data_9FO9 # _entry.id 9FO9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.399 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9FO9 pdb_00009fo9 10.2210/pdb9fo9/pdb WWPDB D_1292139093 ? ? BMRB 50346 ? 10.13018/BMR50346 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2024-11-06 2 'Structure model' 1 1 2024-11-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # _pdbx_audit_revision_category.ordinal 1 _pdbx_audit_revision_category.revision_ordinal 2 _pdbx_audit_revision_category.data_content_type 'Structure model' _pdbx_audit_revision_category.category citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.journal_volume' 2 2 'Structure model' '_citation.page_first' 3 2 'Structure model' '_citation.page_last' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9FO9 _pdbx_database_status.recvd_initial_deposition_date 2024-06-11 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details . _pdbx_database_related.db_id 50346 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email schwalbe@nmr.uni-frankfurt.de _pdbx_contact_author.name_first Harald _pdbx_contact_author.name_last Schwalbe _pdbx_contact_author.name_mi J. _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-5693-7909 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Mertinkus, K.R.' 1 0000-0002-2735-0049 'Oxenfarth, A.' 2 0000-0001-6859-6849 'Schwalbe, H.J.' 3 0000-0001-5693-7909 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country US _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev J.Am.Chem.Soc. _citation.journal_id_ASTM JACSAT _citation.journal_id_CSD ? _citation.journal_id_ISSN 1520-5126 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 146 _citation.language ? _citation.page_first 30139 _citation.page_last 30154 _citation.title ;Dissecting the Conformational Heterogeneity of Stem-Loop Substructures of the Fifth Element in the 5'-Untranslated Region of SARS-CoV-2. ; _citation.year 2024 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1021/jacs.4c08406 _citation.pdbx_database_id_PubMed 39442924 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Mertinkus, K.R.' 1 ? primary 'Oxenfarth, A.' 2 ? primary 'Richter, C.' 3 ? primary 'Wacker, A.' 4 ? primary 'Mata, C.P.' 5 ? primary 'Carazo, J.M.' 6 0000-0003-0788-8447 primary 'Schlundt, A.' 7 0000-0003-2254-7560 primary 'Schwalbe, H.' 8 0000-0001-5693-7909 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (33-MER)' _entity.formula_weight 10524.194 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCC _entity_poly.pdbx_seq_one_letter_code_can GGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 U n 1 6 G n 1 7 C n 1 8 U n 1 9 U n 1 10 A n 1 11 C n 1 12 G n 1 13 G n 1 14 U n 1 15 U n 1 16 U n 1 17 C n 1 18 G n 1 19 U n 1 20 C n 1 21 C n 1 22 G n 1 23 U n 1 24 G n 1 25 U n 1 26 U n 1 27 G n 1 28 C n 1 29 A n 1 30 G n 1 31 C n 1 32 C n 1 33 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 33 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2901879 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 C 4 4 4 C C A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 C 7 7 7 C C A . n A 1 8 U 8 8 8 U U A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 C 11 11 11 C C A . n A 1 12 G 12 12 12 G G A . n A 1 13 G 13 13 13 G G A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 C 17 17 17 C C A . n A 1 18 G 18 18 18 G G A . n A 1 19 U 19 19 19 U U A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 G 22 22 22 G G A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 U 25 25 25 U U A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 C 28 28 28 C C A . n A 1 29 A 29 29 29 A A A . n A 1 30 G 30 30 30 G G A . n A 1 31 C 31 31 31 C C A . n A 1 32 C 32 32 32 C C A . n A 1 33 C 33 33 33 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9FO9 _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9FO9 _struct.title '5_SL5a of S_SL5 of Sars-Cov-2' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9FO9 _struct_keywords.text '5_SL5, 5_SL5a, Sars-cov-2, UUUCGU, repetetive structure motifs, U rich bulges, RNA' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9FO9 _struct_ref.pdbx_db_accession 9FO9 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9FO9 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 33 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9FO9 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 33 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 33 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support SAXS _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 3 N1 ? ? ? 1_555 A C 31 N3 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 3 N2 ? ? ? 1_555 A C 31 O2 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 3 O6 ? ? ? 1_555 A C 31 N4 ? ? A G 3 A C 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 30 N1 ? ? A C 4 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 30 O6 ? ? A C 4 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 30 N2 ? ? A C 4 A G 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 29 N1 ? ? A U 5 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 29 N6 ? ? A U 5 A A 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 6 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 6 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 6 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 7 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 7 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 7 A G 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A U 8 N3 ? ? ? 1_555 A U 26 O4 ? ? A U 8 A U 26 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog22 hydrog ? ? A U 8 O2 ? ? ? 1_555 A U 26 N3 ? ? A U 8 A U 26 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog23 hydrog ? ? A U 9 O4 ? ? ? 1_555 A G 24 N2 ? ? A U 9 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog24 hydrog ? ? A U 9 N3 ? ? ? 1_555 A U 25 O4 ? ? A U 9 A U 25 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog25 hydrog ? ? A A 10 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 10 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 10 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 10 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 22 N1 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 22 O6 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 22 N2 ? ? A C 11 A G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 12 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 13 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 13 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 13 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 14 N3 ? ? ? 1_555 A G 18 O6 ? ? A U 14 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A U 14 O2 ? ? ? 1_555 A G 18 N1 ? ? A U 14 A G 18 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9FO9 _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 4 "HO2'" A U 19 ? ? OP2 A C 20 ? ? 1.58 2 6 "HO2'" A U 19 ? ? OP2 A C 20 ? ? 1.59 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 7 "C1'" A U 15 ? ? "O4'" A U 15 ? ? "C4'" A U 15 ? ? 105.41 109.70 -4.29 0.70 N 2 9 "C3'" A U 19 ? ? "O3'" A U 19 ? ? P A C 20 ? ? 127.16 119.70 7.46 1.20 Y # loop_ _pdbx_validate_planes.id _pdbx_validate_planes.PDB_model_num _pdbx_validate_planes.auth_comp_id _pdbx_validate_planes.auth_asym_id _pdbx_validate_planes.auth_seq_id _pdbx_validate_planes.PDB_ins_code _pdbx_validate_planes.label_alt_id _pdbx_validate_planes.rmsd _pdbx_validate_planes.type 1 1 U A 14 ? ? 0.060 'SIDE CHAIN' 2 1 C A 32 ? ? 0.076 'SIDE CHAIN' 3 2 U A 14 ? ? 0.067 'SIDE CHAIN' 4 2 C A 32 ? ? 0.069 'SIDE CHAIN' 5 3 G A 1 ? ? 0.059 'SIDE CHAIN' 6 4 C A 32 ? ? 0.081 'SIDE CHAIN' 7 5 U A 14 ? ? 0.077 'SIDE CHAIN' 8 5 G A 18 ? ? 0.054 'SIDE CHAIN' 9 5 C A 32 ? ? 0.065 'SIDE CHAIN' 10 6 U A 14 ? ? 0.067 'SIDE CHAIN' 11 6 C A 32 ? ? 0.069 'SIDE CHAIN' 12 7 G A 18 ? ? 0.053 'SIDE CHAIN' 13 7 C A 32 ? ? 0.080 'SIDE CHAIN' 14 9 U A 14 ? ? 0.090 'SIDE CHAIN' 15 9 G A 18 ? ? 0.063 'SIDE CHAIN' 16 10 G A 1 ? ? 0.050 'SIDE CHAIN' # _pdbx_nmr_ensemble.entry_id 9FO9 _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9FO9 _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '280 mM [U-10% 13C; U-100% 15N] RNA (33-MER), 50 mM potassium chloride, 25 mM potassium phosphate, 95% H2O/5% D2O' '95% H2O/5% D2O' '13C15N H2O' solution ? 2 '400 mM [U-10% 13C; U-100% 15N] RNA (33-MER), 50 mM potassium chloride, 25 mM potassium phosphate, 100% D2O' '100% D2O' '13C15N D2O' solution ? 3 '200 mM [U-10% 13C; U-100% 15N] RNA (33-MER), 50 mM potassium chloride, 25 mM potassium phosphate, 95% H2O/5% D2O' '95% H2O/5% D2O' 'RDC ref' solution ? 4 ;200 mM [U-10% 13C; U-100% 15N] RNA (33-MER), 50 mM potassium chloride, 25 mM potassium phosphate, 21 mg/mL Pf1 phage, 95% H2O/5% D2O ; '95% H2O/5% D2O' 'RDC cross' solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (33-MER)' 280 ? mM '[U-10% 13C; U-100% 15N]' 1 'potassium chloride' 50 ? mM 'natural abundance' 1 'potassium phosphate' 25 ? mM 'natural abundance' 2 'RNA (33-MER)' 400 ? mM '[U-10% 13C; U-100% 15N]' 2 'potassium chloride' 50 ? mM 'natural abundance' 2 'potassium phosphate' 25 ? mM 'natural abundance' 3 'RNA (33-MER)' 200 ? mM '[U-10% 13C; U-100% 15N]' 3 'potassium chloride' 50 ? mM 'natural abundance' 3 'potassium phosphate' 25 ? mM 'natural abundance' 4 'RNA (33-MER)' 200 ? mM '[U-10% 13C; U-100% 15N]' 4 'potassium chloride' 50 ? mM 'natural abundance' 4 'potassium phosphate' 25 ? mM 'natural abundance' 4 'Pf1 phage' 21 ? mg/mL 'natural abundance' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 308 _pdbx_nmr_exptl_sample_conditions.pressure_units Pa _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.2 _pdbx_nmr_exptl_sample_conditions.ionic_strength 25 _pdbx_nmr_exptl_sample_conditions.details 'The sample was stored at 277K and measured at temperatures ranging from 278-313K.' _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label 13C15N _pdbx_nmr_exptl_sample_conditions.pH_err 0.1 _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 4 isotropic 2 1 1 '2D 1H-1H NOESY' 4 isotropic 3 1 1 '2D 1H-1H NOESY' 4 isotropic 4 1 2 '2D 1H-1H NOESY' 5 isotropic 5 1 2 '2D 1H-1H NOESY' 5 isotropic 6 1 1 '2D 1H-13C HSQC' 4 isotropic 9 1 1 '2D 1H-13C HSQC aromatic' 4 isotropic 8 1 2 '2D 1H-13C HSQC' 5 isotropic 7 1 2 '2D 1H-13C HSQC aromatic' 5 isotropic 16 1 3 '2D 1H-13C HSQC' 1 isotropic 17 1 3 '2D 1H-13C HSQC aromatic' 1 isotropic 18 1 4 '2D 1H-13C HSQC' 1 anisotropic 19 1 4 '2D 1H-13C HSQC aromatic' 1 anisotropic # loop_ _pdbx_nmr_refine.entry_id _pdbx_nmr_refine.method _pdbx_nmr_refine.details _pdbx_nmr_refine.software_ordinal 9FO9 'simulated annealing' ? 2 9FO9 na 'water refinement' 3 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'chemical shift assignment' NMRFAM-SPARKY 3.190 'Lee W, Tonelli M, Markley JL' 2 'structure calculation' CNS ? 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 'structure calculation' ARIA ? ;Linge, O'Donoghue and Nilges ; 4 processing TopSpin 3.6.3 'Bruker Biospin' 5 processing TopSpin 4.1.4 'Bruker Biospin' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9FO9 'double helix' 9FO9 'a-form double helix' 9FO9 'mismatched base pair' 9FO9 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 33 1_555 -0.205 -0.178 -0.453 -14.710 -1.371 0.154 1 A_G1:C33_A A 1 ? A 33 ? 19 1 1 A G 2 1_555 A C 32 1_555 0.664 -0.029 -0.171 -6.118 -2.475 -9.471 2 A_G2:C32_A A 2 ? A 32 ? 19 1 1 A G 3 1_555 A C 31 1_555 -0.907 -0.250 0.429 4.086 -3.973 -1.486 3 A_G3:C31_A A 3 ? A 31 ? 19 1 1 A C 4 1_555 A G 30 1_555 -0.130 -0.117 -0.097 -1.943 -8.146 0.353 4 A_C4:G30_A A 4 ? A 30 ? 19 1 1 A U 5 1_555 A A 29 1_555 -0.740 0.114 0.336 2.036 -11.566 2.645 5 A_U5:A29_A A 5 ? A 29 ? 20 1 1 A G 6 1_555 A C 28 1_555 1.502 -0.401 -1.062 -4.156 4.020 -14.609 6 A_G6:C28_A A 6 ? A 28 ? 19 1 1 A C 7 1_555 A G 27 1_555 0.286 -0.207 -0.006 7.131 -21.968 -2.180 7 A_C7:G27_A A 7 ? A 27 ? 19 1 1 A U 8 1_555 A U 26 1_555 2.398 -1.764 0.448 -0.475 -6.275 -3.059 8 A_U8:U26_A A 8 ? A 26 ? 16 1 1 A U 9 1_555 A U 25 1_555 3.071 -0.903 0.710 -6.269 -24.773 -66.964 9 A_U9:U25_A A 9 ? A 25 ? ? ? 1 A A 10 1_555 A U 23 1_555 -0.042 -0.018 -0.219 1.222 -0.452 -0.527 10 A_A10:U23_A A 10 ? A 23 ? 20 1 1 A C 11 1_555 A G 22 1_555 0.255 0.167 -0.263 7.407 -10.385 10.813 11 A_C11:G22_A A 11 ? A 22 ? 19 1 1 A G 12 1_555 A C 21 1_555 -0.827 -0.368 -0.554 7.569 -2.916 -2.757 12 A_G12:C21_A A 12 ? A 21 ? 19 1 1 A G 13 1_555 A C 20 1_555 -0.561 -0.049 -0.204 -4.319 -5.820 1.855 13 A_G13:C20_A A 13 ? A 20 ? 19 1 1 A U 14 1_555 A G 18 1_555 0.398 -2.590 -0.796 -35.176 1.209 -96.276 14 A_U14:G18_A A 14 ? A 18 ? 28 2 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 33 1_555 A G 2 1_555 A C 32 1_555 -0.856 -1.226 3.535 2.123 14.618 31.145 -4.346 1.778 2.650 25.505 -3.704 34.392 1 AA_G1G2:C32C33_AA A 1 ? A 33 ? A 2 ? A 32 ? 1 A G 2 1_555 A C 32 1_555 A G 3 1_555 A C 31 1_555 1.267 -0.810 3.298 0.428 0.054 30.548 -1.549 -2.318 3.314 0.102 -0.812 30.551 2 AA_G2G3:C31C32_AA A 2 ? A 32 ? A 3 ? A 31 ? 1 A G 3 1_555 A C 31 1_555 A C 4 1_555 A G 30 1_555 -0.149 -1.818 3.743 -1.106 10.768 35.476 -4.405 0.076 3.083 17.184 1.765 37.039 3 AA_G3C4:G30C31_AA A 3 ? A 31 ? A 4 ? A 30 ? 1 A C 4 1_555 A G 30 1_555 A U 5 1_555 A A 29 1_555 1.057 -1.236 3.436 -3.795 4.590 27.129 -3.680 -3.115 3.017 9.638 7.969 27.763 4 AA_C4U5:A29G30_AA A 4 ? A 30 ? A 5 ? A 29 ? 1 A U 5 1_555 A A 29 1_555 A G 6 1_555 A C 28 1_555 -1.894 -1.928 3.608 4.291 6.030 37.658 -3.709 3.434 3.049 9.233 -6.570 38.353 5 AA_U5G6:C28A29_AA A 5 ? A 29 ? A 6 ? A 28 ? 1 A G 6 1_555 A C 28 1_555 A C 7 1_555 A G 27 1_555 0.835 -0.952 3.806 1.689 -0.596 28.118 -1.792 -1.253 3.868 -1.225 -3.473 28.174 6 AA_G6C7:G27C28_AA A 6 ? A 28 ? A 7 ? A 27 ? 1 A C 7 1_555 A G 27 1_555 A U 8 1_555 A U 26 1_555 -0.001 -0.678 4.101 -4.885 4.712 43.169 -1.473 -0.581 3.986 6.357 6.590 43.674 7 AA_C7U8:U26G27_AA A 7 ? A 27 ? A 8 ? A 26 ? 1 A U 8 1_555 A U 26 1_555 A U 9 1_555 A U 25 1_555 -3.545 -0.493 4.412 0.127 8.788 39.000 -2.070 5.209 4.197 12.964 -0.187 39.940 8 AA_U8U9:U25U26_AA A 8 ? A 26 ? A 9 ? A 25 ? 1 A A 10 1_555 A U 23 1_555 A C 11 1_555 A G 22 1_555 0.570 -0.870 3.726 1.085 10.874 31.895 -3.454 -0.789 3.279 19.100 -1.905 33.669 9 AA_A10C11:G22U23_AA A 10 ? A 23 ? A 11 ? A 22 ? 1 A C 11 1_555 A G 22 1_555 A G 12 1_555 A C 21 1_555 -1.582 -1.615 4.056 -4.448 -0.567 23.388 -3.674 1.950 4.315 -1.383 10.846 23.808 10 AA_C11G12:C21G22_AA A 11 ? A 22 ? A 12 ? A 21 ? 1 A G 12 1_555 A C 21 1_555 A G 13 1_555 A C 20 1_555 1.289 -1.860 3.714 -2.652 24.023 25.184 -6.442 -2.524 1.349 44.212 4.881 34.769 11 AA_G12G13:C20C21_AA A 12 ? A 21 ? A 13 ? A 20 ? 1 A G 13 1_555 A C 20 1_555 A U 14 1_555 A G 18 1_555 3.505 0.158 3.502 38.273 27.649 130.416 -0.132 -1.597 3.978 15.054 -20.838 134.808 12 AA_G13U14:G18C20_AA A 13 ? A 20 ? A 14 ? A 18 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'German Research Foundation (DFG)' Germany 161793742 1 'German Research Foundation (DFG)' Germany '495006306 H.S' 2 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III HD' ? Bruker 800 ? 4 'AVANCE NEO' ? Bruker 600 ? 5 'AVANCE III' ? Bruker 800 ? # _atom_sites.entry_id 9FO9 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_