? ? ? ? ? 2.229 ? ? metalc11 metalc ? ? F MG . MG ? ? ? 1_555 H HOH . O ? ? A MG 205 A HOH 323 1_555 ? ? ? ? ? ? ? 2.076 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A U 53 O2 ? ? A GTP 1 A U 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A U 53 N3 ? ? A GTP 1 A U 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 52 N3 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 52 O2 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 52 N4 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A G 50 O6 ? ? A U 4 A G 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog10 hydrog ? ? A U 4 O2 ? ? ? 1_555 A G 50 N1 ? ? A U 4 A G 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 48 O6 ? ? A U 6 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 48 N1 ? ? A U 6 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A G 7 N2 ? ? ? 1_555 A A 47 N7 ? ? A G 7 A A 47 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog17 hydrog ? ? A G 7 N3 ? ? ? 1_555 A A 47 N6 ? ? A G 7 A A 47 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 46 N3 ? ? A A 9 A G 46 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A A 9 N7 ? ? ? 1_555 A G 46 N2 ? ? A A 9 A G 46 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog20 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 45 N1 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 45 O6 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 45 N2 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 44 N1 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 44 O6 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 44 N2 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 13 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 13 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 17 N7 ? ? A U 14 A A 17 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 14 A A 17 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog33 hydrog ? ? A A 16 N6 ? ? ? 1_555 A C 43 O2 ? ? A A 16 A C 43 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog34 hydrog ? ? A A 17 N6 ? ? ? 1_555 A A 42 N3 ? ? A A 17 A A 42 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 35 N3 ? ? A A 26 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 35 O4 ? ? A A 26 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O6 ? A G 5 ? A G 5 ? 1_555 MG ? E MG . ? A MG 204 ? 1_555 O ? H HOH . ? A HOH 319 ? 1_555 79.2 ? 2 O6 ? A G 5 ? A G 5 ? 1_555 MG ? E MG . ? A MG 204 ? 1_555 O ? H HOH . ? A HOH 320 ? 1_555 98.1 ? 3 O ? H HOH . ? A HOH 319 ? 1_555 MG ? E MG . ? A MG 204 ? 1_555 O ? H HOH . ? A HOH 320 ? 1_555 126.0 ? 4 O6 ? A G 38 ? A G 38 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 303 ? 1_555 116.6 ? 5 O6 ? A G 38 ? A G 38 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 313 ? 1_555 85.6 ? 6 O ? H HOH . ? A HOH 303 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 313 ? 1_555 138.1 ? 7 O6 ? A G 38 ? A G 38 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 323 ? 1_555 135.7 ? 8 O ? H HOH . ? A HOH 303 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 323 ? 1_555 83.1 ? 9 O ? H HOH . ? A HOH 313 ? 1_555 MG ? F MG . ? A MG 205 ? 1_555 O ? H HOH . ? A HOH 323 ? 1_555 106.0 ? 10 "O3'" ? A U 53 ? A U 53 ? 1_555 MG ? G MG . ? A MG 206 ? 1_555 "O2'" ? A U 53 ? A U 53 ? 1_555 68.4 ? 11 O ? H HOH . ? A HOH 308 ? 1_555 MG ? D MG . ? A MG 203 ? 1_555 O ? H HOH . ? A HOH 310 ? 1_555 69.8 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O A HOH 321 ? ? O A HOH 324 ? ? 2.03 2 1 "O3'" A U 53 ? ? O A HOH 301 ? ? 2.19 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O3'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 GTP _pdbx_validate_rmsd_angle.auth_seq_id_1 1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 P _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 "O5'" _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 2 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 90.48 _pdbx_validate_rmsd_angle.angle_target_value 104.00 _pdbx_validate_rmsd_angle.angle_deviation -13.52 _pdbx_validate_rmsd_angle.angle_standard_deviation 1.90 _pdbx_validate_rmsd_angle.linker_flag Y # _pdbx_entry_details.entry_id 8XZO _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 GUN N9 N Y N 159 GUN C8 C Y N 160 GUN N7 N Y N 161 GUN C5 C Y N 162 GUN C6 C N N 163 GUN O6 O N N 164 GUN N1 N N N 165 GUN C2 C N N 166 GUN N2 N N N 167 GUN N3 N N N 168 GUN C4 C Y N 169 GUN HN9 H N N 170 GUN H8 H N N 171 GUN HN1 H N N 172 GUN HN21 H N N 173 GUN HN22 H N N 174 HOH O O N N 175 HOH H1 H N N 176 HOH H2 H N N 177 MG MG MG N N 178 SPM N1 N N N 179 SPM C2 C N N 180 SPM C3 C N N 181 SPM C4 C N N 182 SPM N5 N N N 183 SPM C6 C N N 184 SPM C7 C N N 185 SPM C8 C N N 186 SPM C9 C N N 187 SPM N10 N N N 188 SPM C11 C N N 189 SPM C12 C N N 190 SPM C13 C N N 191 SPM N14 N N N 192 SPM HN11 H N N 193 SPM HN12 H N N 194 SPM H21 H N N 195 SPM H22 H N N 196 SPM H31 H N N 197 SPM H32 H N N 198 SPM H41 H N N 199 SPM H42 H N N 200 SPM HN5 H N N 201 SPM H61 H N N 202 SPM H62 H N N 203 SPM H71 H N N 204 SPM H72 H N N 205 SPM H81 H N N 206 SPM H82 H N N 207 SPM H91 H N N 208 SPM H92 H N N 209 SPM HN0 H N N 210 SPM H111 H N N 211 SPM H112 H N N 212 SPM H121 H N N 213 SPM H122 H N N 214 SPM H131 H N N 215 SPM H132 H N N 216 SPM HN41 H N N 217 SPM HN42 H N N 218 U OP3 O N N 219 U P P N N 220 U OP1 O N N 221 U OP2 O N N 222 U "O5'" O N N 223 U "C5'" C N N 224 U "C4'" C N R 225 U "O4'" O N N 226 U "C3'" C N S 227 U "O3'" O N N 228 U "C2'" C N R 229 U "O2'" O N N 230 U "C1'" C N R 231 U N1 N N N 232 U C2 C N N 233 U O2 O N N 234 U N3 N N N 235 U C4 C N N 236 U O4 O N N 237 U C5 C N N 238 U C6 C N N 239 U HOP3 H N N 240 U HOP2 H N N 241 U "H5'" H N N 242 U "H5''" H N N 243 U "H4'" H N N 244 U "H3'" H N N 245 U "HO3'" H N N 246 U "H2'" H N N 247 U "HO2'" H N N 248 U "H1'" H N N 249 U H3 H N N 250 U H5 H N N 251 U H6 H N N 252 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 GUN N9 C8 sing Y N 166 GUN N9 C4 sing Y N 167 GUN N9 HN9 sing N N 168 GUN C8 N7 doub Y N 169 GUN C8 H8 sing N N 170 GUN N7 C5 sing Y N 171 GUN C5 C6 sing N N 172 GUN C5 C4 doub Y N 173 GUN C6 O6 doub N N 174 GUN C6 N1 sing N N 175 GUN N1 C2 sing N N 176 GUN N1 HN1 sing N N 177 GUN C2 N2 sing N N 178 GUN C2 N3 doub N N 179 GUN N2 HN21 sing N N 180 GUN N2 HN22 sing N N 181 GUN N3 C4 sing N N 182 HOH O H1 sing N N 183 HOH O H2 sing N N 184 SPM N1 C2 sing N N 185 SPM N1 HN11 sing N N 186 SPM N1 HN12 sing N N 187 SPM C2 C3 sing N N 188 SPM C2 H21 sing N N 189 SPM C2 H22 sing N N 190 SPM C3 C4 sing N N 191 SPM C3 H31 sing N N 192 SPM C3 H32 sing N N 193 SPM C4 N5 sing N N 194 SPM C4 H41 sing N N 195 SPM C4 H42 sing N N 196 SPM N5 C6 sing N N 197 SPM N5 HN5 sing N N 198 SPM C6 C7 sing N N 199 SPM C6 H61 sing N N 200 SPM C6 H62 sing N N 201 SPM C7 C8 sing N N 202 SPM C7 H71 sing N N 203 SPM C7 H72 sing N N 204 SPM C8 C9 sing N N 205 SPM C8 H81 sing N N 206 SPM C8 H82 sing N N 207 SPM C9 N10 sing N N 208 SPM C9 H91 sing N N 209 SPM C9 H92 sing N N 210 SPM N10 C11 sing N N 211 SPM N10 HN0 sing N N 212 SPM C11 C12 sing N N 213 SPM C11 H111 sing N N 214 SPM C11 H112 sing N N 215 SPM C12 C13 sing N N 216 SPM C12 H121 sing N N 217 SPM C12 H122 sing N N 218 SPM C13 N14 sing N N 219 SPM C13 H131 sing N N 220 SPM C13 H132 sing N N 221 SPM N14 HN41 sing N N 222 SPM N14 HN42 sing N N 223 U OP3 P sing N N 224 U OP3 HOP3 sing N N 225 U P OP1 doub N N 226 U P OP2 sing N N 227 U P "O5'" sing N N 228 U OP2 HOP2 sing N N 229 U "O5'" "C5'" sing N N 230 U "C5'" "C4'" sing N N 231 U "C5'" "H5'" sing N N 232 U "C5'" "H5''" sing N N 233 U "C4'" "O4'" sing N N 234 U "C4'" "C3'" sing N N 235 U "C4'" "H4'" sing N N 236 U "O4'" "C1'" sing N N 237 U "C3'" "O3'" sing N N 238 U "C3'" "C2'" sing N N 239 U "C3'" "H3'" sing N N 240 U "O3'" "HO3'" sing N N 241 U "C2'" "O2'" sing N N 242 U "C2'" "C1'" sing N N 243 U "C2'" "H2'" sing N N 244 U "O2'" "HO2'" sing N N 245 U "C1'" N1 sing N N 246 U "C1'" "H1'" sing N N 247 U N1 C2 sing N N 248 U N1 C6 sing N N 249 U C2 O2 doub N N 250 U C2 N3 sing N N 251 U N3 C4 sing N N 252 U N3 H3 sing N N 253 U C4 O4 doub N N 254 U C4 C5 sing N N 255 U C5 C6 doub N N 256 U C5 H5 sing N N 257 U C6 H6 sing N N 258 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8XZO 'double helix' 8XZO 'a-form double helix' 8XZO 'hairpin loop' 8XZO 'bulge loop' 8XZO 'mismatched base pair' 8XZO 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A U 53 1_555 -2.358 0.008 -0.323 -6.235 3.007 8.503 1 A_GTP1:U53_A A 1 ? A 53 ? 28 1 1 A G 2 1_555 A C 52 1_555 -0.255 -0.116 -0.170 -3.801 -9.191 0.626 2 A_G2:C52_A A 2 ? A 52 ? 19 1 1 A G 3 1_555 A C 51 1_555 -0.406 -0.083 -0.264 -10.004 -13.683 2.041 3 A_G3:C51_A A 3 ? A 51 ? 19 1 1 A U 4 1_555 A G 50 1_555 2.324 -0.591 0.164 -6.368 -8.439 2.717 4 A_U4:G50_A A 4 ? A 50 ? 28 1 1 A G 5 1_555 A C 49 1_555 -0.363 -0.130 -0.316 -11.357 -10.690 0.528 5 A_G5:C49_A A 5 ? A 49 ? 19 1 1 A U 6 1_555 A G 48 1_555 2.508 -0.543 -0.025 -4.743 1.686 -2.634 6 A_U6:G48_A A 6 ? A 48 ? 28 1 1 A G 7 1_555 A A 47 1_555 6.885 -4.694 0.368 9.523 0.627 -9.904 7 A_G7:A47_A A 7 ? A 47 ? 11 10 1 A A 9 1_555 A G 46 1_555 -6.772 -4.196 0.785 -17.129 -12.096 1.540 8 A_A9:G46_A A 9 ? A 46 ? 11 9 1 A C 10 1_555 A G 45 1_555 0.082 -0.038 0.236 -2.256 -7.428 0.011 9 A_C10:G45_A A 10 ? A 45 ? 19 1 1 A C 11 1_555 A G 44 1_555 0.203 -0.089 -0.199 5.219 -8.596 -1.268 10 A_C11:G44_A A 11 ? A 44 ? 19 1 1 A G 12 1_555 A C 43 1_555 -0.362 -0.134 0.052 -12.633 -18.824 1.124 11 A_G12:C43_A A 12 ? A 43 ? 19 1 1 A U 13 1_555 A A 42 1_555 0.067 0.039 0.404 -14.611 -14.648 -0.422 12 A_U13:A42_A A 13 ? A 42 ? 20 1 1 A G 21 1_555 A C 40 1_555 -0.384 -0.219 0.151 0.727 -15.271 -0.566 13 A_G21:C40_A A 21 ? A 40 ? 19 1 1 A U 22 1_555 A A 39 1_555 0.032 -0.142 -0.051 -1.404 -19.324 3.866 14 A_U22:A39_A A 22 ? A 39 ? 20 1 1 A C 23 1_555 A G 38 1_555 0.259 -0.114 0.101 1.802 -10.911 -1.939 15 A_C23:G38_A A 23 ? A 38 ? 19 1 1 A C 24 1_555 A G 37 1_555 0.327 -0.112 0.052 0.464 -12.802 2.338 16 A_C24:G37_A A 24 ? A 37 ? 19 1 1 A C 25 1_555 A G 36 1_555 0.174 -0.023 0.079 0.834 -12.345 2.223 17 A_C25:G36_A A 25 ? A 36 ? 19 1 1 A A 26 1_555 A U 35 1_555 0.126 -0.061 0.103 -4.389 -14.781 3.703 18 A_A26:U35_A A 26 ? A 35 ? 20 1 1 A G 27 1_555 A C 34 1_555 -0.312 -0.121 0.150 -6.135 -16.569 1.487 19 A_G27:C34_A A 27 ? A 34 ? 19 1 1 A C 28 1_555 A G 32 1_555 0.455 -0.096 -0.252 4.304 -3.645 -2.548 20 A_C28:G32_A A 28 ? A 32 ? 19 1 1 A U 14 1_555 A A 17 1_555 -1.031 3.686 -0.215 4.639 18.606 -75.391 21 A_U14:A17_A A 14 ? A 17 ? 23 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A U 53 1_555 A G 2 1_555 A C 52 1_555 -0.479 -1.522 3.357 -2.681 5.187 35.196 -3.237 0.393 3.135 8.505 4.396 35.662 1 AA_GTP1G2:C52U53_AA A 1 ? A 53 ? A 2 ? A 52 ? 1 A G 2 1_555 A C 52 1_555 A G 3 1_555 A C 51 1_555 0.035 -1.804 3.376 -0.819 7.265 32.122 -4.389 -0.197 2.907 12.921 1.456 32.922 2 AA_G2G3:C51C52_AA A 2 ? A 52 ? A 3 ? A 51 ? 1 A G 3 1_555 A C 51 1_555 A U 4 1_555 A G 50 1_555 0.174 -1.301 3.239 -1.294 3.435 41.812 -2.164 -0.375 3.121 4.803 1.809 41.965 3 AA_G3U4:G50C51_AA A 3 ? A 51 ? A 4 ? A 50 ? 1 A U 4 1_555 A G 50 1_555 A G 5 1_555 A C 49 1_555 -0.461 -2.078 3.278 5.802 9.735 23.062 -7.051 2.450 2.070 22.675 -13.514 25.662 4 AA_U4G5:C49G50_AA A 4 ? A 50 ? A 5 ? A 49 ? 1 A G 5 1_555 A C 49 1_555 A U 6 1_555 A G 48 1_555 0.101 -1.190 3.170 -1.043 4.556 40.055 -2.215 -0.258 3.019 6.624 1.516 40.315 5 AA_G5U6:G48C49_AA A 5 ? A 49 ? A 6 ? A 48 ? 1 A U 6 1_555 A G 48 1_555 A G 7 1_555 A A 47 1_555 -0.227 -1.346 2.916 4.153 7.370 51.667 -1.946 0.494 2.689 8.392 -4.729 52.308 6 AA_U6G7:A47G48_AA A 6 ? A 48 ? A 7 ? A 47 ? 1 A G 7 1_555 A A 47 1_555 A A 9 1_555 A G 46 1_555 -1.870 -0.514 5.560 6.361 16.805 8.102 -13.511 10.011 1.255 61.654 -23.338 19.697 7 AA_G7A9:G46A47_AA A 7 ? A 47 ? A 9 ? A 46 ? 1 A A 9 1_555 A G 46 1_555 A C 10 1_555 A G 45 1_555 0.031 -0.619 3.057 0.819 7.608 57.664 -1.009 0.008 2.961 7.850 -0.845 58.126 8 AA_A9C10:G45G46_AA A 9 ? A 46 ? A 10 ? A 45 ? 1 A C 10 1_555 A G 45 1_555 A C 11 1_555 A G 44 1_555 0.349 -2.160 3.020 3.624 5.627 26.309 -5.828 0.044 2.536 12.115 -7.803 27.133 9 AA_C10C11:G44G45_AA A 10 ? A 45 ? A 11 ? A 44 ? 1 A C 11 1_555 A G 44 1_555 A G 12 1_555 A C 43 1_555 0.088 -1.824 3.516 -0.708 14.232 31.696 -5.163 -0.252 2.491 24.564 1.222 34.677 10 AA_C11G12:C43G44_AA A 11 ? A 44 ? A 12 ? A 43 ? 1 A G 12 1_555 A C 43 1_555 A U 13 1_555 A A 42 1_555 -0.119 -1.419 3.360 -0.926 2.550 33.970 -2.832 0.055 3.250 4.356 1.581 34.075 11 AA_G12U13:A42C43_AA A 12 ? A 43 ? A 13 ? A 42 ? 1 A U 13 1_555 A A 42 1_555 A G 21 1_555 A C 40 1_555 -2.860 -2.775 5.877 1.079 5.096 76.596 -2.497 2.359 5.677 4.107 -0.869 76.746 12 AA_U13G21:C40A42_AA A 13 ? A 42 ? A 21 ? A 40 ? 1 A G 21 1_555 A C 40 1_555 A U 22 1_555 A A 39 1_555 0.061 -1.267 3.297 1.438 8.377 34.038 -3.317 0.106 2.913 14.041 -2.410 35.052 13 AA_G21U22:A39C40_AA A 21 ? A 40 ? A 22 ? A 39 ? 1 A U 22 1_555 A A 39 1_555 A C 23 1_555 A G 38 1_555 -0.225 -1.137 3.176 -2.033 6.428 34.342 -2.806 0.086 2.930 10.759 3.403 34.978 14 AA_U22C23:G38A39_AA A 22 ? A 39 ? A 23 ? A 38 ? 1 A C 23 1_555 A G 38 1_555 A C 24 1_555 A G 37 1_555 0.487 -1.708 3.206 3.149 8.363 30.747 -4.491 -0.360 2.695 15.370 -5.787 31.989 15 AA_C23C24:G37G38_AA A 23 ? A 38 ? A 24 ? A 37 ? 1 A C 24 1_555 A G 37 1_555 A C 25 1_555 A G 36 1_555 0.337 -1.943 3.164 1.537 6.344 28.907 -5.017 -0.364 2.700 12.508 -3.029 29.619 16 AA_C24C25:G36G37_AA A 24 ? A 37 ? A 25 ? A 36 ? 1 A C 25 1_555 A G 36 1_555 A A 26 1_555 A U 35 1_555 0.107 -1.764 3.270 1.497 8.083 28.725 -4.986 0.081 2.687 15.885 -2.942 29.855 17 AA_C25A26:U35G36_AA A 25 ? A 36 ? A 26 ? A 35 ? 1 A A 26 1_555 A U 35 1_555 A G 27 1_555 A C 34 1_555 -0.166 -1.585 3.198 0.738 5.425 33.865 -3.489 0.390 2.912 9.239 -1.256 34.292 18 AA_A26G27:C34U35_AA A 26 ? A 35 ? A 27 ? A 34 ? 1 A G 27 1_555 A C 34 1_555 A C 28 1_555 A G 32 1_555 -0.674 -0.601 3.054 5.781 7.398 27.548 -2.643 2.472 2.616 14.994 -11.718 29.074 19 AA_G27C28:G32C34_AA A 27 ? A 34 ? A 28 ? A 32 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id GUN _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id GUN _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8XZE _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8XZO _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.019993 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017303 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.016012 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_