data_9EWW # _entry.id 9EWW # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.403 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9EWW pdb_00009eww 10.2210/pdb9eww/pdb WWPDB D_1292137700 ? ? EMDB EMD-50024 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-04-16 ? 2 'EM metadata' 1 0 2025-04-16 ? 3 FSC 1 0 2025-04-16 ? 4 'Half map' 1 0 2025-04-16 1 5 'Half map' 1 0 2025-04-16 2 6 Image 1 0 2025-04-16 ? 7 Mask 1 0 2025-04-16 1 8 'Primary map' 1 0 2025-04-16 ? # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 2 'EM metadata' repository 'Initial release' ? ? 3 3 FSC repository 'Initial release' ? ? 4 4 'Half map' repository 'Initial release' ? ? 5 5 'Half map' repository 'Initial release' ? ? 6 6 Image repository 'Initial release' ? ? 7 7 Mask repository 'Initial release' ? ? 8 8 'Primary map' repository 'Initial release' ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9EWW _pdbx_database_status.recvd_initial_deposition_date 2024-04-05 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'Human p53 mRNA_CDS_120nt' _pdbx_database_related.db_id EMD-50024 _pdbx_database_related.content_type 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email robin.fahraeus@umu.se _pdbx_contact_author.name_first Robin _pdbx_contact_author.name_last Fahraeus _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-0402-8492 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Wang, L.' 1 0000-0002-0528-1724 'Chen, S.' 2 0000-0002-4834-1221 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'A cancer-derived synonymous mutation targets the DNA damage-activated p53 mRNA riboswitch.' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Wang, L.' 1 0000-0002-0528-1724 primary 'Chen, S.' 2 0000-0002-4834-1221 # _entity.id 1 _entity.type polymer _entity.src_method man _entity.pdbx_description 'p53 mRNA_CDS_120nt' _entity.formula_weight 38387.801 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACAUUUUCAGACCUAUGGAAACUACUUCC UGAAAACAACGUUCUGUCCCCCUUGCCGUCCCAAGCAAUG ; _entity_poly.pdbx_seq_one_letter_code_can ;AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACAUUUUCAGACCUAUGGAAACUACUUCC UGAAAACAACGUUCUGUCCCCCUUGCCGUCCCAAGCAAUG ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 U n 1 3 G n 1 4 G n 1 5 A n 1 6 G n 1 7 G n 1 8 A n 1 9 G n 1 10 C n 1 11 C n 1 12 G n 1 13 C n 1 14 A n 1 15 G n 1 16 U n 1 17 C n 1 18 A n 1 19 G n 1 20 A n 1 21 U n 1 22 C n 1 23 C n 1 24 U n 1 25 A n 1 26 G n 1 27 C n 1 28 G n 1 29 U n 1 30 C n 1 31 G n 1 32 A n 1 33 G n 1 34 C n 1 35 C n 1 36 C n 1 37 C n 1 38 C n 1 39 U n 1 40 C n 1 41 U n 1 42 G n 1 43 A n 1 44 G n 1 45 U n 1 46 C n 1 47 A n 1 48 G n 1 49 G n 1 50 A n 1 51 A n 1 52 A n 1 53 C n 1 54 A n 1 55 U n 1 56 U n 1 57 U n 1 58 U n 1 59 C n 1 60 A n 1 61 G n 1 62 A n 1 63 C n 1 64 C n 1 65 U n 1 66 A n 1 67 U n 1 68 G n 1 69 G n 1 70 A n 1 71 A n 1 72 A n 1 73 C n 1 74 U n 1 75 A n 1 76 C n 1 77 U n 1 78 U n 1 79 C n 1 80 C n 1 81 U n 1 82 G n 1 83 A n 1 84 A n 1 85 A n 1 86 A n 1 87 C n 1 88 A n 1 89 A n 1 90 C n 1 91 G n 1 92 U n 1 93 U n 1 94 C n 1 95 U n 1 96 G n 1 97 U n 1 98 C n 1 99 C n 1 100 C n 1 101 C n 1 102 C n 1 103 U n 1 104 U n 1 105 G n 1 106 C n 1 107 C n 1 108 G n 1 109 U n 1 110 C n 1 111 C n 1 112 C n 1 113 A n 1 114 A n 1 115 G n 1 116 C n 1 117 A n 1 118 A n 1 119 U n 1 120 G n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 120 _entity_src_gen.gene_src_common_name human _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Homo sapiens' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 9606 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name Mammalia _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 40674 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 0 0 A A A . n A 1 2 U 2 1 1 U U A . n A 1 3 G 3 2 2 G G A . n A 1 4 G 4 3 3 G G A . n A 1 5 A 5 4 4 A A A . n A 1 6 G 6 5 5 G G A . n A 1 7 G 7 6 6 G G A . n A 1 8 A 8 7 7 A A A . n A 1 9 G 9 8 8 G G A . n A 1 10 C 10 9 9 C C A . n A 1 11 C 11 10 10 C C A . n A 1 12 G 12 11 11 G G A . n A 1 13 C 13 12 12 C C A . n A 1 14 A 14 13 13 A A A . n A 1 15 G 15 14 14 G G A . n A 1 16 U 16 15 15 U U A . n A 1 17 C 17 16 16 C C A . n A 1 18 A 18 17 17 A A A . n A 1 19 G 19 18 18 G G A . n A 1 20 A 20 19 19 A A A . n A 1 21 U 21 20 20 U U A . n A 1 22 C 22 21 21 C C A . n A 1 23 C 23 22 22 C C A . n A 1 24 U 24 23 23 U U A . n A 1 25 A 25 24 24 A A A . n A 1 26 G 26 25 25 G G A . n A 1 27 C 27 26 26 C C A . n A 1 28 G 28 27 27 G G A . n A 1 29 U 29 28 28 U U A . n A 1 30 C 30 29 29 C C A . n A 1 31 G 31 30 30 G G A . n A 1 32 A 32 31 31 A A A . n A 1 33 G 33 32 32 G G A . n A 1 34 C 34 33 33 C C A . n A 1 35 C 35 34 34 C C A . n A 1 36 C 36 35 35 C C A . n A 1 37 C 37 36 36 C C A . n A 1 38 C 38 37 37 C C A . n A 1 39 U 39 38 38 U U A . n A 1 40 C 40 39 39 C C A . n A 1 41 U 41 40 40 U U A . n A 1 42 G 42 41 41 G G A . n A 1 43 A 43 42 42 A A A . n A 1 44 G 44 43 43 G G A . n A 1 45 U 45 44 44 U U A . n A 1 46 C 46 45 45 C C A . n A 1 47 A 47 46 46 A A A . n A 1 48 G 48 47 47 G G A . n A 1 49 G 49 48 48 G G A . n A 1 50 A 50 49 49 A A A . n A 1 51 A 51 50 50 A A A . n A 1 52 A 52 51 51 A A A . n A 1 53 C 53 52 52 C C A . n A 1 54 A 54 53 53 A A A . n A 1 55 U 55 54 54 U U A . n A 1 56 U 56 55 55 U U A . n A 1 57 U 57 56 56 U U A . n A 1 58 U 58 57 57 U U A . n A 1 59 C 59 58 58 C C A . n A 1 60 A 60 59 59 A A A . n A 1 61 G 61 60 60 G G A . n A 1 62 A 62 61 61 A A A . n A 1 63 C 63 62 62 C C A . n A 1 64 C 64 63 63 C C A . n A 1 65 U 65 64 64 U U A . n A 1 66 A 66 65 65 A A A . n A 1 67 U 67 66 66 U U A . n A 1 68 G 68 67 67 G G A . n A 1 69 G 69 68 68 G G A . n A 1 70 A 70 69 69 A A A . n A 1 71 A 71 70 70 A A A . n A 1 72 A 72 71 71 A A A . n A 1 73 C 73 72 72 C C A . n A 1 74 U 74 73 73 U U A . n A 1 75 A 75 74 74 A A A . n A 1 76 C 76 75 75 C C A . n A 1 77 U 77 76 76 U U A . n A 1 78 U 78 77 77 U U A . n A 1 79 C 79 78 78 C C A . n A 1 80 C 80 79 79 C C A . n A 1 81 U 81 80 80 U U A . n A 1 82 G 82 81 81 G G A . n A 1 83 A 83 82 82 A A A . n A 1 84 A 84 83 83 A A A . n A 1 85 A 85 84 84 A A A . n A 1 86 A 86 85 85 A A A . n A 1 87 C 87 86 86 C C A . n A 1 88 A 88 87 87 A A A . n A 1 89 A 89 88 88 A A A . n A 1 90 C 90 89 89 C C A . n A 1 91 G 91 90 90 G G A . n A 1 92 U 92 91 91 U U A . n A 1 93 U 93 92 92 U U A . n A 1 94 C 94 93 93 C C A . n A 1 95 U 95 94 94 U U A . n A 1 96 G 96 95 95 G G A . n A 1 97 U 97 96 96 U U A . n A 1 98 C 98 97 97 C C A . n A 1 99 C 99 98 98 C C A . n A 1 100 C 100 99 99 C C A . n A 1 101 C 101 100 100 C C A . n A 1 102 C 102 101 101 C C A . n A 1 103 U 103 102 102 U U A . n A 1 104 U 104 103 103 U U A . n A 1 105 G 105 104 104 G G A . n A 1 106 C 106 105 105 C C A . n A 1 107 C 107 106 106 C C A . n A 1 108 G 108 107 107 G G A . n A 1 109 U 109 108 108 U U A . n A 1 110 C 110 109 109 C C A . n A 1 111 C 111 110 110 C C A . n A 1 112 C 112 111 111 C C A . n A 1 113 A 113 112 112 A A A . n A 1 114 A 114 113 113 A A A . n A 1 115 G 115 114 114 G G A . n A 1 116 C 116 115 115 C C A . n A 1 117 A 117 116 116 A A A . n A 1 118 A 118 117 117 A A A . n A 1 119 U 119 118 118 U U A . n A 1 120 G 120 119 119 G G A . n # _pdbx_unobs_or_zero_occ_atoms.id 1 _pdbx_unobs_or_zero_occ_atoms.PDB_model_num 1 _pdbx_unobs_or_zero_occ_atoms.polymer_flag Y _pdbx_unobs_or_zero_occ_atoms.occupancy_flag 1 _pdbx_unobs_or_zero_occ_atoms.auth_asym_id A _pdbx_unobs_or_zero_occ_atoms.auth_comp_id A _pdbx_unobs_or_zero_occ_atoms.auth_seq_id 0 _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code ? _pdbx_unobs_or_zero_occ_atoms.auth_atom_id "O5'" _pdbx_unobs_or_zero_occ_atoms.label_alt_id ? _pdbx_unobs_or_zero_occ_atoms.label_asym_id A _pdbx_unobs_or_zero_occ_atoms.label_comp_id A _pdbx_unobs_or_zero_occ_atoms.label_seq_id 1 _pdbx_unobs_or_zero_occ_atoms.label_atom_id "O5'" # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9EWW _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 9EWW _struct.title 'Human p53 mRNA_CDS_120nt' _struct.pdbx_model_details ;MODEL GENERATED BY ROSETTA VERSION 2020.08+release.cb1caba ; _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9EWW _struct_keywords.text 'p53, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code X02469.1 _struct_ref.pdbx_db_accession 35209 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACAUUUUCAGACCUAUGGAAACUACUUCC UGAAAACAACGUUCUGUCCCCCUUGCCGUCCCAAGCAAUG ; _struct_ref.pdbx_align_begin 136 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9EWW _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 120 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 35209 _struct_ref_seq.db_align_beg 136 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 255 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 0 _struct_ref_seq.pdbx_auth_seq_align_end 119 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A U 2 O4 ? ? ? 1_555 A C 100 N4 ? ? A U 1 A C 99 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog2 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 99 N3 ? ? A G 2 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 99 O2 ? ? A G 2 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 99 N4 ? ? A G 2 A C 98 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 98 N3 ? ? A G 3 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 98 O2 ? ? A G 3 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 98 N4 ? ? A G 3 A C 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 97 N3 ? ? A A 4 A U 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 97 O4 ? ? A A 4 A U 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A U 95 O2 ? ? A G 5 A U 94 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog11 hydrog ? ? A G 6 O6 ? ? ? 1_555 A U 95 N3 ? ? A G 5 A U 94 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A G 7 N1 ? ? ? 1_555 A C 94 N3 ? ? A G 6 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 7 N2 ? ? ? 1_555 A C 94 O2 ? ? A G 6 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 O6 ? ? ? 1_555 A C 94 N4 ? ? A G 6 A C 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 93 N3 ? ? A A 7 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 93 O4 ? ? A A 7 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 9 N1 ? ? ? 1_555 A U 92 O2 ? ? A G 8 A U 91 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog18 hydrog ? ? A G 9 O6 ? ? ? 1_555 A U 92 N3 ? ? A G 8 A U 91 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 91 N1 ? ? A C 9 A G 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 91 O6 ? ? A C 9 A G 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 91 N2 ? ? A C 9 A G 90 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 43 N1 ? ? A U 15 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 43 N6 ? ? A U 15 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 42 N1 ? ? A C 16 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 42 O6 ? ? A C 16 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 42 N2 ? ? A C 16 A G 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 18 N1 ? ? ? 1_555 A U 41 N3 ? ? A A 17 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 18 N6 ? ? ? 1_555 A U 41 O4 ? ? A A 17 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 18 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 18 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 18 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 39 N3 ? ? A A 19 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 39 O4 ? ? A A 19 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 26 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 25 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 26 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 25 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 26 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 25 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 27 N3 ? ? ? 1_555 A G 33 N1 ? ? A C 26 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 27 N4 ? ? ? 1_555 A G 33 O6 ? ? A C 26 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 27 O2 ? ? ? 1_555 A G 33 N2 ? ? A C 26 A G 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 28 N2 ? ? ? 1_555 A A 32 N7 ? ? A G 27 A A 31 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog41 hydrog ? ? A G 28 N3 ? ? ? 1_555 A A 32 N6 ? ? A G 27 A A 31 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog42 hydrog ? ? A G 44 N1 ? ? ? 1_555 A A 84 N3 ? ? A G 43 A A 83 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog43 hydrog ? ? A G 44 O6 ? ? ? 1_555 A A 86 N6 ? ? A G 43 A A 85 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog44 hydrog ? ? A U 45 N3 ? ? ? 1_555 A A 83 N1 ? ? A U 44 A A 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 45 O4 ? ? ? 1_555 A A 83 N6 ? ? A U 44 A A 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 46 N3 ? ? ? 1_555 A G 82 N1 ? ? A C 45 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 46 N4 ? ? ? 1_555 A G 82 O6 ? ? A C 45 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 46 O2 ? ? ? 1_555 A G 82 N2 ? ? A C 45 A G 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 47 N1 ? ? ? 1_555 A U 81 N3 ? ? A A 46 A U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 47 N6 ? ? ? 1_555 A U 81 O4 ? ? A A 46 A U 80 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 48 N1 ? ? ? 1_555 A C 80 N3 ? ? A G 47 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 48 N2 ? ? ? 1_555 A C 80 O2 ? ? A G 47 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 48 O6 ? ? ? 1_555 A C 80 N4 ? ? A G 47 A C 79 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 49 O6 ? ? ? 1_555 A C 76 N4 ? ? A G 48 A C 75 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog55 hydrog ? ? A G 49 N1 ? ? ? 1_555 A C 79 N3 ? ? A G 48 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 49 N2 ? ? ? 1_555 A C 79 O2 ? ? A G 48 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 49 O6 ? ? ? 1_555 A C 79 N4 ? ? A G 48 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A A 50 N1 ? ? ? 1_555 A U 78 N3 ? ? A A 49 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A A 50 N6 ? ? ? 1_555 A U 78 O4 ? ? A A 49 A U 77 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A A 51 N1 ? ? ? 1_555 A U 77 N3 ? ? A A 50 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A A 51 N6 ? ? ? 1_555 A U 77 O4 ? ? A A 50 A U 76 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 52 N6 ? ? ? 1_555 A U 77 O2 ? ? A A 51 A U 76 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog63 hydrog ? ? A U 55 N3 ? ? ? 1_555 A A 72 N1 ? ? A U 54 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A U 55 O4 ? ? ? 1_555 A A 72 N6 ? ? A U 54 A A 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A U 56 N3 ? ? ? 1_555 A A 71 N1 ? ? A U 55 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A U 56 O4 ? ? ? 1_555 A A 71 N6 ? ? A U 55 A A 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A U 57 N3 ? ? ? 1_555 A A 70 N1 ? ? A U 56 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A U 57 O4 ? ? ? 1_555 A A 70 N6 ? ? A U 56 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A U 58 N3 ? ? ? 1_555 A G 69 O6 ? ? A U 57 A G 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog70 hydrog ? ? A U 58 O2 ? ? ? 1_555 A G 69 N1 ? ? A U 57 A G 68 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog71 hydrog ? ? A C 59 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 58 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A C 59 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 58 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 59 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 58 A G 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A A 60 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 59 A U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A A 60 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 59 A U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A G 61 N2 ? ? ? 1_555 A U 65 O4 ? ? A G 60 A U 64 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? hydrog77 hydrog ? ? A G 61 N3 ? ? ? 1_555 A A 66 N6 ? ? A G 60 A A 65 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog78 hydrog ? ? A A 62 N3 ? ? ? 1_555 A C 64 N4 ? ? A A 61 A C 63 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog79 hydrog ? ? A A 62 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 61 A U 64 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog80 hydrog ? ? A C 102 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 101 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 102 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 101 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 102 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 101 A G 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A U 103 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 102 A A 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A U 103 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 102 A A 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A U 104 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 103 A A 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A U 104 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 103 A A 116 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A G 105 N1 ? ? ? 1_555 A C 116 N3 ? ? A G 104 A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A G 105 N2 ? ? ? 1_555 A C 116 O2 ? ? A G 104 A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A G 105 O6 ? ? ? 1_555 A C 116 N4 ? ? A G 104 A C 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 106 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 105 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A C 106 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 105 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A C 106 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 105 A G 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A C 107 N3 ? ? ? 1_555 A A 114 N6 ? ? A C 106 A A 113 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog94 hydrog ? ? A G 108 N2 ? ? ? 1_555 A A 113 N7 ? ? A G 107 A A 112 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog95 hydrog ? ? A G 108 N3 ? ? ? 1_555 A A 113 N6 ? ? A G 107 A A 112 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9EWW _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP1 A G 81 ? ? H22 A G 90 ? ? 1.59 2 1 N6 A A 19 ? ? "O4'" A C 21 ? ? 2.17 # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 9EWW _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol ? # _em_3d_reconstruction.entry_id 9EWW _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 8.57 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 39008 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type 'ORGANELLE OR CELLULAR COMPONENT' _em_entity_assembly.name 'p53 mRNA_CDS_120nt' _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 9EWW _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'FEI TITAN KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode OTHER _em_imaging.mode OTHER _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_min 1500 _em_imaging.nominal_defocus_max 3000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification ? _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? # _em_vitrification.entry_id 9EWW _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name OTHER _em_vitrification.humidity ? _em_vitrification.temp ? _em_vitrification.chamber_temperature ? _em_vitrification.instrument ? _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 9EWW _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_admin.current_status REL _em_admin.deposition_date 2024-04-05 _em_admin.deposition_site PDBE _em_admin.entry_id 9EWW _em_admin.last_update 2025-04-16 _em_admin.map_release_date 2025-04-16 _em_admin.title 'Human p53 mRNA_CDS_120nt' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type NONE # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 9606 _em_entity_assembly_naturalsource.organism 'Homo sapiens' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 40674 _em_entity_assembly_recombinant.organism Mammalia _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 50 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' ? 1 1 ? ? ? ? 'IMAGE ACQUISITION' ? 2 ? ? 1 ? ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' ? 4 1 ? ? ? ? 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' ? 7 ? ? ? ? ? 'MODEL REFINEMENT' ? 8 ? ? ? ? ? OTHER ? 9 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 11 1 ? ? ? ? CLASSIFICATION ? 12 1 ? ? ? ? RECONSTRUCTION ? 13 1 ? ? ? ? # _em_specimen.concentration 1 _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9EWW 'double helix' 9EWW 'a-form double helix' 9EWW 'hairpin loop' 9EWW 'bulge loop' 9EWW 'mismatched base pair' 9EWW 'internal loop' 9EWW 'triple helix' 9EWW 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 91 1_555 A C 10 1_555 -0.156 -0.117 -0.060 -2.925 -3.886 -1.490 1 A_G90:C9_A A 90 ? A 9 ? 19 1 1 A U 92 1_555 A G 9 1_555 2.066 -0.455 -0.012 0.965 -4.814 -3.095 2 A_U91:G8_A A 91 ? A 8 ? 28 1 1 A U 93 1_555 A A 8 1_555 -0.021 -0.102 -0.163 3.681 -4.919 -2.490 3 A_U92:A7_A A 92 ? A 7 ? 20 1 1 A C 94 1_555 A G 7 1_555 0.114 -0.120 -0.087 4.480 -3.810 -1.560 4 A_C93:G6_A A 93 ? A 6 ? 19 1 1 A U 95 1_555 A G 6 1_555 2.112 -0.482 -0.007 1.491 -10.653 -1.549 5 A_U94:G5_A A 94 ? A 5 ? 28 1 1 A U 97 1_555 A A 5 1_555 -0.022 -0.074 -0.106 4.055 -3.073 -3.484 6 A_U96:A4_A A 96 ? A 4 ? 20 1 1 A C 98 1_555 A G 4 1_555 0.118 -0.127 -0.141 6.670 -4.673 -1.572 7 A_C97:G3_A A 97 ? A 3 ? 19 1 1 A C 99 1_555 A G 3 1_555 0.137 -0.138 -0.118 4.707 -4.916 -1.064 8 A_C98:G2_A A 98 ? A 2 ? 19 1 1 A C 100 1_555 A U 2 1_555 3.394 -1.324 -1.211 -6.777 -25.815 -38.400 9 A_C99:U1_A A 99 ? A 1 ? ? ? 1 A C 102 1_555 A G 120 1_555 -0.012 -1.413 -1.919 -6.389 -13.856 8.958 10 A_C101:G119_A A 101 ? A 119 ? 19 1 1 A U 103 1_555 A A 118 1_555 0.059 -0.117 -0.177 -1.007 -7.309 -0.988 11 A_U102:A117_A A 102 ? A 117 ? 20 1 1 A U 104 1_555 A A 117 1_555 0.065 -0.114 -0.081 -4.885 -5.780 -1.589 12 A_U103:A116_A A 103 ? A 116 ? 20 1 1 A G 105 1_555 A C 116 1_555 -0.099 -0.123 -0.112 -6.662 -5.048 -1.806 13 A_G104:C115_A A 104 ? A 115 ? 19 1 1 A C 106 1_555 A G 115 1_555 0.161 -0.124 -0.028 0.723 -3.139 -1.304 14 A_C105:G114_A A 105 ? A 114 ? 19 1 1 A C 107 1_555 A A 114 1_555 2.188 -0.519 -0.819 -3.167 -12.884 -6.393 15 A_C106:A113_A A 106 ? A 113 ? ? 1 1 A G 108 1_555 A A 113 1_555 6.605 -4.183 -0.137 1.782 -8.670 -4.498 16 A_G107:A112_A A 107 ? A 112 ? 11 6 1 A U 16 1_555 A A 43 1_555 0.060 -0.115 -0.168 -1.023 -7.246 -1.015 17 A_U15:A42_A A 15 ? A 42 ? 20 1 1 A C 17 1_555 A G 42 1_555 0.158 -0.138 0.003 -3.305 0.506 -0.770 18 A_C16:G41_A A 16 ? A 41 ? 19 1 1 A A 18 1_555 A U 41 1_555 0.039 -0.070 -0.136 -3.570 -2.127 -3.986 19 A_A17:U40_A A 17 ? A 40 ? 20 1 1 A G 19 1_555 A C 40 1_555 -0.114 -0.122 -0.120 -4.573 -3.523 -1.629 20 A_G18:C39_A A 18 ? A 39 ? 19 1 1 A A 20 1_555 A U 39 1_555 0.015 -0.076 -0.114 -3.025 -3.874 -3.256 21 A_A19:U38_A A 19 ? A 38 ? 20 1 1 A G 26 1_555 A C 34 1_555 -0.137 -0.137 -0.113 -4.990 -5.472 -1.069 22 A_G25:C33_A A 25 ? A 33 ? 19 1 1 A C 27 1_555 A G 33 1_555 0.166 -0.132 -0.046 -0.148 -2.432 -0.885 23 A_C26:G32_A A 26 ? A 32 ? 19 1 1 A G 28 1_555 A A 32 1_555 6.546 -4.059 -0.651 7.995 5.266 -8.618 24 A_G27:A31_A A 27 ? A 31 ? 11 10 1 A G 44 1_555 A A 84 1_555 -4.771 1.034 -0.389 -30.326 4.417 66.101 25 A_G43:A83_A A 43 ? A 83 ? ? 5 1 A U 45 1_555 A A 83 1_555 0.060 -0.116 -0.168 -1.036 -7.230 -1.001 26 A_U44:A82_A A 44 ? A 82 ? 20 1 1 A C 46 1_555 A G 82 1_555 0.159 -0.138 0.003 -3.293 0.527 -0.757 27 A_C45:G81_A A 45 ? A 81 ? 19 1 1 A A 47 1_555 A U 81 1_555 0.039 -0.070 -0.136 -3.577 -2.135 -3.986 28 A_A46:U80_A A 46 ? A 80 ? 20 1 1 A G 48 1_555 A C 80 1_555 -0.111 -0.122 -0.126 -4.619 -3.650 -1.698 29 A_G47:C79_A A 47 ? A 79 ? 19 1 1 A G 49 1_555 A C 79 1_555 -0.110 -0.122 -0.107 -5.048 -4.286 -1.805 30 A_G48:C78_A A 48 ? A 78 ? 19 1 1 A A 50 1_555 A U 78 1_555 0.016 -0.074 -0.132 -3.349 -3.572 -3.449 31 A_A49:U77_A A 49 ? A 77 ? 20 1 1 A A 51 1_555 A U 77 1_555 0.012 -0.080 -0.132 -1.691 -4.514 -2.935 32 A_A50:U76_A A 50 ? A 76 ? 20 1 1 A U 55 1_555 A A 72 1_555 0.059 -0.116 -0.177 -1.009 -7.327 -0.985 33 A_U54:A71_A A 54 ? A 71 ? 20 1 1 A U 56 1_555 A A 71 1_555 0.071 -0.106 -0.120 -4.568 -6.588 -1.686 34 A_U55:A70_A A 55 ? A 70 ? 20 1 1 A U 57 1_555 A A 70 1_555 0.058 -0.071 -0.070 -3.876 -4.793 -3.615 35 A_U56:A69_A A 56 ? A 69 ? 20 1 1 A U 58 1_555 A G 69 1_555 2.133 -0.456 0.006 -2.963 -1.925 -2.629 36 A_U57:G68_A A 57 ? A 68 ? 28 1 1 A C 59 1_555 A G 68 1_555 0.155 -0.153 -0.025 -2.177 -0.964 -0.520 37 A_C58:G67_A A 58 ? A 67 ? 19 1 1 A A 60 1_555 A U 67 1_555 0.052 -0.057 -0.118 -3.003 -2.479 -4.447 38 A_A59:U66_A A 59 ? A 66 ? 20 1 1 A G 61 1_555 A A 66 1_555 5.923 -1.546 1.838 -27.657 -1.661 25.366 39 A_G60:A65_A A 60 ? A 65 ? ? ? 1 A A 62 1_555 A U 65 1_555 -0.937 -1.718 -1.008 -45.842 -34.742 -99.308 40 A_A61:U64_A A 61 ? A 64 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 91 1_555 A C 10 1_555 A U 92 1_555 A G 9 1_555 -0.176 -1.374 3.188 1.209 6.557 40.054 -2.669 0.380 2.930 9.494 -1.751 40.582 1 AA_G90U91:G8C9_AA A 90 ? A 9 ? A 91 ? A 8 ? 1 A U 92 1_555 A G 9 1_555 A U 93 1_555 A A 8 1_555 -0.132 -1.814 3.074 3.522 9.308 25.637 -5.752 1.009 2.251 20.040 -7.584 27.471 2 AA_U91U92:A7G8_AA A 91 ? A 8 ? A 92 ? A 7 ? 1 A U 93 1_555 A A 8 1_555 A C 94 1_555 A G 7 1_555 0.011 -1.665 3.207 -0.269 7.428 32.367 -4.067 -0.061 2.767 13.110 0.475 33.187 3 AA_U92C93:G6A7_AA A 92 ? A 7 ? A 93 ? A 6 ? 1 A C 94 1_555 A G 7 1_555 A U 95 1_555 A G 6 1_555 0.175 -1.497 3.312 2.080 6.500 39.559 -2.908 -0.023 3.044 9.517 -3.045 40.120 4 AA_C93U94:G5G6_AA A 93 ? A 6 ? A 94 ? A 5 ? 1 A U 95 1_555 A G 6 1_555 A U 97 1_555 A A 5 1_555 -1.850 -0.311 3.086 4.827 29.434 39.499 -2.373 2.553 2.155 37.740 -6.190 49.134 5 AA_U94U96:A4G5_AA A 94 ? A 5 ? A 96 ? A 4 ? 1 A U 97 1_555 A A 5 1_555 A C 98 1_555 A G 4 1_555 -0.001 -1.638 3.173 0.360 7.076 32.505 -3.949 0.058 2.765 12.458 -0.634 33.248 6 AA_U96C97:G3A4_AA A 96 ? A 4 ? A 97 ? A 3 ? 1 A C 98 1_555 A G 4 1_555 A C 99 1_555 A G 3 1_555 0.018 -1.791 3.286 -0.091 6.656 32.578 -4.191 -0.047 2.873 11.713 0.160 33.233 7 AA_C97C98:G2G3_AA A 97 ? A 3 ? A 98 ? A 2 ? 1 A C 99 1_555 A G 3 1_555 A C 100 1_555 A U 2 1_555 -2.071 -1.495 3.686 6.567 9.222 49.184 -2.447 2.925 3.094 10.913 -7.771 50.391 8 AA_C98C99:U1G2_AA A 98 ? A 2 ? A 99 ? A 1 ? 1 A C 100 1_555 A U 2 1_555 A C 102 1_555 A G 120 1_555 1.686 -4.744 3.932 18.952 24.311 49.259 -6.240 -0.724 2.045 26.409 -20.587 57.594 9 AA_C99C101:G119U1_AA A 99 ? A 1 ? A 101 ? A 119 ? 1 A C 102 1_555 A G 120 1_555 A U 103 1_555 A A 118 1_555 2.333 -2.253 4.593 -33.682 25.957 53.155 -3.188 -3.604 1.828 25.035 32.487 67.089 10 AA_C101U102:A117G119_AA A 101 ? A 119 ? A 102 ? A 117 ? 1 A U 103 1_555 A A 118 1_555 A U 104 1_555 A A 117 1_555 0.059 -1.817 3.320 0.836 7.144 32.659 -4.291 0.030 2.870 12.515 -1.464 33.421 11 AA_U102U103:A116A117_AA A 102 ? A 117 ? A 103 ? A 116 ? 1 A U 104 1_555 A A 117 1_555 A G 105 1_555 A C 116 1_555 0.158 -1.616 3.279 0.628 9.184 31.557 -4.331 -0.178 2.717 16.454 -1.125 32.840 12 AA_U103G104:C115A116_AA A 103 ? A 116 ? A 104 ? A 115 ? 1 A G 105 1_555 A C 116 1_555 A C 106 1_555 A G 115 1_555 0.286 -1.567 3.064 -0.213 4.743 32.991 -3.446 -0.532 2.816 8.298 0.373 33.322 13 AA_G104C105:G114C115_AA A 104 ? A 115 ? A 105 ? A 114 ? 1 A C 106 1_555 A G 115 1_555 A C 107 1_555 A A 114 1_555 -0.052 -1.529 3.479 8.467 10.115 39.719 -3.218 0.971 2.950 14.413 -12.066 41.768 14 AA_C105C106:A113G114_AA A 105 ? A 114 ? A 106 ? A 113 ? 1 A C 107 1_555 A A 114 1_555 A G 108 1_555 A A 113 1_555 0.567 -0.849 3.519 8.379 13.843 50.331 -1.912 -0.060 3.247 15.814 -9.572 52.706 15 AA_C106G107:A112A113_AA A 106 ? A 113 ? A 107 ? A 112 ? 1 A U 16 1_555 A A 43 1_555 A C 17 1_555 A G 42 1_555 0.004 -1.809 3.298 -0.240 7.892 33.248 -4.263 -0.043 2.807 13.556 0.412 34.147 16 AA_U15C16:G41A42_AA A 15 ? A 42 ? A 16 ? A 41 ? 1 A C 17 1_555 A G 42 1_555 A A 18 1_555 A U 41 1_555 -0.029 -1.723 3.280 1.643 8.202 30.607 -4.567 0.337 2.733 15.185 -3.041 31.703 17 AA_C16A17:U40G41_AA A 16 ? A 41 ? A 17 ? A 40 ? 1 A A 18 1_555 A U 41 1_555 A G 19 1_555 A C 40 1_555 0.334 -1.706 3.347 -0.051 7.901 31.440 -4.396 -0.608 2.845 14.300 0.092 32.393 18 AA_A17G18:C39U40_AA A 17 ? A 40 ? A 18 ? A 39 ? 1 A G 19 1_555 A C 40 1_555 A A 20 1_555 A U 39 1_555 0.044 -1.650 3.215 -0.133 7.604 32.531 -4.041 -0.097 2.770 13.348 0.234 33.385 19 AA_G18A19:U38C39_AA A 18 ? A 39 ? A 19 ? A 38 ? 1 A G 26 1_555 A C 34 1_555 A C 27 1_555 A G 33 1_555 0.063 -1.746 3.091 -0.015 4.062 33.767 -3.579 -0.109 2.867 6.961 0.026 34.003 20 AA_G25C26:G32C33_AA A 25 ? A 33 ? A 26 ? A 32 ? 1 A C 27 1_555 A G 33 1_555 A G 28 1_555 A A 32 1_555 -0.625 -1.024 3.321 1.915 2.423 56.004 -1.229 0.774 3.256 2.578 -2.037 56.082 21 AA_C26G27:A31G32_AA A 26 ? A 32 ? A 27 ? A 31 ? 1 A G 44 1_555 A A 84 1_555 A U 45 1_555 A A 83 1_555 -3.977 -0.079 2.538 3.505 9.578 29.050 -1.470 7.983 1.933 18.393 -6.731 30.752 22 AA_G43U44:A82A83_AA A 43 ? A 83 ? A 44 ? A 82 ? 1 A U 45 1_555 A A 83 1_555 A C 46 1_555 A G 82 1_555 0.004 -1.808 3.297 -0.230 7.884 33.255 -4.260 -0.041 2.807 13.539 0.395 34.151 23 AA_U44C45:G81A82_AA A 44 ? A 82 ? A 45 ? A 81 ? 1 A C 46 1_555 A G 82 1_555 A A 47 1_555 A U 81 1_555 -0.029 -1.722 3.280 1.644 8.209 30.597 -4.569 0.337 2.733 15.202 -3.045 31.696 24 AA_C45A46:U80G81_AA A 45 ? A 81 ? A 46 ? A 80 ? 1 A A 47 1_555 A U 81 1_555 A G 48 1_555 A C 80 1_555 0.341 -1.709 3.338 -0.116 7.784 31.396 -4.391 -0.632 2.843 14.114 0.211 32.323 25 AA_A46G47:C79U80_AA A 46 ? A 80 ? A 47 ? A 79 ? 1 A G 48 1_555 A C 80 1_555 A G 49 1_555 A C 79 1_555 0.121 -1.691 3.285 -0.160 7.221 32.071 -4.163 -0.240 2.847 12.867 0.284 32.854 26 AA_G47G48:C78C79_AA A 47 ? A 79 ? A 48 ? A 78 ? 1 A G 49 1_555 A C 79 1_555 A A 50 1_555 A U 78 1_555 0.024 -1.607 3.211 -0.012 8.290 32.818 -3.999 -0.044 2.735 14.389 0.021 33.821 27 AA_G48A49:U77C78_AA A 48 ? A 78 ? A 49 ? A 77 ? 1 A A 50 1_555 A U 78 1_555 A A 51 1_555 A U 77 1_555 0.188 -1.670 3.225 -0.049 7.433 31.641 -4.195 -0.344 2.771 13.401 0.087 32.481 28 AA_A49A50:U76U77_AA A 49 ? A 77 ? A 50 ? A 76 ? 1 A U 55 1_555 A A 72 1_555 A U 56 1_555 A A 71 1_555 0.094 -1.817 3.297 0.974 6.530 32.610 -4.217 -0.009 2.891 11.482 -1.713 33.254 29 AA_U54U55:A70A71_AA A 54 ? A 71 ? A 55 ? A 70 ? 1 A U 56 1_555 A A 71 1_555 A U 57 1_555 A A 70 1_555 0.103 -1.711 3.256 0.815 5.653 31.759 -4.036 -0.047 2.918 10.227 -1.474 32.255 30 AA_U55U56:A69A70_AA A 55 ? A 70 ? A 56 ? A 69 ? 1 A U 57 1_555 A A 70 1_555 A U 58 1_555 A G 69 1_555 0.408 -1.467 3.324 1.512 5.080 39.022 -2.774 -0.428 3.129 7.562 -2.251 39.367 31 AA_U56U57:G68A69_AA A 56 ? A 69 ? A 57 ? A 68 ? 1 A U 58 1_555 A G 69 1_555 A C 59 1_555 A G 68 1_555 0.286 -2.035 3.115 4.425 8.010 26.148 -5.943 0.335 2.412 17.054 -9.421 27.677 32 AA_U57C58:G67G68_AA A 57 ? A 68 ? A 58 ? A 67 ? 1 A C 59 1_555 A G 68 1_555 A A 60 1_555 A U 67 1_555 -0.027 -1.667 3.281 1.504 9.136 30.228 -4.641 0.309 2.671 17.023 -2.802 31.582 33 AA_C58A59:U66G67_AA A 58 ? A 67 ? A 59 ? A 66 ? 1 A A 60 1_555 A U 67 1_555 A G 61 1_555 A A 66 1_555 2.230 -0.837 4.055 -5.408 14.077 56.138 -1.753 -2.642 3.560 14.667 5.634 57.968 34 AA_A59G60:A65U66_AA A 59 ? A 66 ? A 60 ? A 65 ? 1 A G 61 1_555 A A 66 1_555 A A 62 1_555 A U 65 1_555 -5.622 -1.201 -4.111 114.010 112.027 29.037 2.091 0.104 -5.738 61.290 -62.375 160.488 35 AA_G60A61:U64A65_AA A 60 ? A 65 ? A 61 ? A 64 ? # _pdbx_audit_support.funding_organization 'Swedish Research Council' _pdbx_audit_support.country Sweden _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9EWW _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #