data_8XZW # _entry.id 8XZW # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.395 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8XZW pdb_00008xzw 10.2210/pdb8xzw/pdb WWPDB D_1300044548 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-07-24 2 'Structure model' 1 1 2024-08-21 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # _pdbx_audit_revision_category.ordinal 1 _pdbx_audit_revision_category.revision_ordinal 2 _pdbx_audit_revision_category.data_content_type 'Structure model' _pdbx_audit_revision_category.category citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8XZW _pdbx_database_status.recvd_initial_deposition_date 2024-01-21 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, C.Y.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 52 _citation.language ? _citation.page_first 8454 _citation.page_last 8465 _citation.title 'Structure-based characterization and compound identification of the wild-type THF class-II riboswitch.' _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkae377 _citation.pdbx_database_id_PubMed 38769061 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, C.' 1 ? primary 'Xu, X.' 2 ? primary 'Geng, Z.' 3 ? primary 'Zheng, L.' 4 ? primary 'Song, Q.' 5 ? primary 'Shen, X.' 6 ? primary 'Wu, J.' 7 ? primary 'Zhao, J.' 8 ? primary 'Li, H.' 9 ? primary 'He, M.' 10 ? primary 'Tai, X.' 11 ? primary 'Zhang, L.' 12 0000-0001-8139-0474 primary 'Ma, J.' 13 ? primary 'Dong, Y.' 14 ? primary 'Ren, A.' 15 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (53-MER)' 17174.043 1 ? ? ? ? 2 non-polymer syn '(6S)-5,6,7,8-TETRAHYDROFOLATE' 445.429 1 ? ? ? ? 3 non-polymer syn SPERMINE 202.340 1 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 3 ? ? ? ? 5 water nat water 18.015 20 ? ? ? ? # _entity_name_com.entity_id 1 _entity_name_com.name env6 # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGUGUGUACCGUUCAACUCGUCCCAGCUUCGACUGGGACUACGGGAGCGCCU' _entity_poly.pdbx_seq_one_letter_code_can GGGUGUGUACCGUUCAACUCGUCCCAGCUUCGACUGGGACUACGGGAGCGCCU _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 '(6S)-5,6,7,8-TETRAHYDROFOLATE' THG 3 SPERMINE SPM 4 'MAGNESIUM ION' MG 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 U n 1 5 G n 1 6 U n 1 7 G n 1 8 U n 1 9 A n 1 10 C n 1 11 C n 1 12 G n 1 13 U n 1 14 U n 1 15 C n 1 16 A n 1 17 A n 1 18 C n 1 19 U n 1 20 C n 1 21 G n 1 22 U n 1 23 C n 1 24 C n 1 25 C n 1 26 A n 1 27 G n 1 28 C n 1 29 U n 1 30 U n 1 31 C n 1 32 G n 1 33 A n 1 34 C n 1 35 U n 1 36 G n 1 37 G n 1 38 G n 1 39 A n 1 40 C n 1 41 U n 1 42 A n 1 43 C n 1 44 G n 1 45 G n 1 46 G n 1 47 A n 1 48 G n 1 49 C n 1 50 G n 1 51 C n 1 52 C n 1 53 U n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 53 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'unidentified eubacterium clone A70' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 41312 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 SPM non-polymer . SPERMINE ? 'C10 H26 N4' 202.340 THG non-polymer . '(6S)-5,6,7,8-TETRAHYDROFOLATE' ? 'C19 H23 N7 O6' 445.429 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 G 5 5 5 G G A . n A 1 6 U 6 6 6 U U A . n A 1 7 G 7 7 7 G G A . n A 1 8 U 8 8 8 U U A . n A 1 9 A 9 9 9 A A A . n A 1 10 C 10 10 10 C C A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 C 18 18 18 C C A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 G 21 21 21 G G A . n A 1 22 U 22 22 22 U U A . n A 1 23 C 23 23 23 C C A . n A 1 24 C 24 24 24 C C A . n A 1 25 C 25 25 25 C C A . n A 1 26 A 26 26 26 A A A . n A 1 27 G 27 27 27 G G A . n A 1 28 C 28 28 28 C C A . n A 1 29 U 29 29 29 U U A . n A 1 30 U 30 30 30 U U A . n A 1 31 C 31 31 31 C C A . n A 1 32 G 32 32 32 G G A . n A 1 33 A 33 33 33 A A A . n A 1 34 C 34 34 34 C C A . n A 1 35 U 35 35 35 U U A . n A 1 36 G 36 36 36 G G A . n A 1 37 G 37 37 37 G G A . n A 1 38 G 38 38 38 G G A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 U 41 41 41 U U A . n A 1 42 A 42 42 42 A A A . n A 1 43 C 43 43 43 C C A . n A 1 44 G 44 44 44 G G A . n A 1 45 G 45 45 45 G G A . n A 1 46 G 46 46 46 G G A . n A 1 47 A 47 47 47 A A A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 G 50 50 50 G G A . n A 1 51 C 51 51 51 C C A . n A 1 52 C 52 52 52 C C A . n A 1 53 U 53 53 53 U U A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 THG 1 101 101 THG THG A . C 3 SPM 1 102 201 SPM SPM A . D 4 MG 1 103 1 MG MG A . E 4 MG 1 104 2 MG MG A . F 4 MG 1 105 3 MG MG A . G 5 HOH 1 201 20 HOH HOH A . G 5 HOH 2 202 2 HOH HOH A . G 5 HOH 3 203 15 HOH HOH A . G 5 HOH 4 204 16 HOH HOH A . G 5 HOH 5 205 3 HOH HOH A . G 5 HOH 6 206 4 HOH HOH A . G 5 HOH 7 207 17 HOH HOH A . G 5 HOH 8 208 12 HOH HOH A . G 5 HOH 9 209 11 HOH HOH A . G 5 HOH 10 210 18 HOH HOH A . G 5 HOH 11 211 10 HOH HOH A . G 5 HOH 12 212 8 HOH HOH A . G 5 HOH 13 213 6 HOH HOH A . G 5 HOH 14 214 13 HOH HOH A . G 5 HOH 15 215 5 HOH HOH A . G 5 HOH 16 216 7 HOH HOH A . G 5 HOH 17 217 19 HOH HOH A . G 5 HOH 18 218 1 HOH HOH A . G 5 HOH 19 219 14 HOH HOH A . G 5 HOH 20 220 9 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.18.2_3874: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 8XZW _cell.details ? _cell.formula_units_Z ? _cell.length_a 49.105 _cell.length_a_esd ? _cell.length_b 57.500 _cell.length_b_esd ? _cell.length_c 62.185 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 8XZW _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8XZW _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.56 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 51.88 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.08 M Sodium chloride, 0.04 M Sodium cacodylate trihydrate pH 7.0, 30% v/v MPD, 0.012 M Spermine tetrahydrochloride' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-07-12 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.102 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.102 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 8XZW _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 1.91 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 26146 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.4 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 11.2 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 3.0 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 1.903 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.213 _reflns.pdbx_Rpim_I_all 0.066 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.926 _reflns.pdbx_CC_star 0.981 _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.202 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.50 2.59 ? ? ? ? ? ? 613 ? ? ? ? ? ? ? ? ? ? ? 9.3 0.460 ? ? 1.619 0.485 ? 1 1 0.605 0.868 ? 95.8 ? 1.541 ? ? ? ? ? ? ? ? ? 2.59 2.69 ? ? ? ? ? ? 623 ? ? ? ? ? ? ? ? ? ? ? 10.9 0.528 ? ? 1.127 0.326 ? 2 1 0.760 0.929 ? 98.6 ? 1.077 ? ? ? ? ? ? ? ? ? 2.69 2.82 ? ? ? ? ? ? 648 ? ? ? ? ? ? ? ? ? ? ? 11.8 0.593 ? ? 0.923 0.261 ? 3 1 0.821 0.950 ? 100.0 ? 0.885 ? ? ? ? ? ? ? ? ? 2.82 2.96 ? ? ? ? ? ? 648 ? ? ? ? ? ? ? ? ? ? ? 12.1 0.841 ? ? 0.695 0.197 ? 4 1 0.927 0.981 ? 100.0 ? 0.665 ? ? ? ? ? ? ? ? ? 2.96 3.15 ? ? ? ? ? ? 641 ? ? ? ? ? ? ? ? ? ? ? 11.6 1.385 ? ? 0.462 0.137 ? 5 1 0.958 0.989 ? 100.0 ? 0.441 ? ? ? ? ? ? ? ? ? 3.15 3.39 ? ? ? ? ? ? 652 ? ? ? ? ? ? ? ? ? ? ? 11.9 2.044 ? ? 0.351 0.102 ? 6 1 0.969 0.992 ? 100.0 ? 0.335 ? ? ? ? ? ? ? ? ? 3.39 3.73 ? ? ? ? ? ? 647 ? ? ? ? ? ? ? ? ? ? ? 12.3 2.619 ? ? 0.311 0.090 ? 7 1 0.979 0.995 ? 100.0 ? 0.298 ? ? ? ? ? ? ? ? ? 3.73 4.27 ? ? ? ? ? ? 670 ? ? ? ? ? ? ? ? ? ? ? 11.5 3.038 ? ? 0.261 0.078 ? 8 1 0.980 0.995 ? 100.0 ? 0.249 ? ? ? ? ? ? ? ? ? 4.27 5.38 ? ? ? ? ? ? 675 ? ? ? ? ? ? ? ? ? ? ? 10.8 3.361 ? ? 0.223 0.068 ? 9 1 0.979 0.995 ? 99.7 ? 0.212 ? ? ? ? ? ? ? ? ? 5.38 50.00 ? ? ? ? ? ? 734 ? ? ? ? ? ? ? ? ? ? ? 10.1 3.732 ? ? 0.141 0.048 ? 10 1 0.998 0.999 ? 100.0 ? 0.132 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 8XZW _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 1.91 _refine.ls_d_res_low 19.50 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 26146 _refine.ls_number_reflns_R_free 2619 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.40 _refine.ls_percent_reflns_R_free 10.02 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2187 _refine.ls_R_factor_R_free 0.2511 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2151 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.33 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 40.58 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.52 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 1.91 _refine_hist.d_res_low 19.50 _refine_hist.number_atoms_solvent 20 _refine_hist.number_atoms_total 1205 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1136 _refine_hist.pdbx_number_atoms_ligand 49 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1312 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.097 ? 2029 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 17.915 ? 660 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.041 ? 266 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 58 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 1.91 1.94 . . 95 912 71.00 . . . . 0.5456 . . . . . . . . . . . 0.5211 'X-RAY DIFFRACTION' 1.94 1.98 . . 143 1241 100.00 . . . . 0.4989 . . . . . . . . . . . 0.5556 'X-RAY DIFFRACTION' 1.98 2.02 . . 131 1262 100.00 . . . . 0.4403 . . . . . . . . . . . 0.4744 'X-RAY DIFFRACTION' 2.02 2.06 . . 136 1249 100.00 . . . . 0.4241 . . . . . . . . . . . 0.4043 'X-RAY DIFFRACTION' 2.06 2.11 . . 141 1278 100.00 . . . . 0.4112 . . . . . . . . . . . 0.4290 'X-RAY DIFFRACTION' 2.11 2.16 . . 156 1265 100.00 . . . . 0.3751 . . . . . . . . . . . 0.3947 'X-RAY DIFFRACTION' 2.16 2.22 . . 149 1241 100.00 . . . . 0.3717 . . . . . . . . . . . 0.3826 'X-RAY DIFFRACTION' 2.22 2.29 . . 112 1276 100.00 . . . . 0.3529 . . . . . . . . . . . 0.3929 'X-RAY DIFFRACTION' 2.29 2.36 . . 138 1249 100.00 . . . . 0.3027 . . . . . . . . . . . 0.3348 'X-RAY DIFFRACTION' 2.36 2.44 . . 156 1251 100.00 . . . . 0.3063 . . . . . . . . . . . 0.3528 'X-RAY DIFFRACTION' 2.44 2.54 . . 130 1242 100.00 . . . . 0.3057 . . . . . . . . . . . 0.3216 'X-RAY DIFFRACTION' 2.54 2.66 . . 140 1268 100.00 . . . . 0.2953 . . . . . . . . . . . 0.3507 'X-RAY DIFFRACTION' 2.66 2.80 . . 143 1254 100.00 . . . . 0.3127 . . . . . . . . . . . 0.3970 'X-RAY DIFFRACTION' 2.80 2.97 . . 145 1263 100.00 . . . . 0.3317 . . . . . . . . . . . 0.4225 'X-RAY DIFFRACTION' 2.97 3.20 . . 123 1259 100.00 . . . . 0.2353 . . . . . . . . . . . 0.2914 'X-RAY DIFFRACTION' 3.20 3.52 . . 164 1243 100.00 . . . . 0.2128 . . . . . . . . . . . 0.2702 'X-RAY DIFFRACTION' 3.52 4.02 . . 134 1261 100.00 . . . . 0.1648 . . . . . . . . . . . 0.1801 'X-RAY DIFFRACTION' 4.03 5.05 . . 141 1249 100.00 . . . . 0.1442 . . . . . . . . . . . 0.1611 'X-RAY DIFFRACTION' 5.06 19.50 . . 142 1264 100.00 . . . . 0.1324 . . . . . . . . . . . 0.1642 # _struct.entry_id 8XZW _struct.title 'Crystal structure of THF-II riboswitch with THF and soaked with Ir' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8XZW _struct_keywords.text 'riboswitch, THF, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 4 ? F N N 4 ? G N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8XZW _struct_ref.pdbx_db_accession 8XZW _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8XZW _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 53 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8XZW _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 53 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 53 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'isothermal titration calorimetry' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.669 ? ? metalc1 metalc ? ? A U 53 "O3'" ? ? ? 1_555 D MG . MG ? ? A U 53 A MG 103 1_555 ? ? ? ? ? ? ? 1.828 ? ? metalc2 metalc ? ? A U 53 "O2'" ? ? ? 1_555 D MG . MG ? ? A U 53 A MG 103 1_555 ? ? ? ? ? ? ? 1.966 ? ? metalc3 metalc ? ? D MG . MG ? ? ? 1_555 G HOH . O ? ? A MG 103 A HOH 202 1_555 ? ? ? ? ? ? ? 2.405 ? ? metalc4 metalc ? ? E MG . MG ? ? ? 1_555 G HOH . O ? ? A MG 104 A HOH 208 1_555 ? ? ? ? ? ? ? 1.977 ? ? metalc5 metalc ? ? F MG . MG ? ? ? 1_555 G HOH . O ? ? A MG 105 A HOH 203 1_555 ? ? ? ? ? ? ? 2.347 ? ? metalc6 metalc ? ? F MG . MG ? ? ? 1_555 G HOH . O ? ? A MG 105 A HOH 204 1_555 ? ? ? ? ? ? ? 2.450 ? ? metalc7 metalc ? ? F MG . MG ? ? ? 1_555 G HOH . O ? ? A MG 105 A HOH 207 1_555 ? ? ? ? ? ? ? 2.127 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A U 53 O2 ? ? A GTP 1 A U 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog2 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A U 53 N3 ? ? A GTP 1 A U 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog3 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 52 N3 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 52 O2 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 52 N4 ? ? A G 2 A C 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 51 N3 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 51 O2 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 51 N4 ? ? A G 3 A C 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 4 N3 ? ? ? 1_555 A G 50 O6 ? ? A U 4 A G 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog10 hydrog ? ? A U 4 O2 ? ? ? 1_555 A G 50 N1 ? ? A U 4 A G 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 5 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 A G 48 O6 ? ? A U 6 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog15 hydrog ? ? A U 6 O2 ? ? ? 1_555 A G 48 N1 ? ? A U 6 A G 48 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog16 hydrog ? ? A G 7 N2 ? ? ? 1_555 A A 47 N7 ? ? A G 7 A A 47 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog17 hydrog ? ? A G 7 N3 ? ? ? 1_555 A A 47 N6 ? ? A G 7 A A 47 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog18 hydrog ? ? A A 9 N6 ? ? ? 1_555 A G 46 N3 ? ? A A 9 A G 46 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog19 hydrog ? ? A A 9 N7 ? ? ? 1_555 A G 46 N2 ? ? A A 9 A G 46 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog20 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 45 N1 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 45 O6 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 45 N2 ? ? A C 10 A G 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 44 N1 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 44 O6 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 44 N2 ? ? A C 11 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 43 N3 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 43 O2 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 43 N4 ? ? A G 12 A C 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 13 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 13 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 17 N7 ? ? A U 14 A A 17 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 17 N6 ? ? A U 14 A A 17 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog33 hydrog ? ? A A 16 N6 ? ? ? 1_555 A C 43 O2 ? ? A A 16 A C 43 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog34 hydrog ? ? A A 17 N6 ? ? ? 1_555 A A 42 N3 ? ? A A 17 A A 42 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A G 21 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 21 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 21 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 21 A C 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 22 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A C 23 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 23 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 23 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 23 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 37 N1 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 37 O6 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 37 N2 ? ? A C 24 A G 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 36 N1 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 36 O6 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 36 N2 ? ? A C 25 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 35 N3 ? ? A A 26 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 35 O4 ? ? A A 26 A U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 27 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 32 N1 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 32 O6 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 32 N2 ? ? A C 28 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O3'" ? A U 53 ? A U 53 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 "O2'" ? A U 53 ? A U 53 ? 1_555 89.8 ? 2 "O3'" ? A U 53 ? A U 53 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? G HOH . ? A HOH 202 ? 1_555 63.7 ? 3 "O2'" ? A U 53 ? A U 53 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? G HOH . ? A HOH 202 ? 1_555 113.8 ? 4 O ? G HOH . ? A HOH 203 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? G HOH . ? A HOH 204 ? 1_555 70.2 ? 5 O ? G HOH . ? A HOH 203 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? G HOH . ? A HOH 207 ? 1_555 94.5 ? 6 O ? G HOH . ? A HOH 204 ? 1_555 MG ? F MG . ? A MG 105 ? 1_555 O ? G HOH . ? A HOH 207 ? 1_555 163.0 ? # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 N7 A A 33 ? ? O A HOH 201 ? ? 2.02 2 1 O A HOH 214 ? ? O A HOH 219 ? ? 2.08 # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O3'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 GTP _pdbx_validate_rmsd_angle.auth_seq_id_1 1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 P _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 OP1 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 2 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 117.50 _pdbx_validate_rmsd_angle.angle_target_value 110.50 _pdbx_validate_rmsd_angle.angle_deviation 7.00 _pdbx_validate_rmsd_angle.angle_standard_deviation 1.10 _pdbx_validate_rmsd_angle.linker_flag Y # _pdbx_entry_details.entry_id 8XZW _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification ? # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 MG MG MG N N 162 SPM N1 N N N 163 SPM C2 C N N 164 SPM C3 C N N 165 SPM C4 C N N 166 SPM N5 N N N 167 SPM C6 C N N 168 SPM C7 C N N 169 SPM C8 C N N 170 SPM C9 C N N 171 SPM N10 N N N 172 SPM C11 C N N 173 SPM C12 C N N 174 SPM C13 C N N 175 SPM N14 N N N 176 SPM HN11 H N N 177 SPM HN12 H N N 178 SPM H21 H N N 179 SPM H22 H N N 180 SPM H31 H N N 181 SPM H32 H N N 182 SPM H41 H N N 183 SPM H42 H N N 184 SPM HN5 H N N 185 SPM H61 H N N 186 SPM H62 H N N 187 SPM H71 H N N 188 SPM H72 H N N 189 SPM H81 H N N 190 SPM H82 H N N 191 SPM H91 H N N 192 SPM H92 H N N 193 SPM HN0 H N N 194 SPM H111 H N N 195 SPM H112 H N N 196 SPM H121 H N N 197 SPM H122 H N N 198 SPM H131 H N N 199 SPM H132 H N N 200 SPM HN41 H N N 201 SPM HN42 H N N 202 THG N3 N Y N 203 THG C2 C Y N 204 THG N1 N Y N 205 THG C8A C Y N 206 THG C4A C Y N 207 THG C4 C Y N 208 THG N8 N N N 209 THG C7 C N N 210 THG C6 C N S 211 THG N5 N N N 212 THG C9 C N N 213 THG N10 N N N 214 THG "C4'" C Y N 215 THG "C3'" C Y N 216 THG "C2'" C Y N 217 THG "C1'" C Y N 218 THG "C6'" C Y N 219 THG "C5'" C Y N 220 THG C11 C N N 221 THG N N N N 222 THG CA C N S 223 THG C C N N 224 THG OX2 O N N 225 THG OX1 O N N 226 THG CB C N N 227 THG CG C N N 228 THG CD C N N 229 THG OE1 O N N 230 THG OE2 O N N 231 THG O11 O N N 232 THG O4 O N N 233 THG N2 N N N 234 THG HN3 H N N 235 THG HN8 H N N 236 THG HC71 H N N 237 THG HC72 H N N 238 THG HC6 H N N 239 THG HN5 H N N 240 THG HC91 H N N 241 THG HC92 H N N 242 THG H10 H N N 243 THG HC3 H N N 244 THG HC2 H N N 245 THG HC61 H N N 246 THG HC5 H N N 247 THG HN H N N 248 THG HCA H N N 249 THG HX2 H N N 250 THG HCB1 H N N 251 THG HCB2 H N N 252 THG HCG1 H N N 253 THG HCG2 H N N 254 THG HE2 H N N 255 THG HN21 H N N 256 THG HN22 H N N 257 U OP3 O N N 258 U P P N N 259 U OP1 O N N 260 U OP2 O N N 261 U "O5'" O N N 262 U "C5'" C N N 263 U "C4'" C N R 264 U "O4'" O N N 265 U "C3'" C N S 266 U "O3'" O N N 267 U "C2'" C N R 268 U "O2'" O N N 269 U "C1'" C N R 270 U N1 N N N 271 U C2 C N N 272 U O2 O N N 273 U N3 N N N 274 U C4 C N N 275 U O4 O N N 276 U C5 C N N 277 U C6 C N N 278 U HOP3 H N N 279 U HOP2 H N N 280 U "H5'" H N N 281 U "H5''" H N N 282 U "H4'" H N N 283 U "H3'" H N N 284 U "HO3'" H N N 285 U "H2'" H N N 286 U "HO2'" H N N 287 U "H1'" H N N 288 U H3 H N N 289 U H5 H N N 290 U H6 H N N 291 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 SPM N1 C2 sing N N 168 SPM N1 HN11 sing N N 169 SPM N1 HN12 sing N N 170 SPM C2 C3 sing N N 171 SPM C2 H21 sing N N 172 SPM C2 H22 sing N N 173 SPM C3 C4 sing N N 174 SPM C3 H31 sing N N 175 SPM C3 H32 sing N N 176 SPM C4 N5 sing N N 177 SPM C4 H41 sing N N 178 SPM C4 H42 sing N N 179 SPM N5 C6 sing N N 180 SPM N5 HN5 sing N N 181 SPM C6 C7 sing N N 182 SPM C6 H61 sing N N 183 SPM C6 H62 sing N N 184 SPM C7 C8 sing N N 185 SPM C7 H71 sing N N 186 SPM C7 H72 sing N N 187 SPM C8 C9 sing N N 188 SPM C8 H81 sing N N 189 SPM C8 H82 sing N N 190 SPM C9 N10 sing N N 191 SPM C9 H91 sing N N 192 SPM C9 H92 sing N N 193 SPM N10 C11 sing N N 194 SPM N10 HN0 sing N N 195 SPM C11 C12 sing N N 196 SPM C11 H111 sing N N 197 SPM C11 H112 sing N N 198 SPM C12 C13 sing N N 199 SPM C12 H121 sing N N 200 SPM C12 H122 sing N N 201 SPM C13 N14 sing N N 202 SPM C13 H131 sing N N 203 SPM C13 H132 sing N N 204 SPM N14 HN41 sing N N 205 SPM N14 HN42 sing N N 206 THG N3 C2 sing Y N 207 THG N3 C4 sing Y N 208 THG N3 HN3 sing N N 209 THG C2 N1 doub Y N 210 THG C2 N2 sing N N 211 THG N1 C8A sing Y N 212 THG C8A C4A doub Y N 213 THG C8A N8 sing N N 214 THG C4A C4 sing Y N 215 THG C4A N5 sing N N 216 THG C4 O4 doub N N 217 THG N8 C7 sing N N 218 THG N8 HN8 sing N N 219 THG C7 C6 sing N N 220 THG C7 HC71 sing N N 221 THG C7 HC72 sing N N 222 THG C6 N5 sing N N 223 THG C6 C9 sing N N 224 THG C6 HC6 sing N N 225 THG N5 HN5 sing N N 226 THG C9 N10 sing N N 227 THG C9 HC91 sing N N 228 THG C9 HC92 sing N N 229 THG N10 "C4'" sing N N 230 THG N10 H10 sing N N 231 THG "C4'" "C3'" doub Y N 232 THG "C4'" "C5'" sing Y N 233 THG "C3'" "C2'" sing Y N 234 THG "C3'" HC3 sing N N 235 THG "C2'" "C1'" doub Y N 236 THG "C2'" HC2 sing N N 237 THG "C1'" "C6'" sing Y N 238 THG "C1'" C11 sing N N 239 THG "C6'" "C5'" doub Y N 240 THG "C6'" HC61 sing N N 241 THG "C5'" HC5 sing N N 242 THG C11 N sing N N 243 THG C11 O11 doub N N 244 THG N CA sing N N 245 THG N HN sing N N 246 THG CA C sing N N 247 THG CA CB sing N N 248 THG CA HCA sing N N 249 THG C OX2 sing N N 250 THG C OX1 doub N N 251 THG OX2 HX2 sing N N 252 THG CB CG sing N N 253 THG CB HCB1 sing N N 254 THG CB HCB2 sing N N 255 THG CG CD sing N N 256 THG CG HCG1 sing N N 257 THG CG HCG2 sing N N 258 THG CD OE1 doub N N 259 THG CD OE2 sing N N 260 THG OE2 HE2 sing N N 261 THG N2 HN21 sing N N 262 THG N2 HN22 sing N N 263 U OP3 P sing N N 264 U OP3 HOP3 sing N N 265 U P OP1 doub N N 266 U P OP2 sing N N 267 U P "O5'" sing N N 268 U OP2 HOP2 sing N N 269 U "O5'" "C5'" sing N N 270 U "C5'" "C4'" sing N N 271 U "C5'" "H5'" sing N N 272 U "C5'" "H5''" sing N N 273 U "C4'" "O4'" sing N N 274 U "C4'" "C3'" sing N N 275 U "C4'" "H4'" sing N N 276 U "O4'" "C1'" sing N N 277 U "C3'" "O3'" sing N N 278 U "C3'" "C2'" sing N N 279 U "C3'" "H3'" sing N N 280 U "O3'" "HO3'" sing N N 281 U "C2'" "O2'" sing N N 282 U "C2'" "C1'" sing N N 283 U "C2'" "H2'" sing N N 284 U "O2'" "HO2'" sing N N 285 U "C1'" N1 sing N N 286 U "C1'" "H1'" sing N N 287 U N1 C2 sing N N 288 U N1 C6 sing N N 289 U C2 O2 doub N N 290 U C2 N3 sing N N 291 U N3 C4 sing N N 292 U N3 H3 sing N N 293 U C4 O4 doub N N 294 U C4 C5 sing N N 295 U C5 C6 doub N N 296 U C5 H5 sing N N 297 U C6 H6 sing N N 298 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8XZW 'double helix' 8XZW 'a-form double helix' 8XZW 'hairpin loop' 8XZW 'bulge loop' 8XZW 'mismatched base pair' 8XZW 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A U 53 1_555 -2.100 -0.376 -0.397 -5.232 -0.933 -8.910 1 A_GTP1:U53_A A 1 ? A 53 ? 28 1 1 A G 2 1_555 A C 52 1_555 -0.268 -0.112 -0.063 0.037 -10.601 1.762 2 A_G2:C52_A A 2 ? A 52 ? 19 1 1 A G 3 1_555 A C 51 1_555 -0.301 0.007 -0.005 -3.658 -14.523 8.374 3 A_G3:C51_A A 3 ? A 51 ? 19 1 1 A U 4 1_555 A G 50 1_555 2.459 -0.517 0.151 -5.344 -9.322 4.948 4 A_U4:G50_A A 4 ? A 50 ? 28 1 1 A G 5 1_555 A C 49 1_555 -0.030 -0.051 -0.333 -9.758 -11.137 3.274 5 A_G5:C49_A A 5 ? A 49 ? 19 1 1 A U 6 1_555 A G 48 1_555 2.395 -0.643 0.005 -4.064 -1.085 -6.789 6 A_U6:G48_A A 6 ? A 48 ? 28 1 1 A G 7 1_555 A A 47 1_555 6.942 -4.882 0.310 11.580 -2.524 -10.082 7 A_G7:A47_A A 7 ? A 47 ? 11 10 1 A A 9 1_555 A G 46 1_555 -6.834 -4.506 0.771 -15.406 -12.910 -0.952 8 A_A9:G46_A A 9 ? A 46 ? 11 10 1 A C 10 1_555 A G 45 1_555 0.091 -0.144 0.264 0.380 -6.577 -1.062 9 A_C10:G45_A A 10 ? A 45 ? 19 1 1 A C 11 1_555 A G 44 1_555 0.026 -0.177 -0.144 5.003 -11.876 -2.642 10 A_C11:G44_A A 11 ? A 44 ? 19 1 1 A G 12 1_555 A C 43 1_555 -0.275 -0.203 0.016 -14.377 -22.468 1.871 11 A_G12:C43_A A 12 ? A 43 ? 19 1 1 A U 13 1_555 A A 42 1_555 -0.018 0.026 0.478 -15.188 -11.816 0.562 12 A_U13:A42_A A 13 ? A 42 ? 20 1 1 A G 21 1_555 A C 40 1_555 -0.363 -0.158 0.275 1.899 -16.283 4.745 13 A_G21:C40_A A 21 ? A 40 ? 19 1 1 A U 22 1_555 A A 39 1_555 -0.029 -0.116 0.016 -0.556 -18.193 1.810 14 A_U22:A39_A A 22 ? A 39 ? 20 1 1 A C 23 1_555 A G 38 1_555 0.189 -0.245 0.208 -0.670 -10.581 -1.691 15 A_C23:G38_A A 23 ? A 38 ? 19 1 1 A C 24 1_555 A G 37 1_555 0.350 -0.415 0.036 -1.347 -11.201 -3.123 16 A_C24:G37_A A 24 ? A 37 ? 19 1 1 A C 25 1_555 A G 36 1_555 0.247 -0.208 -0.016 -0.472 -9.824 -0.341 17 A_C25:G36_A A 25 ? A 36 ? 19 1 1 A A 26 1_555 A U 35 1_555 0.013 -0.060 0.042 -3.693 -14.936 5.460 18 A_A26:U35_A A 26 ? A 35 ? 20 1 1 A G 27 1_555 A C 34 1_555 -0.212 -0.118 0.267 -6.389 -15.075 2.627 19 A_G27:C34_A A 27 ? A 34 ? 19 1 1 A C 28 1_555 A G 32 1_555 0.325 -0.169 -0.333 7.258 1.025 -4.352 20 A_C28:G32_A A 28 ? A 32 ? 19 1 1 A U 14 1_555 A A 17 1_555 -0.984 3.579 -0.252 3.449 16.873 -78.682 21 A_U14:A17_A A 14 ? A 17 ? 23 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A U 53 1_555 A G 2 1_555 A C 52 1_555 0.316 -1.348 3.269 -6.335 8.196 35.791 -3.146 -1.293 2.809 13.004 10.051 37.213 1 AA_GTP1G2:C52U53_AA A 1 ? A 53 ? A 2 ? A 52 ? 1 A G 2 1_555 A C 52 1_555 A G 3 1_555 A C 51 1_555 0.068 -1.839 3.302 -2.177 5.861 32.281 -4.214 -0.479 2.921 10.419 3.871 32.865 2 AA_G2G3:C51C52_AA A 2 ? A 52 ? A 3 ? A 51 ? 1 A G 3 1_555 A C 51 1_555 A U 4 1_555 A G 50 1_555 0.068 -1.268 3.337 0.860 4.195 41.600 -2.217 -0.004 3.200 5.888 -1.207 41.810 3 AA_G3U4:G50C51_AA A 3 ? A 51 ? A 4 ? A 50 ? 1 A U 4 1_555 A G 50 1_555 A G 5 1_555 A C 49 1_555 -0.484 -1.970 3.251 6.112 10.155 24.115 -6.501 2.401 2.083 22.639 -13.627 26.832 4 AA_U4G5:C49G50_AA A 4 ? A 50 ? A 5 ? A 49 ? 1 A G 5 1_555 A C 49 1_555 A U 6 1_555 A G 48 1_555 -0.167 -1.209 3.152 -1.326 5.054 39.155 -2.350 0.100 2.983 7.500 1.968 39.489 5 AA_G5U6:G48C49_AA A 5 ? A 49 ? A 6 ? A 48 ? 1 A U 6 1_555 A G 48 1_555 A G 7 1_555 A A 47 1_555 -0.212 -1.351 2.956 4.968 6.382 53.196 -1.844 0.506 2.760 7.080 -5.512 53.763 6 AA_U6G7:A47G48_AA A 6 ? A 48 ? A 7 ? A 47 ? 1 A G 7 1_555 A A 47 1_555 A A 9 1_555 A G 46 1_555 -1.923 -0.467 5.594 6.307 16.956 4.874 -14.629 10.816 0.392 70.338 -26.161 18.731 7 AA_G7A9:G46A47_AA A 7 ? A 47 ? A 9 ? A 46 ? 1 A A 9 1_555 A G 46 1_555 A C 10 1_555 A G 45 1_555 0.252 -0.595 3.037 0.046 7.047 59.183 -0.925 -0.252 2.955 7.108 -0.047 59.564 8 AA_A9C10:G45G46_AA A 9 ? A 46 ? A 10 ? A 45 ? 1 A C 10 1_555 A G 45 1_555 A C 11 1_555 A G 44 1_555 0.363 -2.220 3.070 4.719 4.689 25.883 -5.892 0.307 2.657 10.253 -10.320 26.710 9 AA_C10C11:G44G45_AA A 10 ? A 45 ? A 11 ? A 44 ? 1 A C 11 1_555 A G 44 1_555 A G 12 1_555 A C 43 1_555 0.300 -1.894 3.599 1.636 14.116 33.953 -4.923 -0.253 2.642 22.964 -2.661 36.726 10 AA_C11G12:C43G44_AA A 11 ? A 44 ? A 12 ? A 43 ? 1 A G 12 1_555 A C 43 1_555 A U 13 1_555 A A 42 1_555 0.079 -1.275 3.302 -1.547 4.528 33.656 -2.893 -0.378 3.102 7.771 2.654 33.984 11 AA_G12U13:A42C43_AA A 12 ? A 43 ? A 13 ? A 42 ? 1 A U 13 1_555 A A 42 1_555 A G 21 1_555 A C 40 1_555 -2.868 -2.922 5.807 1.804 4.195 76.256 -2.578 2.412 5.606 3.395 -1.460 76.372 12 AA_U13G21:C40A42_AA A 13 ? A 42 ? A 21 ? A 40 ? 1 A G 21 1_555 A C 40 1_555 A U 22 1_555 A A 39 1_555 -0.291 -1.288 3.264 0.225 8.418 32.852 -3.496 0.533 2.854 14.587 -0.390 33.886 13 AA_G21U22:A39C40_AA A 21 ? A 40 ? A 22 ? A 39 ? 1 A U 22 1_555 A A 39 1_555 A C 23 1_555 A G 38 1_555 -0.257 -1.276 3.215 -2.690 6.703 33.378 -3.183 0.033 2.922 11.503 4.617 34.129 14 AA_U22C23:G38A39_AA A 22 ? A 39 ? A 23 ? A 38 ? 1 A C 23 1_555 A G 38 1_555 A C 24 1_555 A G 37 1_555 0.250 -1.787 3.193 3.185 8.751 33.035 -4.285 0.032 2.659 15.022 -5.468 34.288 15 AA_C23C24:G37G38_AA A 23 ? A 38 ? A 24 ? A 37 ? 1 A C 24 1_555 A G 37 1_555 A C 25 1_555 A G 36 1_555 0.496 -1.921 3.184 1.952 5.470 27.955 -5.047 -0.596 2.792 11.170 -3.985 28.540 16 AA_C24C25:G36G37_AA A 24 ? A 37 ? A 25 ? A 36 ? 1 A C 25 1_555 A G 36 1_555 A A 26 1_555 A U 35 1_555 0.263 -1.837 3.235 1.498 8.320 28.211 -5.243 -0.224 2.608 16.603 -2.989 29.426 17 AA_C25A26:U35G36_AA A 25 ? A 36 ? A 26 ? A 35 ? 1 A A 26 1_555 A U 35 1_555 A G 27 1_555 A C 34 1_555 -0.201 -1.513 3.211 -1.719 4.642 34.824 -3.165 0.088 2.997 7.708 2.855 35.163 18 AA_A26G27:C34U35_AA A 26 ? A 35 ? A 27 ? A 34 ? 1 A G 27 1_555 A C 34 1_555 A C 28 1_555 A G 32 1_555 -0.726 -0.641 3.009 7.786 6.649 27.068 -2.567 2.955 2.485 13.603 -15.930 28.906 19 AA_G27C28:G32C34_AA A 27 ? A 34 ? A 28 ? A 32 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id THG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id THG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 8XZE _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 8XZW _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.020365 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.017391 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.016081 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_