data_9CK9 # _entry.id 9CK9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.410 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9CK9 pdb_00009ck9 10.2210/pdb9ck9/pdb WWPDB D_1000285559 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-03-18 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9CK9 _pdbx_database_status.recvd_initial_deposition_date 2024-07-08 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible N # _pdbx_database_related.db_name PDB _pdbx_database_related.details . _pdbx_database_related.db_id 8VH6 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 5 _pdbx_contact_author.email rs17@nyu.edu _pdbx_contact_author.name_first Ruojie _pdbx_contact_author.name_last Sha _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-0807-734X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Vecchioni, S.' 1 0000-0001-8243-650X 'Lu, B.' 2 0000-0001-6424-2197 'Sha, R.' 3 0000-0002-0807-734X 'Ohayon, Y.P.' 4 0000-0001-7500-4282 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Thiopyrimidine metal base pairs' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Vecchioni, S.' 1 ? primary 'Sha, R.' 2 ? primary 'Lu, B.' 3 ? primary 'Ohayon, Y.P.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;DNA (5'-D(*GP*AP*GP*CP*AP*GP*CP*CP*TP*GP*TP*CP*TP*GP*GP*AP*CP*AP*TP*CP*A)-3') ; 6448.173 1 ? ? ? ? 2 polymer syn ;DNA (5'-D(P*CP*CP*AP*GP*AP*CP*A)-3') ; 2091.414 1 ? ? ? ? 3 polymer syn ;DNA (5'-D(P*GP*GP*CP*TP*GP*CP*T)-3') ; 2129.409 1 ? ? ? ? 4 polymer syn ;DNA (5'-D(P*CP*TP*GP*AP*TP*GP*(2PS))-3') ; 2144.487 1 ? ? ? ? 5 non-polymer syn 'SILVER ION' 107.868 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polydeoxyribonucleotide no no ;(DG)(DA)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(DC)(DT)(DG)(DG)(DA)(DC)(DA)(DT)(DC) (DA) ; GAGCAGCCTGTCTGGACATCA A ? 2 polydeoxyribonucleotide no no '(DC)(DC)(DA)(DG)(DA)(DC)(DA)' CCAGACA B ? 3 polydeoxyribonucleotide no no '(DG)(DG)(DC)(DT)(DG)(DC)(DT)' GGCTGCT C ? 4 polydeoxyribonucleotide no yes '(DC)(DT)(DG)(DA)(DT)(DG)(A1AAZ)' CTGATGX D ? # _pdbx_entity_nonpoly.entity_id 5 _pdbx_entity_nonpoly.name 'SILVER ION' _pdbx_entity_nonpoly.comp_id AG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DG n 1 4 DC n 1 5 DA n 1 6 DG n 1 7 DC n 1 8 DC n 1 9 DT n 1 10 DG n 1 11 DT n 1 12 DC n 1 13 DT n 1 14 DG n 1 15 DG n 1 16 DA n 1 17 DC n 1 18 DA n 1 19 DT n 1 20 DC n 1 21 DA n 2 1 DC n 2 2 DC n 2 3 DA n 2 4 DG n 2 5 DA n 2 6 DC n 2 7 DA n 3 1 DG n 3 2 DG n 3 3 DC n 3 4 DT n 3 5 DG n 3 6 DC n 3 7 DT n 4 1 DC n 4 2 DT n 4 3 DG n 4 4 DA n 4 5 DT n 4 6 DG n 4 7 A1AAZ n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 21 'synthetic construct' ? 32630 ? 2 1 sample 1 7 'synthetic construct' ? 32630 ? 3 1 sample 1 7 'synthetic construct' ? 32630 ? 4 1 sample 1 7 'synthetic construct' ? 32630 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A1AAZ 'DNA linking' n 2-thio-thymidine ? 'C10 H15 N2 O7 P S' 338.274 AG non-polymer . 'SILVER ION' ? 'Ag 1' 107.868 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DG 3 3 3 DG DG A . n A 1 4 DC 4 4 4 DC DC A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DT 11 11 11 DT DT A . n A 1 12 DC 12 12 12 DC DC A . n A 1 13 DT 13 13 13 DT DT A . n A 1 14 DG 14 14 14 DG DG A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DC 17 17 17 DC DC A . n A 1 18 DA 18 18 18 DA DA A . n A 1 19 DT 19 19 19 DT DT A . n A 1 20 DC 20 20 20 DC DC A . n A 1 21 DA 21 21 21 DA DA A . n B 2 1 DC 1 1 1 DC DC B . n B 2 2 DC 2 2 2 DC DC B . n B 2 3 DA 3 3 3 DA DA B . n B 2 4 DG 4 4 4 DG DG B . n B 2 5 DA 5 5 5 DA DA B . n B 2 6 DC 6 6 6 DC DC B . n B 2 7 DA 7 7 7 DA DA B . n C 3 1 DG 1 8 8 DG DG C . n C 3 2 DG 2 9 9 DG DG C . n C 3 3 DC 3 10 10 DC DC C . n C 3 4 DT 4 11 11 DT DT C . n C 3 5 DG 5 12 12 DG DG C . n C 3 6 DC 6 13 13 DC DC C . n C 3 7 DT 7 14 14 DT DT C . n D 4 1 DC 1 1 1 DC DC D . n D 4 2 DT 2 2 2 DT DT D . n D 4 3 DG 3 3 3 DG DG D . n D 4 4 DA 4 4 4 DA DA D . n D 4 5 DT 5 5 5 DT DT D . n D 4 6 DG 6 6 6 DG DG D . n D 4 7 A1AAZ 7 7 7 A1AAZ 2PS D . n # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 A1AAZ ? ? A1AAZ ? ? 'SUBJECT OF INVESTIGATION' ? 2 AG ? ? AG ? ? 'SUBJECT OF INVESTIGATION' ? # _pdbx_nonpoly_scheme.asym_id E _pdbx_nonpoly_scheme.entity_id 5 _pdbx_nonpoly_scheme.mon_id AG _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 1 _pdbx_nonpoly_scheme.pdb_mon_id AG _pdbx_nonpoly_scheme.auth_mon_id AG _pdbx_nonpoly_scheme.pdb_strand_id D _pdbx_nonpoly_scheme.pdb_ins_code . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? STARANISO ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 9CK9 _cell.details ? _cell.formula_units_Z ? _cell.length_a 105.679 _cell.length_a_esd ? _cell.length_b 105.679 _cell.length_b_esd ? _cell.length_c 88.730 _cell.length_c_esd ? _cell.volume 858180.226 _cell.volume_esd ? _cell.Z_PDB 9 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9CK9 _symmetry.cell_setting ? _symmetry.Int_Tables_number 146 _symmetry.space_group_name_Hall 'H 3' _symmetry.space_group_name_H-M 'H 3' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9CK9 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews ? _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol ? _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 8.0 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details '338-293 at 0.4 degree/hr' _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '100 mM MOPS, 1.25 M magnesium sulfate' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 X 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-12-12 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.00743 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 17-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.00743 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 17-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate 322.52 _reflns.entry_id 9CK9 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 4.553 _reflns.d_resolution_low 63.705 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 2758 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 86.1 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 10.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 4.553 5.132 ? ? ? ? ? ? 196 ? ? ? ? ? ? ? ? ? ? ? 11.0 ? ? ? ? ? ? 1 1 0.197 ? ? 56.6 ? ? ? ? ? ? ? ? ? ? ? 10.169 63.705 ? ? ? ? ? ? 191 ? ? ? ? ? ? ? ? ? ? ? 11.3 ? ? ? ? ? ? 2 1 0.999 ? ? 99.0 ? ? ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 336.52 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9CK9 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 4.553 _refine.ls_d_res_low 32.23 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 2758 _refine.ls_number_reflns_R_free 152 _refine.ls_number_reflns_R_work 2606 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 65.42 _refine.ls_percent_reflns_R_free 5.51 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.1644 _refine.ls_R_factor_R_free 0.1735 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1620 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.96 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.8768 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.5784 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 4.553 _refine_hist.d_res_low 32.23 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 860 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 859 _refine_hist.pdbx_number_atoms_ligand 1 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0087 ? 960 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.1693 ? 1474 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0676 ? 166 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0067 ? 42 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 40.1478 ? 401 ? f_dihedral_angle_d ? ? # _refine_ls_shell.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_shell.d_res_high 4.553 _refine_ls_shell.d_res_low 32.23 _refine_ls_shell.number_reflns_all ? _refine_ls_shell.number_reflns_obs ? _refine_ls_shell.number_reflns_R_free 152 _refine_ls_shell.number_reflns_R_work 2606 _refine_ls_shell.percent_reflns_obs 65.42 _refine_ls_shell.percent_reflns_R_free ? _refine_ls_shell.R_factor_all ? _refine_ls_shell.R_factor_obs ? _refine_ls_shell.R_factor_R_free_error ? _refine_ls_shell.R_factor_R_work 0.1620 _refine_ls_shell.redundancy_reflns_all ? _refine_ls_shell.redundancy_reflns_obs ? _refine_ls_shell.wR_factor_all ? _refine_ls_shell.wR_factor_obs ? _refine_ls_shell.wR_factor_R_free ? _refine_ls_shell.wR_factor_R_work ? _refine_ls_shell.pdbx_R_complete ? _refine_ls_shell.pdbx_total_number_of_bins_used ? _refine_ls_shell.pdbx_phase_error ? _refine_ls_shell.pdbx_fsc_work ? _refine_ls_shell.pdbx_fsc_free ? _refine_ls_shell.R_factor_R_free 0.1735 # _struct.entry_id 9CK9 _struct.title ;[7F1F-AgR3-int] Tensegrity triangle with 2-thiothymidine modification in the junction region intercalating Ag+ between base pair stacks with R3 symmetry ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9CK9 _struct_keywords.text 'Tensegrity triangle, metal base pair, thiopyrimidine, intercalation, Ag+, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 9CK9 9CK9 ? 1 ? 1 2 PDB 9CK9 9CK9 ? 2 ? 1 3 PDB 9CK9 9CK9 ? 3 ? 1 4 PDB 9CK9 9CK9 ? 4 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 9CK9 A 1 ? 21 ? 9CK9 1 ? 21 ? 1 21 2 2 9CK9 B 1 ? 7 ? 9CK9 1 ? 7 ? 1 7 3 3 9CK9 C 1 ? 7 ? 9CK9 8 ? 14 ? 8 14 4 4 9CK9 D 1 ? 7 ? 9CK9 1 ? 7 ? 1 7 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dodecameric _pdbx_struct_assembly.oligomeric_count 12 # loop_ _pdbx_struct_assembly_gen.assembly_id _pdbx_struct_assembly_gen.oper_expression _pdbx_struct_assembly_gen.asym_id_list 1 1 A,B,C,D,E 1 2 A,B,C,D,E 1 3 A,B,C,D,E # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 2_555 -y,x-y,z -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 3_555 -x+y,-x,z -0.5000000000 0.8660254038 0.0000000000 0.0000000000 -0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? D DG 6 "O3'" ? ? ? 1_555 D A1AAZ 7 P ? ? D DG 6 D A1AAZ 7 1_555 ? ? ? ? ? ? ? 1.613 ? ? metalc1 metalc ? ? A DA 16 N1 ? ? ? 1_555 E AG . AG ? ? A DA 16 D AG 101 1_555 ? ? ? ? ? ? ? 2.306 ? ? metalc2 metalc ? ? A DC 17 N3 ? ? ? 1_555 E AG . AG ? ? A DC 17 D AG 101 1_555 ? ? ? ? ? ? ? 2.404 ? ? metalc3 metalc ? ? D DG 6 O6 ? ? ? 1_555 E AG . AG ? ? D DG 6 D AG 101 1_555 ? ? ? ? ? ? ? 2.402 ? ? metalc4 metalc ? ? D DG 6 N1 ? ? ? 1_555 E AG . AG ? ? D DG 6 D AG 101 1_555 ? ? ? ? ? ? ? 2.382 ? ? metalc5 metalc ? ? D A1AAZ 7 N3 ? ? ? 1_555 E AG . AG ? ? D A1AAZ 7 D AG 101 1_555 ? ? ? ? ? ? ? 2.324 ? ? hydrog1 hydrog ? ? A DA 2 N1 ? ? ? 1_555 C DT 7 N3 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DA 2 N6 ? ? ? 1_555 C DT 7 O4 ? ? A DA 2 C DT 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 3 N1 ? ? ? 1_555 C DC 6 N3 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DG 3 N2 ? ? ? 1_555 C DC 6 O2 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DG 3 O6 ? ? ? 1_555 C DC 6 N4 ? ? A DG 3 C DC 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 4 N3 ? ? ? 1_555 C DG 5 N1 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DC 4 N4 ? ? ? 1_555 C DG 5 O6 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DC 4 O2 ? ? ? 1_555 C DG 5 N2 ? ? A DC 4 C DG 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DA 5 N1 ? ? ? 1_555 C DT 4 N3 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DA 5 N6 ? ? ? 1_555 C DT 4 O4 ? ? A DA 5 C DT 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 C DC 3 N3 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 C DC 3 O2 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 6 O6 ? ? ? 1_555 C DC 3 N4 ? ? A DG 6 C DC 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 7 N3 ? ? ? 1_555 C DG 2 N1 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 7 N4 ? ? ? 1_555 C DG 2 O6 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 7 O2 ? ? ? 1_555 C DG 2 N2 ? ? A DC 7 C DG 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 N3 ? ? ? 1_555 C DG 1 N1 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 8 N4 ? ? ? 1_555 C DG 1 O6 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 8 O2 ? ? ? 1_555 C DG 1 N2 ? ? A DC 8 C DG 8 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DT 9 N3 ? ? ? 1_555 B DA 7 N1 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DT 9 O4 ? ? ? 1_555 B DA 7 N6 ? ? A DT 9 B DA 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DG 10 N1 ? ? ? 1_555 B DC 6 N3 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 10 N2 ? ? ? 1_555 B DC 6 O2 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 10 O6 ? ? ? 1_555 B DC 6 N4 ? ? A DG 10 B DC 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 5 N1 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 5 N6 ? ? A DT 11 B DA 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 12 N3 ? ? ? 1_555 B DG 4 N1 ? ? A DC 12 B DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 12 N4 ? ? ? 1_555 B DG 4 O6 ? ? A DC 12 B DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DC 12 O2 ? ? ? 1_555 B DG 4 N2 ? ? A DC 12 B DG 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A DT 13 N3 ? ? ? 1_555 B DA 3 N1 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A DT 13 O4 ? ? ? 1_555 B DA 3 N6 ? ? A DT 13 B DA 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A DG 14 N1 ? ? ? 1_555 B DC 2 N3 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DG 14 N2 ? ? ? 1_555 B DC 2 O2 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DG 14 O6 ? ? ? 1_555 B DC 2 N4 ? ? A DG 14 B DC 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 1 N3 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 1 O2 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 1 N4 ? ? A DG 15 B DC 1 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 16 N1 ? ? ? 1_555 D A1AAZ 7 N3 ? ? A DA 16 D A1AAZ 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 16 N6 ? ? ? 1_555 D A1AAZ 7 O4 ? ? A DA 16 D A1AAZ 7 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DC 17 N3 ? ? ? 1_555 D DG 6 N1 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DC 17 N4 ? ? ? 1_555 D DG 6 O6 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 17 O2 ? ? ? 1_555 D DG 6 N2 ? ? A DC 17 D DG 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DA 18 N1 ? ? ? 1_555 D DT 5 N3 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DA 18 N6 ? ? ? 1_555 D DT 5 O4 ? ? A DA 18 D DT 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A DT 19 N3 ? ? ? 1_555 D DA 4 N1 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A DT 19 O4 ? ? ? 1_555 D DA 4 N6 ? ? A DT 19 D DA 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A DC 20 N3 ? ? ? 1_555 D DG 3 N1 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A DC 20 N4 ? ? ? 1_555 D DG 3 O6 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A DC 20 O2 ? ? ? 1_555 D DG 3 N2 ? ? A DC 20 D DG 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A DA 21 N1 ? ? ? 1_555 D DT 2 N3 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A DA 21 N6 ? ? ? 1_555 D DT 2 O4 ? ? A DA 21 D DT 2 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 N1 ? A DA 16 ? A DA 16 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N3 ? A DC 17 ? A DC 17 ? 1_555 111.4 ? 2 N1 ? A DA 16 ? A DA 16 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 O6 ? D DG 6 ? D DG 6 ? 1_555 108.7 ? 3 N3 ? A DC 17 ? A DC 17 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 O6 ? D DG 6 ? D DG 6 ? 1_555 100.0 ? 4 N1 ? A DA 16 ? A DA 16 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N1 ? D DG 6 ? D DG 6 ? 1_555 165.0 ? 5 N3 ? A DC 17 ? A DC 17 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N1 ? D DG 6 ? D DG 6 ? 1_555 77.9 ? 6 O6 ? D DG 6 ? D DG 6 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N1 ? D DG 6 ? D DG 6 ? 1_555 57.0 ? 7 N1 ? A DA 16 ? A DA 16 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N3 ? D A1AAZ 7 ? D A1AAZ 7 ? 1_555 86.9 ? 8 N3 ? A DC 17 ? A DC 17 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N3 ? D A1AAZ 7 ? D A1AAZ 7 ? 1_555 153.8 ? 9 O6 ? D DG 6 ? D DG 6 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N3 ? D A1AAZ 7 ? D A1AAZ 7 ? 1_555 91.0 ? 10 N1 ? D DG 6 ? D DG 6 ? 1_555 AG ? E AG . ? D AG 101 ? 1_555 N3 ? D A1AAZ 7 ? D A1AAZ 7 ? 1_555 88.6 ? # _pdbx_entry_details.entry_id 9CK9 _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "C5'" A DC 12 ? ? "C4'" A DC 12 ? ? 1.565 1.512 0.053 0.007 N 2 1 P D DC 1 ? ? OP3 D DC 1 ? ? 1.479 1.607 -0.128 0.012 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DC 7 ? ? "C1'" A DC 7 ? ? N1 A DC 7 ? ? 111.11 108.30 2.81 0.30 N 2 1 "O4'" A DT 11 ? ? "C1'" A DT 11 ? ? N1 A DT 11 ? ? 112.64 108.30 4.34 0.30 N 3 1 "C3'" B DC 6 ? ? "C2'" B DC 6 ? ? "C1'" B DC 6 ? ? 97.41 102.40 -4.99 0.80 N 4 1 "O4'" D DG 3 ? ? "C1'" D DG 3 ? ? N9 D DG 3 ? ? 110.95 108.30 2.65 0.30 N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 -y,x-y,z 3 -x+y,-x,z 4 x+1/3,y+2/3,z+2/3 5 -y+1/3,x-y+2/3,z+2/3 6 -x+y+1/3,-x+2/3,z+2/3 7 x+2/3,y+1/3,z+1/3 8 -y+2/3,x-y+1/3,z+1/3 9 -x+y+2/3,-x+1/3,z+1/3 # loop_ _pdbx_refine_tls.id _pdbx_refine_tls.pdbx_refine_id _pdbx_refine_tls.details _pdbx_refine_tls.method _pdbx_refine_tls.origin_x _pdbx_refine_tls.origin_y _pdbx_refine_tls.origin_z _pdbx_refine_tls.T[1][1] _pdbx_refine_tls.T[1][1]_esd _pdbx_refine_tls.T[1][2] _pdbx_refine_tls.T[1][2]_esd _pdbx_refine_tls.T[1][3] _pdbx_refine_tls.T[1][3]_esd _pdbx_refine_tls.T[2][2] _pdbx_refine_tls.T[2][2]_esd _pdbx_refine_tls.T[2][3] _pdbx_refine_tls.T[2][3]_esd _pdbx_refine_tls.T[3][3] _pdbx_refine_tls.T[3][3]_esd _pdbx_refine_tls.L[1][1] _pdbx_refine_tls.L[1][1]_esd _pdbx_refine_tls.L[1][2] _pdbx_refine_tls.L[1][2]_esd _pdbx_refine_tls.L[1][3] _pdbx_refine_tls.L[1][3]_esd _pdbx_refine_tls.L[2][2] _pdbx_refine_tls.L[2][2]_esd _pdbx_refine_tls.L[2][3] _pdbx_refine_tls.L[2][3]_esd _pdbx_refine_tls.L[3][3] _pdbx_refine_tls.L[3][3]_esd _pdbx_refine_tls.S[1][1] _pdbx_refine_tls.S[1][1]_esd _pdbx_refine_tls.S[1][2] _pdbx_refine_tls.S[1][2]_esd _pdbx_refine_tls.S[1][3] _pdbx_refine_tls.S[1][3]_esd _pdbx_refine_tls.S[2][1] _pdbx_refine_tls.S[2][1]_esd _pdbx_refine_tls.S[2][2] _pdbx_refine_tls.S[2][2]_esd _pdbx_refine_tls.S[2][3] _pdbx_refine_tls.S[2][3]_esd _pdbx_refine_tls.S[3][1] _pdbx_refine_tls.S[3][1]_esd _pdbx_refine_tls.S[3][2] _pdbx_refine_tls.S[3][2]_esd _pdbx_refine_tls.S[3][3] _pdbx_refine_tls.S[3][3]_esd 1 'X-RAY DIFFRACTION' ? refined -15.4477711396 -2.33071043337 23.4630937988 2.88366451717 ? 0.270737910813 ? -0.145669343218 ? 3.06430125311 ? 0.333314563435 ? 3.03297080944 ? 9.08883918397 ? -2.33129662669 ? 3.48172570557 ? 3.54327223033 ? 1.84116864854 ? 2.60233513096 ? 0.163697390719 ? -0.419458285684 ? -2.138327805 ? 1.67771051602 ? 2.30345791061 ? 1.84373053166 ? 0.045475628216 ? -1.16131565701 ? -1.34824426836 ? 2 'X-RAY DIFFRACTION' ? refined -14.1130745331 0.606472498997 22.0959222469 2.81922696894 ? 0.373570894281 ? 0.412637562773 ? 3.4633293583 ? -0.0835885062263 ? 4.0808667147 ? 2.9356108741 ? 1.07024179797 ? 2.94158309765 ? 0.542371864142 ? 1.09751480692 ? 3.2346613694 ? 0.269093214207 ? -3.09716688182 ? 1.01087878184 ? -2.10975204105 ? 3.73926010125 ? -6.02228095398 ? 0.581920887694 ? -5.13710183037 ? -2.74739404937 ? 3 'X-RAY DIFFRACTION' ? refined -17.97910984 -19.5916144413 34.8525529548 2.65780721161 ? -0.113687918985 ? -0.538647050621 ? 3.13648607084 ? 0.255124528906 ? 4.98510343449 ? 2.85317412266 ? 0.494998928809 ? -1.22914764717 ? 3.03148200748 ? 1.53024790745 ? 2.17099309346 ? 4.46112128802 ? -0.019502423665 ? 4.87457139528 ? 3.26268255443 ? 1.89208510165 ? 4.47275050399 ? 0.993547199802 ? 1.75740940346 ? -4.90774511176 ? 4 'X-RAY DIFFRACTION' ? refined -13.182787914 20.3275307136 9.47245073958 3.28880111577 ? 0.567472292004 ? 0.29605451517 ? 2.42033938005 ? 0.953432074563 ? 2.72151460687 ? 10.355802099 ? 4.15423392315 ? -3.44687129586 ? 3.48621512817 ? 0.404499187334 ? 3.71468866002 ? -2.4854489156 ? 0.152846177068 ? 3.45354077739 ? -1.612870659 ? 1.79274194072 ? 1.10988187019 ? -5.36888213499 ? -1.43284250656 ? -1.69060827275 ? # loop_ _pdbx_refine_tls_group.id _pdbx_refine_tls_group.pdbx_refine_id _pdbx_refine_tls_group.refine_tls_id _pdbx_refine_tls_group.beg_label_asym_id _pdbx_refine_tls_group.beg_label_seq_id _pdbx_refine_tls_group.beg_auth_asym_id _pdbx_refine_tls_group.beg_auth_seq_id _pdbx_refine_tls_group.beg_PDB_ins_code _pdbx_refine_tls_group.end_label_asym_id _pdbx_refine_tls_group.end_label_seq_id _pdbx_refine_tls_group.end_auth_asym_id _pdbx_refine_tls_group.end_auth_seq_id _pdbx_refine_tls_group.end_PDB_ins_code _pdbx_refine_tls_group.selection _pdbx_refine_tls_group.selection_details 1 'X-RAY DIFFRACTION' 1 A ? A 1 ? A ? A 21 ? ? ;(chain 'A' and resid 1 through 21) ; 2 'X-RAY DIFFRACTION' 2 B ? B 1 ? B ? B 7 ? ? ;(chain 'B' and resid 1 through 7) ; 3 'X-RAY DIFFRACTION' 3 C ? C 8 ? C ? C 14 ? ? ;(chain 'C' and resid 8 through 14) ; 4 'X-RAY DIFFRACTION' 4 D ? D 1 ? D 7 D 7 ? ? ;(chain 'D' and resid 1 through 7) ; # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A1AAZ "C1'" C N R 1 A1AAZ C2 C N N 2 A1AAZ "C2'" C N N 3 A1AAZ "C3'" C N S 4 A1AAZ C4 C N N 5 A1AAZ "C4'" C N R 6 A1AAZ C5 C N N 7 A1AAZ "C5'" C N N 8 A1AAZ C6 C N N 9 A1AAZ C7 C N N 10 A1AAZ N1 N N N 11 A1AAZ N3 N N N 12 A1AAZ "O3'" O N N 13 A1AAZ O4 O N N 14 A1AAZ "O4'" O N N 15 A1AAZ "O5'" O N N 16 A1AAZ OP1 O N N 17 A1AAZ OP2 O N N 18 A1AAZ P P N N 19 A1AAZ S1 S N N 20 A1AAZ H1 H N N 21 A1AAZ H2 H N N 22 A1AAZ H3 H N N 23 A1AAZ H4 H N N 24 A1AAZ H5 H N N 25 A1AAZ H6 H N N 26 A1AAZ H7 H N N 27 A1AAZ H8 H N N 28 A1AAZ H9 H N N 29 A1AAZ H10 H N N 30 A1AAZ H11 H N N 31 A1AAZ H12 H N N 32 A1AAZ H15 H N N 33 A1AAZ OP3 O N N 34 A1AAZ H17 H N N 35 A1AAZ H13 H N N 36 AG AG AG N N 37 DA OP3 O N N 38 DA P P N N 39 DA OP1 O N N 40 DA OP2 O N N 41 DA "O5'" O N N 42 DA "C5'" C N N 43 DA "C4'" C N R 44 DA "O4'" O N N 45 DA "C3'" C N S 46 DA "O3'" O N N 47 DA "C2'" C N N 48 DA "C1'" C N R 49 DA N9 N Y N 50 DA C8 C Y N 51 DA N7 N Y N 52 DA C5 C Y N 53 DA C6 C Y N 54 DA N6 N N N 55 DA N1 N Y N 56 DA C2 C Y N 57 DA N3 N Y N 58 DA C4 C Y N 59 DA HOP3 H N N 60 DA HOP2 H N N 61 DA "H5'" H N N 62 DA "H5''" H N N 63 DA "H4'" H N N 64 DA "H3'" H N N 65 DA "HO3'" H N N 66 DA "H2'" H N N 67 DA "H2''" H N N 68 DA "H1'" H N N 69 DA H8 H N N 70 DA H61 H N N 71 DA H62 H N N 72 DA H2 H N N 73 DC OP3 O N N 74 DC P P N N 75 DC OP1 O N N 76 DC OP2 O N N 77 DC "O5'" O N N 78 DC "C5'" C N N 79 DC "C4'" C N R 80 DC "O4'" O N N 81 DC "C3'" C N S 82 DC "O3'" O N N 83 DC "C2'" C N N 84 DC "C1'" C N R 85 DC N1 N N N 86 DC C2 C N N 87 DC O2 O N N 88 DC N3 N N N 89 DC C4 C N N 90 DC N4 N N N 91 DC C5 C N N 92 DC C6 C N N 93 DC HOP3 H N N 94 DC HOP2 H N N 95 DC "H5'" H N N 96 DC "H5''" H N N 97 DC "H4'" H N N 98 DC "H3'" H N N 99 DC "HO3'" H N N 100 DC "H2'" H N N 101 DC "H2''" H N N 102 DC "H1'" H N N 103 DC H41 H N N 104 DC H42 H N N 105 DC H5 H N N 106 DC H6 H N N 107 DG OP3 O N N 108 DG P P N N 109 DG OP1 O N N 110 DG OP2 O N N 111 DG "O5'" O N N 112 DG "C5'" C N N 113 DG "C4'" C N R 114 DG "O4'" O N N 115 DG "C3'" C N S 116 DG "O3'" O N N 117 DG "C2'" C N N 118 DG "C1'" C N R 119 DG N9 N Y N 120 DG C8 C Y N 121 DG N7 N Y N 122 DG C5 C Y N 123 DG C6 C N N 124 DG O6 O N N 125 DG N1 N N N 126 DG C2 C N N 127 DG N2 N N N 128 DG N3 N N N 129 DG C4 C Y N 130 DG HOP3 H N N 131 DG HOP2 H N N 132 DG "H5'" H N N 133 DG "H5''" H N N 134 DG "H4'" H N N 135 DG "H3'" H N N 136 DG "HO3'" H N N 137 DG "H2'" H N N 138 DG "H2''" H N N 139 DG "H1'" H N N 140 DG H8 H N N 141 DG H1 H N N 142 DG H21 H N N 143 DG H22 H N N 144 DT OP3 O N N 145 DT P P N N 146 DT OP1 O N N 147 DT OP2 O N N 148 DT "O5'" O N N 149 DT "C5'" C N N 150 DT "C4'" C N R 151 DT "O4'" O N N 152 DT "C3'" C N S 153 DT "O3'" O N N 154 DT "C2'" C N N 155 DT "C1'" C N R 156 DT N1 N N N 157 DT C2 C N N 158 DT O2 O N N 159 DT N3 N N N 160 DT C4 C N N 161 DT O4 O N N 162 DT C5 C N N 163 DT C7 C N N 164 DT C6 C N N 165 DT HOP3 H N N 166 DT HOP2 H N N 167 DT "H5'" H N N 168 DT "H5''" H N N 169 DT "H4'" H N N 170 DT "H3'" H N N 171 DT "HO3'" H N N 172 DT "H2'" H N N 173 DT "H2''" H N N 174 DT "H1'" H N N 175 DT H3 H N N 176 DT H71 H N N 177 DT H72 H N N 178 DT H73 H N N 179 DT H6 H N N 180 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A1AAZ "C1'" "C2'" sing N N 1 A1AAZ "C1'" N1 sing N N 2 A1AAZ "C1'" "O4'" sing N N 3 A1AAZ C2 N1 sing N N 4 A1AAZ C2 N3 sing N N 5 A1AAZ C2 S1 doub N N 6 A1AAZ "C2'" "C3'" sing N N 7 A1AAZ "C3'" "C4'" sing N N 8 A1AAZ "C3'" "O3'" sing N N 9 A1AAZ C4 C5 sing N N 10 A1AAZ C4 N3 sing N N 11 A1AAZ C4 O4 doub N N 12 A1AAZ "C4'" "C5'" sing N N 13 A1AAZ "C4'" "O4'" sing N N 14 A1AAZ C5 C6 doub N N 15 A1AAZ C5 C7 sing N N 16 A1AAZ "C5'" "O5'" sing N N 17 A1AAZ C6 N1 sing N N 18 A1AAZ "O5'" P sing N N 19 A1AAZ OP1 P doub N N 20 A1AAZ OP2 P sing N N 21 A1AAZ "C1'" H1 sing N N 22 A1AAZ "C2'" H2 sing N N 23 A1AAZ "C2'" H3 sing N N 24 A1AAZ "C3'" H4 sing N N 25 A1AAZ "C4'" H5 sing N N 26 A1AAZ "C5'" H6 sing N N 27 A1AAZ "C5'" H7 sing N N 28 A1AAZ C6 H8 sing N N 29 A1AAZ C7 H9 sing N N 30 A1AAZ C7 H10 sing N N 31 A1AAZ C7 H11 sing N N 32 A1AAZ "O3'" H12 sing N N 33 A1AAZ OP2 H15 sing N N 34 A1AAZ P OP3 sing N N 35 A1AAZ N3 H17 sing N N 36 A1AAZ OP3 H13 sing N N 37 DA OP3 P sing N N 38 DA OP3 HOP3 sing N N 39 DA P OP1 doub N N 40 DA P OP2 sing N N 41 DA P "O5'" sing N N 42 DA OP2 HOP2 sing N N 43 DA "O5'" "C5'" sing N N 44 DA "C5'" "C4'" sing N N 45 DA "C5'" "H5'" sing N N 46 DA "C5'" "H5''" sing N N 47 DA "C4'" "O4'" sing N N 48 DA "C4'" "C3'" sing N N 49 DA "C4'" "H4'" sing N N 50 DA "O4'" "C1'" sing N N 51 DA "C3'" "O3'" sing N N 52 DA "C3'" "C2'" sing N N 53 DA "C3'" "H3'" sing N N 54 DA "O3'" "HO3'" sing N N 55 DA "C2'" "C1'" sing N N 56 DA "C2'" "H2'" sing N N 57 DA "C2'" "H2''" sing N N 58 DA "C1'" N9 sing N N 59 DA "C1'" "H1'" sing N N 60 DA N9 C8 sing Y N 61 DA N9 C4 sing Y N 62 DA C8 N7 doub Y N 63 DA C8 H8 sing N N 64 DA N7 C5 sing Y N 65 DA C5 C6 sing Y N 66 DA C5 C4 doub Y N 67 DA C6 N6 sing N N 68 DA C6 N1 doub Y N 69 DA N6 H61 sing N N 70 DA N6 H62 sing N N 71 DA N1 C2 sing Y N 72 DA C2 N3 doub Y N 73 DA C2 H2 sing N N 74 DA N3 C4 sing Y N 75 DC OP3 P sing N N 76 DC OP3 HOP3 sing N N 77 DC P OP1 doub N N 78 DC P OP2 sing N N 79 DC P "O5'" sing N N 80 DC OP2 HOP2 sing N N 81 DC "O5'" "C5'" sing N N 82 DC "C5'" "C4'" sing N N 83 DC "C5'" "H5'" sing N N 84 DC "C5'" "H5''" sing N N 85 DC "C4'" "O4'" sing N N 86 DC "C4'" "C3'" sing N N 87 DC "C4'" "H4'" sing N N 88 DC "O4'" "C1'" sing N N 89 DC "C3'" "O3'" sing N N 90 DC "C3'" "C2'" sing N N 91 DC "C3'" "H3'" sing N N 92 DC "O3'" "HO3'" sing N N 93 DC "C2'" "C1'" sing N N 94 DC "C2'" "H2'" sing N N 95 DC "C2'" "H2''" sing N N 96 DC "C1'" N1 sing N N 97 DC "C1'" "H1'" sing N N 98 DC N1 C2 sing N N 99 DC N1 C6 sing N N 100 DC C2 O2 doub N N 101 DC C2 N3 sing N N 102 DC N3 C4 doub N N 103 DC C4 N4 sing N N 104 DC C4 C5 sing N N 105 DC N4 H41 sing N N 106 DC N4 H42 sing N N 107 DC C5 C6 doub N N 108 DC C5 H5 sing N N 109 DC C6 H6 sing N N 110 DG OP3 P sing N N 111 DG OP3 HOP3 sing N N 112 DG P OP1 doub N N 113 DG P OP2 sing N N 114 DG P "O5'" sing N N 115 DG OP2 HOP2 sing N N 116 DG "O5'" "C5'" sing N N 117 DG "C5'" "C4'" sing N N 118 DG "C5'" "H5'" sing N N 119 DG "C5'" "H5''" sing N N 120 DG "C4'" "O4'" sing N N 121 DG "C4'" "C3'" sing N N 122 DG "C4'" "H4'" sing N N 123 DG "O4'" "C1'" sing N N 124 DG "C3'" "O3'" sing N N 125 DG "C3'" "C2'" sing N N 126 DG "C3'" "H3'" sing N N 127 DG "O3'" "HO3'" sing N N 128 DG "C2'" "C1'" sing N N 129 DG "C2'" "H2'" sing N N 130 DG "C2'" "H2''" sing N N 131 DG "C1'" N9 sing N N 132 DG "C1'" "H1'" sing N N 133 DG N9 C8 sing Y N 134 DG N9 C4 sing Y N 135 DG C8 N7 doub Y N 136 DG C8 H8 sing N N 137 DG N7 C5 sing Y N 138 DG C5 C6 sing N N 139 DG C5 C4 doub Y N 140 DG C6 O6 doub N N 141 DG C6 N1 sing N N 142 DG N1 C2 sing N N 143 DG N1 H1 sing N N 144 DG C2 N2 sing N N 145 DG C2 N3 doub N N 146 DG N2 H21 sing N N 147 DG N2 H22 sing N N 148 DG N3 C4 sing N N 149 DT OP3 P sing N N 150 DT OP3 HOP3 sing N N 151 DT P OP1 doub N N 152 DT P OP2 sing N N 153 DT P "O5'" sing N N 154 DT OP2 HOP2 sing N N 155 DT "O5'" "C5'" sing N N 156 DT "C5'" "C4'" sing N N 157 DT "C5'" "H5'" sing N N 158 DT "C5'" "H5''" sing N N 159 DT "C4'" "O4'" sing N N 160 DT "C4'" "C3'" sing N N 161 DT "C4'" "H4'" sing N N 162 DT "O4'" "C1'" sing N N 163 DT "C3'" "O3'" sing N N 164 DT "C3'" "C2'" sing N N 165 DT "C3'" "H3'" sing N N 166 DT "O3'" "HO3'" sing N N 167 DT "C2'" "C1'" sing N N 168 DT "C2'" "H2'" sing N N 169 DT "C2'" "H2''" sing N N 170 DT "C1'" N1 sing N N 171 DT "C1'" "H1'" sing N N 172 DT N1 C2 sing N N 173 DT N1 C6 sing N N 174 DT C2 O2 doub N N 175 DT C2 N3 sing N N 176 DT N3 C4 sing N N 177 DT N3 H3 sing N N 178 DT C4 O4 doub N N 179 DT C4 C5 sing N N 180 DT C5 C7 sing N N 181 DT C5 C6 doub N N 182 DT C7 H71 sing N N 183 DT C7 H72 sing N N 184 DT C7 H73 sing N N 185 DT C6 H6 sing N N 186 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9CK9 'double helix' 9CK9 'a-form double helix' 9CK9 'b-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DA 2 1_555 C DT 7 1_555 0.137 -0.007 -0.545 -9.652 -8.475 -5.113 1 A_DA2:DT14_C A 2 ? C 14 ? 20 1 1 A DG 3 1_555 C DC 6 1_555 -0.285 -0.204 -0.507 2.162 -10.481 6.116 2 A_DG3:DC13_C A 3 ? C 13 ? 19 1 1 A DC 4 1_555 C DG 5 1_555 0.075 -0.036 -0.160 -8.918 -7.339 -1.983 3 A_DC4:DG12_C A 4 ? C 12 ? 19 1 1 A DA 5 1_555 C DT 4 1_555 2.500 0.006 0.076 -3.109 -1.314 -4.462 4 A_DA5:DT11_C A 5 ? C 11 ? 20 1 1 A DG 6 1_555 C DC 3 1_555 -0.105 -0.504 1.353 8.826 -5.585 -3.472 5 A_DG6:DC10_C A 6 ? C 10 ? 19 1 1 A DC 7 1_555 C DG 2 1_555 0.197 -0.341 1.091 5.490 -7.570 -1.693 6 A_DC7:DG9_C A 7 ? C 9 ? 19 1 1 A DC 8 1_555 C DG 1 1_555 0.103 -0.178 0.392 -7.214 -17.055 -2.487 7 A_DC8:DG8_C A 8 ? C 8 ? 19 1 1 A DT 9 1_555 B DA 7 1_555 -0.215 -0.103 0.661 -4.060 -3.209 -10.426 8 A_DT9:DA7_B A 9 ? B 7 ? 20 1 1 A DG 10 1_555 B DC 6 1_555 -0.287 -0.353 0.853 -2.209 -1.889 3.129 9 A_DG10:DC6_B A 10 ? B 6 ? 19 1 1 A DT 11 1_555 B DA 5 1_555 -0.142 0.045 0.397 6.434 -0.986 -5.218 10 A_DT11:DA5_B A 11 ? B 5 ? 20 1 1 A DC 12 1_555 B DG 4 1_555 -0.467 0.130 0.203 1.241 1.647 9.005 11 A_DC12:DG4_B A 12 ? B 4 ? 19 1 1 A DT 13 1_555 B DA 3 1_555 0.005 -0.315 0.539 0.295 -0.772 11.384 12 A_DT13:DA3_B A 13 ? B 3 ? 20 1 1 A DG 14 1_555 B DC 2 1_555 -0.216 -0.120 -0.030 -6.295 -18.648 -3.079 13 A_DG14:DC2_B A 14 ? B 2 ? 19 1 1 A DG 15 1_555 B DC 1 1_555 -0.279 -0.325 -1.098 -3.764 -11.042 2.019 14 A_DG15:DC1_B A 15 ? B 1 ? 19 1 1 A DA 16 1_555 D A1AAZ 7 1_555 0.919 0.292 0.055 9.353 -21.389 14.328 15 A_DA16:A1AAZ7_D A 16 ? D 7 ? 20 1 1 A DC 17 1_555 D DG 6 1_555 0.156 -0.055 0.339 -7.309 -12.958 -3.420 16 A_DC17:DG6_D A 17 ? D 6 ? 19 1 1 A DA 18 1_555 D DT 5 1_555 0.098 -0.390 0.824 -2.565 -15.436 -0.960 17 A_DA18:DT5_D A 18 ? D 5 ? 20 1 1 A DT 19 1_555 D DA 4 1_555 -0.085 -0.163 -0.562 1.535 -15.563 2.222 18 A_DT19:DA4_D A 19 ? D 4 ? 20 1 1 A DC 20 1_555 D DG 3 1_555 0.179 -0.114 0.032 -5.726 -13.356 4.104 19 A_DC20:DG3_D A 20 ? D 3 ? 19 1 1 A DA 21 1_555 D DT 2 1_555 -0.015 -0.179 -0.046 -7.227 -11.901 2.133 20 A_DA21:DT2_D A 21 ? D 2 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DA 2 1_555 C DT 7 1_555 A DG 3 1_555 C DC 6 1_555 -0.227 0.486 2.945 -8.749 5.288 35.575 0.111 -0.728 2.957 8.443 13.968 36.969 1 AA_DA2DG3:DC13DT14_CC A 2 ? C 14 ? A 3 ? C 13 ? 1 A DG 3 1_555 C DC 6 1_555 A DC 4 1_555 C DG 5 1_555 -0.471 -1.678 3.423 -4.280 -3.358 31.013 -2.414 0.003 3.611 -6.220 7.927 31.475 2 AA_DG3DC4:DG12DC13_CC A 3 ? C 13 ? A 4 ? C 12 ? 1 A DC 4 1_555 C DG 5 1_555 A DA 5 1_555 C DT 4 1_555 -0.516 -0.303 3.019 -1.925 6.851 43.407 -1.001 0.521 2.960 9.189 2.582 43.959 3 AA_DC4DA5:DT11DG12_CC A 4 ? C 12 ? A 5 ? C 11 ? 1 A DA 5 1_555 C DT 4 1_555 A DG 6 1_555 C DC 3 1_555 -0.244 -1.136 2.611 -14.446 12.423 22.863 -4.163 -1.786 1.668 26.247 30.521 29.680 4 AA_DA5DG6:DC10DT11_CC A 5 ? C 11 ? A 6 ? C 10 ? 1 A DG 6 1_555 C DC 3 1_555 A DC 7 1_555 C DG 2 1_555 0.475 -1.825 3.203 -0.530 -1.729 29.620 -3.202 -1.038 3.293 -3.378 1.035 29.674 5 AA_DG6DC7:DG9DC10_CC A 6 ? C 10 ? A 7 ? C 9 ? 1 A DC 7 1_555 C DG 2 1_555 A DC 8 1_555 C DG 1 1_555 -0.911 -0.766 3.608 0.489 -15.428 45.893 0.439 1.157 3.662 -19.159 -0.608 48.286 6 AA_DC7DC8:DG8DG9_CC A 7 ? C 9 ? A 8 ? C 8 ? 1 A DC 8 1_555 C DG 1 1_555 A DT 9 1_555 B DA 7 1_555 -2.240 -0.694 3.569 -1.389 -3.637 19.718 -0.085 5.692 3.781 -10.487 4.006 20.095 7 AA_DC8DT9:DA7DG8_BC A 8 ? C 8 ? A 9 ? B 7 ? 1 A DT 9 1_555 B DA 7 1_555 A DG 10 1_555 B DC 6 1_555 0.457 -0.157 3.503 -2.396 4.406 30.544 -1.200 -1.349 3.402 8.293 4.511 30.943 8 AA_DT9DG10:DC6DA7_BB A 9 ? B 7 ? A 10 ? B 6 ? 1 A DG 10 1_555 B DC 6 1_555 A DT 11 1_555 B DA 5 1_555 -0.685 0.528 3.512 4.612 3.135 31.249 0.351 2.158 3.414 5.762 -8.477 31.730 9 AA_DG10DT11:DA5DC6_BB A 10 ? B 6 ? A 11 ? B 5 ? 1 A DT 11 1_555 B DA 5 1_555 A DC 12 1_555 B DG 4 1_555 0.420 -0.841 3.223 -0.209 5.595 36.782 -2.038 -0.685 3.064 8.804 0.328 37.191 10 AA_DT11DC12:DG4DA5_BB A 11 ? B 5 ? A 12 ? B 4 ? 1 A DC 12 1_555 B DG 4 1_555 A DT 13 1_555 B DA 3 1_555 -0.437 -0.625 3.368 1.110 4.009 29.644 -2.052 1.080 3.240 7.787 -2.156 29.928 11 AA_DC12DT13:DA3DG4_BB A 12 ? B 4 ? A 13 ? B 3 ? 1 A DT 13 1_555 B DA 3 1_555 A DG 14 1_555 B DC 2 1_555 -1.520 3.394 3.679 -3.339 -6.255 46.157 4.846 1.619 3.314 -7.923 4.230 46.669 12 AA_DT13DG14:DC2DA3_BB A 13 ? B 3 ? A 14 ? B 2 ? 1 A DG 14 1_555 B DC 2 1_555 A DG 15 1_555 B DC 1 1_555 0.852 1.401 3.513 0.011 0.217 43.707 1.860 -1.143 3.519 0.291 -0.015 43.708 13 AA_DG14DG15:DC1DC2_BB A 14 ? B 2 ? A 15 ? B 1 ? 1 A DG 15 1_555 B DC 1 1_555 A DA 16 1_555 D A1AAZ 7 1_555 -0.715 0.205 2.731 -12.277 -2.196 29.722 0.714 -0.636 2.780 -4.063 22.716 32.179 14 AA_DG15DA16:A1AAZ7DC1_DB A 15 ? B 1 ? A 16 ? D 7 ? 1 A DA 16 1_555 D A1AAZ 7 1_555 A DC 17 1_555 D DG 6 1_555 -1.418 -1.157 3.375 -6.843 4.324 24.473 -3.882 1.145 3.389 9.861 15.608 25.757 15 AA_DA16DC17:DG6A1AAZ7_DD A 16 ? D 7 ? A 17 ? D 6 ? 1 A DC 17 1_555 D DG 6 1_555 A DA 18 1_555 D DT 5 1_555 0.576 0.362 2.745 -4.498 2.529 38.401 0.288 -1.328 2.681 3.824 6.800 38.733 16 AA_DC17DA18:DT5DG6_DD A 17 ? D 6 ? A 18 ? D 5 ? 1 A DA 18 1_555 D DT 5 1_555 A DT 19 1_555 D DA 4 1_555 0.207 -0.058 3.357 4.168 -1.219 36.280 0.080 0.263 3.360 -1.949 -6.664 36.530 17 AA_DA18DT19:DA4DT5_DD A 18 ? D 5 ? A 19 ? D 4 ? 1 A DT 19 1_555 D DA 4 1_555 A DC 20 1_555 D DG 3 1_555 0.155 1.233 3.559 -0.343 -2.714 44.880 1.876 -0.236 3.481 -3.552 0.449 44.959 18 AA_DT19DC20:DG3DA4_DD A 19 ? D 4 ? A 20 ? D 3 ? 1 A DC 20 1_555 D DG 3 1_555 A DA 21 1_555 D DT 2 1_555 -0.688 0.244 3.312 -3.686 9.752 31.866 -1.243 0.564 3.299 17.196 6.499 33.486 19 AA_DC20DA21:DT2DG3_DD A 20 ? D 3 ? A 21 ? D 2 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Science Foundation (NSF, United States)' 'United States' GCR-2317843 1 'National Science Foundation (NSF, United States)' 'United States' CCF-2106790 2 'Department of Energy (DOE, United States)' 'United States' DE-SC0007991 3 'Office of Naval Research (ONR)' 'United States' N000141912596 4 # _space_group.name_H-M_alt 'H 3' _space_group.name_Hall 'H 3' _space_group.IT_number 146 _space_group.crystal_system trigonal _space_group.id 1 # _atom_sites.entry_id 9CK9 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.009463 _atom_sites.fract_transf_matrix[1][2] 0.005463 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.010926 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.011270 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source AG ? ? 46.70359 ? ? ? 5.43095 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? C ? ? 5.96793 ? ? ? 14.89577 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 6.96715 ? ? ? 11.43723 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 14.90797 ? ? ? 11.91318 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? S ? ? 15.91112 ? ? ? 10.84690 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ # loop_ #