data_9FM4 # _entry.id 9FM4 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.404 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9FM4 pdb_00009fm4 10.2210/pdb9fm4/pdb WWPDB D_1292138963 ? ? BMRB 34919 ? 10.13018/BMR34919 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-05-07 ? 2 'Structure model' 1 1 2025-06-04 ? 3 'Structure model' 1 2 2025-07-16 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Structure summary' 2 3 'Structure model' 'Database references' 3 3 'Structure model' 'Structure summary' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' struct 2 3 'Structure model' citation 3 3 'Structure model' citation_author 4 3 'Structure model' struct # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_struct.title' 2 3 'Structure model' '_citation.country' 3 3 'Structure model' '_citation.journal_abbrev' 4 3 'Structure model' '_citation.journal_id_ASTM' 5 3 'Structure model' '_citation.journal_id_CSD' 6 3 'Structure model' '_citation.journal_id_ISSN' 7 3 'Structure model' '_citation.journal_volume' 8 3 'Structure model' '_citation.pdbx_database_id_DOI' 9 3 'Structure model' '_citation.pdbx_database_id_PubMed' 10 3 'Structure model' '_citation.title' 11 3 'Structure model' '_citation.year' 12 3 'Structure model' '_struct.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9FM4 _pdbx_database_status.recvd_initial_deposition_date 2024-06-05 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type SASBDB . SASDUD9 unspecified SASBDB . SASDUD9 'associated SAS data' BMRB 'Dynamic structure of the apical stem loop of the stem loop 2 motif (s2m) from SCoV-2 Delta variant' 34919 unspecified # _pdbx_contact_author.id 4 _pdbx_contact_author.email schwalbe@nmr.uni-frankfurt.de _pdbx_contact_author.name_first Harald _pdbx_contact_author.name_last Schwalbe _pdbx_contact_author.name_mi J. _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-5693-7909 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Wirtz Martin, M.A.' 1 0000-0002-0318-7785 'Matzel, T.' 2 0009-0008-6024-4062 'Makowski, J.' 3 ? 'Kensinger, A.' 4 ? 'Herr, A.' 5 ? 'Wacker, A.' 6 0000-0001-5892-5661 'Richter, C.' 7 0000-0002-5420-2826 'Jonker, H.R.A.' 8 ? 'Evanseck, J.' 9 0000-0002-1162-7699 'Schwalbe, H.' 10 0000-0001-5693-7909 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title ;Structural heterogeneity and dynamics in the apical stem loop of s2m from SARS-CoV-2 Delta by an integrative NMR spectroscopy and MD simulation approach. ; _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf552 _citation.pdbx_database_id_PubMed 40586311 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Wirtz Martin, M.A.' 1 ? primary 'Makowski, J.A.' 2 ? primary 'Matzel, T.' 3 ? primary 'Kensinger, A.H.' 4 ? primary 'Herr, A.' 5 ? primary 'Richter, C.' 6 ? primary 'Jonker, H.R.A.' 7 ? primary 'Wacker, A.' 8 ? primary 'Evanseck, J.D.' 9 ? primary 'Schwalbe, H.' 10 0000-0001-5693-7909 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (25-MER)' _entity.formula_weight 8068.861 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation 'C738G; U760C; A761C' _entity.pdbx_fragment ? _entity.details 'Sequence numbering corresponds to position in the RNA genome -29,000' # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCACUCGGAGUACGAUCGAGUGCC _entity_poly.pdbx_seq_one_letter_code_can GGCACUCGGAGUACGAUCGAGUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 C n 1 6 U n 1 7 C n 1 8 G n 1 9 G n 1 10 A n 1 11 G n 1 12 U n 1 13 A n 1 14 C n 1 15 G n 1 16 A n 1 17 U n 1 18 C n 1 19 G n 1 20 A n 1 21 G n 1 22 U n 1 23 G n 1 24 C n 1 25 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 25 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus 2' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2697049 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 737 737 G G A . n A 1 2 G 2 738 738 G G A . n A 1 3 C 3 739 739 C C A . n A 1 4 A 4 740 740 A A A . n A 1 5 C 5 741 741 C C A . n A 1 6 U 6 742 742 U U A . n A 1 7 C 7 743 743 C C A . n A 1 8 G 8 744 744 G G A . n A 1 9 G 9 745 745 G G A . n A 1 10 A 10 746 746 A A A . n A 1 11 G 11 747 747 G G A . n A 1 12 U 12 748 748 U U A . n A 1 13 A 13 749 749 A A A . n A 1 14 C 14 750 750 C C A . n A 1 15 G 15 751 751 G G A . n A 1 16 A 16 752 752 A A A . n A 1 17 U 17 753 753 U U A . n A 1 18 C 18 754 754 C C A . n A 1 19 G 19 755 755 G G A . n A 1 20 A 20 756 756 A A A . n A 1 21 G 21 757 757 G G A . n A 1 22 U 22 758 758 U U A . n A 1 23 G 23 759 759 G G A . n A 1 24 C 24 760 760 C C A . n A 1 25 C 25 761 761 C C A . n # loop_ _exptl.absorpt_coefficient_mu _exptl.absorpt_correction_T_max _exptl.absorpt_correction_T_min _exptl.absorpt_correction_type _exptl.absorpt_process_details _exptl.entry_id _exptl.crystals_number _exptl.details _exptl.method _exptl.method_details ? ? ? ? ? 9FM4 ? ? 'SOLUTION NMR' ? ? ? ? ? ? 9FM4 ? ? 'SOLUTION SCATTERING' ? # _struct.entry_id 9FM4 _struct.title 'Dynamic structure of the apical stem loop of the stem loop 2 motif (s2m) from SCoV-2 Delta variant' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9FM4 _struct_keywords.text 's2m, Covid-19, NMR Assignment, Molecular dynamic simulations, NMR dynamics, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9FM4 _struct_ref.pdbx_db_accession 9FM4 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9FM4 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 25 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9FM4 _struct_ref_seq.db_align_beg 737 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 761 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 737 _struct_ref_seq.pdbx_auth_seq_align_end 761 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support SAXS _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 737 A C 761 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 737 A C 761 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 737 A C 761 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 24 N3 ? ? A G 738 A C 760 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 24 O2 ? ? A G 738 A C 760 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 24 N4 ? ? A G 738 A C 760 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 23 N1 ? ? A C 739 A G 759 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 23 O6 ? ? A C 739 A G 759 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 23 N2 ? ? A C 739 A G 759 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 740 A U 758 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 740 A U 758 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 21 N1 ? ? A C 741 A G 757 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 21 O6 ? ? A C 741 A G 757 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 21 N2 ? ? A C 741 A G 757 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 20 N1 ? ? A U 742 A A 756 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 20 N6 ? ? A U 742 A A 756 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 743 A G 755 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 743 A G 755 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 743 A G 755 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 8 N1 ? ? ? 1_555 A C 18 N3 ? ? A G 744 A C 754 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 8 N2 ? ? ? 1_555 A C 18 O2 ? ? A G 744 A C 754 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 8 O6 ? ? ? 1_555 A C 18 N4 ? ? A G 744 A C 754 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N1 ? ? ? 1_555 A U 17 O2 ? ? A G 745 A U 753 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A U 17 N3 ? ? A G 745 A U 753 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9FM4 _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "HO2'" A U 753 ? ? OP1 A C 754 ? ? 1.59 2 3 "HO2'" A G 744 ? ? "O5'" A G 745 ? ? 1.60 3 6 "HO2'" A G 747 ? ? OP1 A U 748 ? ? 1.55 4 12 "HO2'" A A 749 ? ? OP2 A C 750 ? ? 1.54 5 13 "HO2'" A G 747 ? ? "O5'" A U 748 ? ? 1.54 6 13 "HO2'" A U 753 ? ? OP1 A C 754 ? ? 1.56 7 16 "HO2'" A G 747 ? ? "O5'" A U 748 ? ? 1.54 8 19 "HO2'" A G 747 ? ? OP1 A U 748 ? ? 1.60 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 8 "C3'" A A 749 ? ? "O3'" A A 749 ? ? P A C 750 ? ? 127.49 119.70 7.79 1.20 Y 2 11 "C3'" A A 749 ? ? "C2'" A A 749 ? ? "C1'" A A 749 ? ? 96.96 101.30 -4.34 0.70 N 3 12 "C3'" A A 749 ? ? "O3'" A A 749 ? ? P A C 750 ? ? 128.69 119.70 8.99 1.20 Y 4 19 "C3'" A A 749 ? ? "O3'" A A 749 ? ? P A C 750 ? ? 128.06 119.70 8.36 1.20 Y # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 4 G A 738 ? ? 0.049 'SIDE CHAIN' 2 11 A A 749 ? ? 0.050 'SIDE CHAIN' 3 14 G A 737 ? ? 0.067 'SIDE CHAIN' 4 15 A A 752 ? ? 0.065 'SIDE CHAIN' 5 16 A A 749 ? ? 0.053 'SIDE CHAIN' 6 18 C A 760 ? ? 0.055 'SIDE CHAIN' 7 20 G A 744 ? ? 0.047 'SIDE CHAIN' 8 20 C A 754 ? ? 0.070 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 9FM4 _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9FM4 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'fewest violations' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 ;250 uM [U-100% 13C; U-100% 15N] s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short H2O' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' 2 ;1700 uM [U-100% 13C; U-100% 15N] s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short D2O 1' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' 3 ;150 uM [U-100% 13C; U-100% 15N] s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short D2O 2' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' 4 ;150 uM [U-13C; U-15N]-Ade; U[U-13C; U-15N]-Ura s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short D2O AU labelled' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' 5 ;200 uM [U-13C; U-15N]-Cyt s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short D2O C labelled' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' 6 ;700 uM [U-13C; U-15N]-Cyt s2m Delta_short RNA, 25 mM dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate, 50 mM potassium chloride, 95% H2O/5% D2O ; '95% H2O/5% D2O' 's2m Delta_short D2O natural abundance' solution 's2m Delta_short RNA in 25 mM Kpi, 50 mM KCl, pH 6.2' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 's2m Delta_short RNA' 250 ? uM '[U-100% 13C; U-100% 15N]' 1 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 1 'potassium chloride' 50 ? mM 'natural abundance' 2 's2m Delta_short RNA' 1700 ? uM '[U-100% 13C; U-100% 15N]' 2 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 2 'potassium chloride' 50 ? mM 'natural abundance' 3 's2m Delta_short RNA' 150 ? uM '[U-100% 13C; U-100% 15N]' 3 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 3 'potassium chloride' 50 ? mM 'natural abundance' 4 's2m Delta_short RNA' 150 ? uM '[U-13C; U-15N]-Ade; U[U-13C; U-15N]-Ura' 4 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 4 'potassium chloride' 50 ? mM 'natural abundance' 5 's2m Delta_short RNA' 200 ? uM '[U-13C; U-15N]-Cyt' 5 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 5 'potassium chloride' 50 ? mM 'natural abundance' 6 's2m Delta_short RNA' 700 ? uM '[U-13C; U-15N]-Cyt' 6 'dipotassium hydrogen orthophosphate/potassium dihydrogen phosphate' 25 ? mM 'natural abundance' 6 'potassium chloride' 50 ? mM 'natural abundance' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 atm 1 6.2 75 ? ? mM '283 K' ? pH ? ? K 2 298 atm 1 6.2 75 ? ? mM '298 K' ? pH ? ? K 3 298 atm 1 6.2 75 ? ? mM '308 K' ? pH ? ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 1 '2D 1H-15N TROSY' 1 isotropic 3 1 1 '3D HNN-COSY' 1 isotropic 4 1 1 '3D HNCO' 1 isotropic 5 1 1 '2D 1H-13C HSQC' 1 isotropic 6 2 1 '2D 1H-1H NOESY' 2 isotropic 7 2 1 '2D 1H-15N TROSY' 1 isotropic 8 2 1 '2D 1H-15N HSQC NH2 only' 1 isotropic 9 2 1 '3D HNCO' 2 isotropic 10 2 1 '2D 1H-13C HSQC' 1 isotropic 11 2 1 '2D 1H-15N HSQC 2J' 1 isotropic 12 2 1 '2D 1H-13C HSQC LR' 2 isotropic 13 3 6 '2D 1H-1H NOESY' 4 isotropic 14 3 1 '2D 1H-15N TROSY' 2 isotropic 15 3 1 '3D HNCO' 2 isotropic 16 3 1 '2D 1H-13C HSQC LR' 2 isotropic 17 3 1 '2D 1H-13C HSQC' 1 isotropic 18 3 2 '2D 1H-13C HSQC' 5 isotropic 19 3 3 '2D 1H-13C HSQC' 4 isotropic 20 3 4 '2D 1H-13C HSQC' 2 isotropic 21 3 5 '2D 1H-13C HSQC' 2 isotropic 22 3 1 '3D HCN' 3 isotropic 23 3 1 '2D HCCNH' 1 isotropic 24 3 2 '3D TROSY-HCCH-COSY' 1 isotropic 25 3 1 3D-NOESY 3 isotropic 26 3 2 4D-HMQC-NOESY-HMQC 5 isotropic 27 3 2 '3D HCCH-TOCSY' 3 isotropic 28 3 3 '3D fw-HCCH-TOCSY' 1 isotropic 29 3 4 '3D fw-HCCH-TOCSY' 3 isotropic 30 3 5 '3D fw-HCCH-TOCSY' 1 isotropic 31 3 2 '2D CN-HSQC' 2 isotropic 32 2 1 '2D 1H-15N CPMG NOESY' 1 isotropic # _pdbx_nmr_refine.entry_id 9FM4 _pdbx_nmr_refine.method 'molecular dynamics' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 8 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'chemical shift assignment' NMRFAM-SPARKY ? 'Lee W, Tonelli M, Markley JL' 2 'structure calculation' CNS ? 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 refinement CNS ? 'Brunger, Adams, Clore, Gros, Nilges and Read' 4 'peak picking' NMRFAM-SPARKY ? 'Lee W, Tonelli M, Markley JL' 5 collection TopSpin ? 'Bruker Biospin' 6 'data analysis' TopSpin ? 'Bruker Biospin' 7 processing TopSpin ? 'Bruker Biospin' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9FM4 'double helix' 9FM4 'a-form double helix' 9FM4 'hairpin loop' 9FM4 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 25 1_555 -0.588 -0.123 0.014 24.488 -0.990 -8.638 1 A_G737:C761_A A 737 ? A 761 ? 19 1 1 A G 2 1_555 A C 24 1_555 0.172 -0.041 0.174 -1.544 4.881 3.537 2 A_G738:C760_A A 738 ? A 760 ? 19 1 1 A C 3 1_555 A G 23 1_555 0.131 -0.008 -0.237 3.191 1.202 -3.411 3 A_C739:G759_A A 739 ? A 759 ? 19 1 1 A A 4 1_555 A U 22 1_555 -0.496 -0.189 0.509 14.370 1.145 -3.775 4 A_A740:U758_A A 740 ? A 758 ? 20 1 1 A C 5 1_555 A G 21 1_555 0.021 -0.068 0.062 12.267 -6.221 -2.414 5 A_C741:G757_A A 741 ? A 757 ? 19 1 1 A U 6 1_555 A A 20 1_555 -0.010 0.122 -0.039 1.561 -4.770 -10.322 6 A_U742:A756_A A 742 ? A 756 ? 20 1 1 A C 7 1_555 A G 19 1_555 -0.160 -0.092 0.226 -13.299 2.099 0.162 7 A_C743:G755_A A 743 ? A 755 ? 19 1 1 A G 8 1_555 A C 18 1_555 0.051 -0.096 0.035 -7.876 -3.846 -6.373 8 A_G744:C754_A A 744 ? A 754 ? 19 1 1 A G 9 1_555 A U 17 1_555 -2.562 -0.661 -0.589 -1.187 0.817 -6.339 9 A_G745:U753_A A 745 ? A 753 ? 28 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 25 1_555 A G 2 1_555 A C 24 1_555 0.555 -0.898 4.547 -9.278 39.402 31.407 -4.628 -1.491 2.090 52.290 12.312 50.827 1 AA_G737G738:C760C761_AA A 737 ? A 761 ? A 738 ? A 760 ? 1 A G 2 1_555 A C 24 1_555 A C 3 1_555 A G 23 1_555 -0.272 -1.094 3.483 3.999 12.548 30.086 -4.094 1.168 2.763 22.846 -7.282 32.781 2 AA_G738C739:G759C760_AA A 738 ? A 760 ? A 739 ? A 759 ? 1 A C 3 1_555 A G 23 1_555 A A 4 1_555 A U 22 1_555 0.644 -1.217 4.189 -5.747 -18.901 27.448 2.167 -2.408 3.990 -34.708 10.553 33.707 3 AA_C739A740:U758G759_AA A 739 ? A 759 ? A 740 ? A 758 ? 1 A A 4 1_555 A U 22 1_555 A C 5 1_555 A G 21 1_555 0.394 -1.181 3.612 4.948 8.054 32.333 -3.449 0.185 3.256 14.092 -8.657 33.651 4 AA_A740C741:G757U758_AA A 740 ? A 758 ? A 741 ? A 757 ? 1 A C 5 1_555 A G 21 1_555 A U 6 1_555 A A 20 1_555 -0.367 -1.536 3.610 4.099 11.302 35.588 -3.913 1.123 2.945 17.874 -6.483 37.502 5 AA_C741U742:A756G757_AA A 741 ? A 757 ? A 742 ? A 756 ? 1 A U 6 1_555 A A 20 1_555 A C 7 1_555 A G 19 1_555 -0.595 -0.851 4.355 -5.256 18.596 33.780 -4.216 0.066 3.494 29.226 8.260 38.777 6 AA_U742C743:G755A756_AA A 742 ? A 756 ? A 743 ? A 755 ? 1 A C 7 1_555 A G 19 1_555 A G 8 1_555 A C 18 1_555 -0.409 -0.793 3.405 -0.172 21.857 20.449 -5.853 0.760 1.775 47.407 0.373 29.847 7 AA_C743G744:C754G755_AA A 743 ? A 755 ? A 744 ? A 754 ? 1 A G 8 1_555 A C 18 1_555 A G 9 1_555 A U 17 1_555 1.005 -1.164 3.782 1.132 -3.961 27.196 -1.293 -1.784 3.946 -8.362 -2.390 27.501 8 AA_G744G745:U753C754_AA A 744 ? A 754 ? A 745 ? A 753 ? # _pdbx_audit_support.funding_organization 'German Research Foundation (DFG)' _pdbx_audit_support.country Germany _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III HD' ? Bruker 600 ? 2 'AVANCE III' ? Bruker 800 ? 3 'AVANCE III HD' ? Bruker 800 ? 4 'AVANCE III' ? Bruker 700 ? 5 'AVANCE NEO' ? Bruker 900 ? # _atom_sites.entry_id 9FM4 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #