data_9HRO # _entry.id 9HRO # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.406 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9HRO pdb_00009hro 10.2210/pdb9hro/pdb WWPDB D_1292143537 ? ? BMRB 34972 ? 10.13018/BMR34972 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-10-01 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9HRO _pdbx_database_status.recvd_initial_deposition_date 2024-12-18 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category RNA-Puzzles _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Solution NMR structure of the synthetic tobramycin riboswitch in complex with tobramycin' _pdbx_database_related.db_id 34972 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 3 _pdbx_contact_author.email woehnert@bio.uni-frankfurt.de _pdbx_contact_author.name_first Jens _pdbx_contact_author.name_last Woehnert _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7193-401X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Duchardt-Ferner, E.' 1 0000-0001-7521-8264 'Woehnert, J.' 2 0000-0001-7193-401X # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? UK ? ? primary 'Nucleic Acids Res.' NARHAD 0389 1362-4962 ? ? 53 ? ? ? 'Structural basis for ligand recognition in the tobramycin riboswitch.' 2025 ? 10.1093/nar/gkaf817 40902004 ? ? ? ? ? ? ? ? ? UK ? ? 1 'Nucleic Acids Res' NARHAD 0389 1362-4962 ? ? 51 ? 11375 11385 'Development of a novel tobramycin dependent riboswitch.' 2023 ? 10.1093/nar/gkad767 37791877 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Duchardt-Ferner, E.' 1 0000-0001-7521-8264 primary 'Kraus, L.' 2 ? primary 'Limouchi, A.' 3 ? primary 'Suess, B.' 4 0000-0001-8666-6716 primary 'Wohnert, J.' 5 0000-0001-7193-401X 1 'Kraus, L.' 6 ? 1 'Duchardt-Ferner, E.' 7 0000-0001-7521-8264 1 'Braeuchle, E.' 8 ? 1 'Fuerbacher, S.' 9 ? 1 'Kelvin, D.' 10 ? 1 'Marx, H.' 11 ? 1 'Boussebayle, A.' 12 ? 1 'Maurer, L.M.' 13 ? 1 'Bofill-Bosch, C.' 14 ? 1 'Woehnert, J.' 15 0000-0001-7193-401X 1 'Suess, B.' 16 0000-0001-8666-6716 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (35-MER)' 11189.646 1 ? ? ? ? 2 non-polymer syn TOBRAMYCIN 467.514 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUGUUUCGGAAAGCUUCGGCUUCUACCGAGCACC _entity_poly.pdbx_seq_one_letter_code_can GGUGUUUCGGAAAGCUUCGGCUUCUACCGAGCACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name TOBRAMYCIN _pdbx_entity_nonpoly.comp_id TOY # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 G n 1 5 U n 1 6 U n 1 7 U n 1 8 C n 1 9 G n 1 10 G n 1 11 A n 1 12 A n 1 13 A n 1 14 G n 1 15 C n 1 16 U n 1 17 U n 1 18 C n 1 19 G n 1 20 G n 1 21 C n 1 22 U n 1 23 U n 1 24 C n 1 25 U n 1 26 A n 1 27 C n 1 28 C n 1 29 G n 1 30 A n 1 31 G n 1 32 C n 1 33 A n 1 34 C n 1 35 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 35 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 TOY non-polymer . TOBRAMYCIN ;4-AMINO-2-[4,6-DIAMINO-3-(3-AMINO-6-AMINOMETHYL-5-HYDROXY-TETRAHYDRO-PYRAN-2-YLOXY)-2-HYDROXY-CYCLOHEXYLOXY]-6-HYDROXYMETHYL-TETRAHYDRO-PYRAN-3,5-DIOL ; 'C18 H37 N5 O9' 467.514 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 U 3 3 3 U U A . n A 1 4 G 4 4 4 G G A . n A 1 5 U 5 5 5 U U A . n A 1 6 U 6 6 6 U U A . n A 1 7 U 7 7 7 U U A . n A 1 8 C 8 8 8 C C A . n A 1 9 G 9 9 9 G G A . n A 1 10 G 10 10 10 G G A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 A 13 13 13 A A A . n A 1 14 G 14 14 14 G G A . n A 1 15 C 15 15 15 C C A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n A 1 21 C 21 21 21 C C A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 C 24 24 24 C C A . n A 1 25 U 25 25 25 U U A . n A 1 26 A 26 26 26 A A A . n A 1 27 C 27 27 27 C C A . n A 1 28 C 28 28 28 C C A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 A 33 33 33 A A A . n A 1 34 C 34 34 34 C C A . n A 1 35 C 35 35 35 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id TOY _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id TOY _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id TOY _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 68 _pdbx_nonpoly_scheme.pdb_mon_id TOY _pdbx_nonpoly_scheme.auth_mon_id TOY _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9HRO _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9HRO _struct.title 'Solution NMR structure of the synthetic tobramycin riboswitch in complex with tobramycin' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9HRO _struct_keywords.text 'RNA-ligand complex, riboswitch, aminoglycoside, translation regulation, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9HRO _struct_ref.pdbx_db_accession 9HRO _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9HRO _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 35 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9HRO _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 35 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 35 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 35 N3 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 35 O2 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 35 N4 ? ? A G 1 A C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 2 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 2 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 2 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 33 N1 ? ? A U 3 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 33 N6 ? ? A U 3 A A 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 4 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 4 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 4 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 5 N3 ? ? ? 1_555 A G 31 O6 ? ? A U 5 A G 31 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A U 5 O2 ? ? ? 1_555 A G 31 N1 ? ? A U 5 A G 31 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog14 hydrog ? ? A U 6 O4 ? ? ? 1_555 A C 27 N4 ? ? A U 6 A C 27 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog15 hydrog ? ? A U 7 O4 ? ? ? 1_555 A U 25 N3 ? ? A U 7 A U 25 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 7 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 7 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 8 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 8 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 8 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 9 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 9 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 9 A C 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 27 N3 ? ? A G 10 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 27 O2 ? ? A G 10 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 27 N4 ? ? A G 10 A C 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 11 N6 ? ? ? 1_555 A C 24 N3 ? ? A A 11 A C 24 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog28 hydrog ? ? A A 11 N1 ? ? ? 1_555 A C 27 N4 ? ? A A 11 A C 27 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog29 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 23 N3 ? ? A A 12 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A A 12 N6 ? ? ? 1_555 A U 23 O4 ? ? A A 12 A U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A A 13 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 13 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 13 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 13 A U 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 14 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 14 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 14 A C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 15 A G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 16 O2 ? ? ? 1_555 A G 19 N1 ? ? A U 16 A G 19 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog40 hydrog ? ? A C 24 N3 ? ? ? 1_555 A C 27 N4 ? ? A C 24 A C 27 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog41 hydrog ? ? A U 25 O2 ? ? ? 1_555 A A 30 N6 ? ? A U 25 A A 30 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9HRO _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_nmr_ensemble.entry_id 9HRO _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'target function' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9HRO _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'target function' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '1 mM unlabeled RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' 'unlabeled sample H2O' solution ? 2 '0.5 mM [U-100% 15N] RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' '15N labeled sample H2O' solution ? 3 '0.75 mM [U-13C; U-15N]-Ade,Cyt RNA (35-MER), 0.9 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' 'A,C-13C,15N sample H2O' solution ? 4 '0.75 mM [U-13C; U-15N]-Ade,Cyt RNA (35-MER), 0.9 mM unlabeled TOBRAMYCIN, 100% D2O' '100% D2O' 'A,C-13C,15N sample D2O' solution ? 5 '0.5 mM [U-13C; U-15N]-Ura,Gua RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' 'G.U-13C,15N sample H2O' solution ? 6 '0.5 mM [U-13C; U-15N]-Ura,Gua RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 100% D2O' '100% D2O' 'G.U-13C,15N sample D2O' solution ? 7 '0.84 mM [U-13C; U-15N] RNA (35-MER), 1.004 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' '13C,15N sample H2O' solution ? 8 '0.84 mM [U-13C; U-15N] RNA (35-MER), 1.004 mM unlabeled TOBRAMYCIN, 100% D2O' '100% D2O' '13C,15N sample D2O' solution ? 9 '1 mM [U-100% 2H] RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O' '95% H2O/5% D2O' 'Deuterated short RNA H2O' solution '31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC' 10 '1 mM [U-100% 2H] RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 100% D2O' '100% D2O' 'Deuterated short RNA D2O' solution '31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC' 11 '2.8 mM [U-13C; U-15N]-Ura RNA (35-MER), 2.2 mM unlabeled TOBRAMYCIN, 100% D2O' '100% D2O' 'U-15N,13C short RNA D2O' solution '31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'RNA (35-MER)' 1 ? mM unlabeled 1 TOBRAMYCIN 1.2 ? mM unlabeled 2 'RNA (35-MER)' 0.5 ? mM '[U-100% 15N]' 2 TOBRAMYCIN 0.6 ? mM unlabeled 3 'RNA (35-MER)' 0.75 ? mM '[U-13C; U-15N]-Ade,Cyt' 3 TOBRAMYCIN 0.9 ? mM unlabeled 4 'RNA (35-MER)' 0.75 ? mM '[U-13C; U-15N]-Ade,Cyt' 4 TOBRAMYCIN 0.9 ? mM unlabeled 5 'RNA (35-MER)' 0.5 ? mM '[U-13C; U-15N]-Ura,Gua' 5 TOBRAMYCIN 0.6 ? mM unlabeled 6 'RNA (35-MER)' 0.5 ? mM '[U-13C; U-15N]-Ura,Gua' 6 TOBRAMYCIN 0.6 ? mM unlabeled 7 'RNA (35-MER)' 0.84 ? mM '[U-13C; U-15N]' 7 TOBRAMYCIN 1.004 ? mM unlabeled 8 'RNA (35-MER)' 0.84 ? mM '[U-13C; U-15N]' 8 TOBRAMYCIN 1.004 ? mM unlabeled 9 'RNA (35-MER)' 1 ? mM '[U-100% 2H]' 9 TOBRAMYCIN 1.2 ? mM unlabeled 10 'RNA (35-MER)' 1 ? mM '[U-100% 2H]' 10 TOBRAMYCIN 1.2 ? mM unlabeled 11 'RNA (35-MER)' 2.8 ? mM '[U-13C; U-15N]-Ura' 11 TOBRAMYCIN 2.2 ? mM unlabeled # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 283 bar 1 6.2 85.9 '25 mM Potassium Phosphate, 50 mM Potassium Chloride' 0.5 M 'NMR Buffer 283 K' 0.2 pH 0.01 0.1 K 2 298 bar 1 6.2 85.9 '25 mM Potassium Phosphate, 50 mM Potassium Chloride' 0.5 M 'NMR Buffer 298 K' 0.2 pH 0.01 0.1 K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 6 isotropic 2 1 2 '2D 1H-15N HSQC imino' 1 isotropic 3 1 2 '2D 1H-15N HSQC amino' 6 isotropic 4 1 2 '2D HNN-COSY' 1 isotropic 5 1 2 '2D CPMG-NOESY' 1 isotropic 14 1 2 '3D 1H-15N NOESY amino' 2 isotropic 13 1 2 '2D long-range 1H-15N HSQC' 1 isotropic 17 1 7 '2D 1H-13C HSQC aromatic' 1 isotropic 16 1 5 '2D 1H-13C HSQC aliphatic' 5 isotropic 15 1 3 '2D H5(C5C4N4)H4' 3 isotropic 18 1 5 '2D H1/H8-C5 HMBC' 1 isotropic 37 2 4 '2D H(CC)H-TOCSY' 1 isotropic 19 1 5 '2D H(N)CO' 3 isotropic 20 2 6 '2D H(C)N aromatic' 2 isotropic 21 2 4 '2D H(C)N aromatic' 1 isotropic 22 2 6 '2D H(C)N aliphatic' 2 isotropic 23 2 4 '2D H(C)N aliphatic' 1 isotropic 24 2 6 '3D 1H-13C NOESY-HSQC aro' 5 isotropic 25 2 6 '3D 1H-13C NOESY-HSQC ali' 3 isotropic 26 2 4 '3D 1H-13C NOESY-HSQC ali' 5 isotropic 27 2 6 '3D HCCH-COSY' 3 isotropic 28 2 4 '3D HCCH-COSY' 3 isotropic 29 2 6 '3D HCCH-TOCSY' 3 isotropic 30 2 4 '3D HCCH-TOCSY' 3 isotropic 31 1 7 '2D f1-filtered 1H-1H TOCSY' 1 isotropic 32 2 8 '2D fi1-filtered 1H-1H TOCSY' 6 isotropic 34 1 9 '2D 1H-1H TOCSY' 6 isotropic 35 2 10 '2D 1H-1H TOCSY' 6 isotropic 33 1 7 '2D f1,f2-filtered 1H-1H NOESY' 1 isotropic 36 2 11 '3D HCP' 2 isotropic # _pdbx_nmr_refine.entry_id 9HRO _pdbx_nmr_refine.method 'distance geometry' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 5 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection TopSpin ? 'Bruker Biospin' 2 processing TopSpin ? 'Bruker Biospin' 3 'chemical shift assignment' CARA ? 'Keller and Wuthrich' 4 'peak picking' CARA ? 'Keller and Wuthrich' 5 'structure calculation' CYANA ? 'Guntert, Mumenthaler and Wuthrich' 6 refinement CYANA ? 'Guntert, Mumenthaler and Wuthrich' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 TOY C11 C N R 111 TOY O11 O N N 112 TOY C21 C N R 113 TOY N21 N N N 114 TOY C31 C N N 115 TOY C41 C N S 116 TOY O41 O N N 117 TOY C51 C N R 118 TOY O51 O N N 119 TOY C61 C N N 120 TOY N61 N N N 121 TOY C12 C N R 122 TOY N12 N N N 123 TOY C22 C N N 124 TOY C32 C N S 125 TOY N32 N N N 126 TOY C42 C N R 127 TOY C52 C N S 128 TOY O52 O N N 129 TOY C62 C N S 130 TOY O62 O N N 131 TOY C13 C N S 132 TOY C23 C N R 133 TOY O23 O N N 134 TOY C33 C N S 135 TOY N33 N N N 136 TOY C43 C N S 137 TOY O43 O N N 138 TOY C53 C N R 139 TOY O53 O N N 140 TOY C63 C N N 141 TOY O63 O N N 142 TOY H11 H N N 143 TOY H21 H N N 144 TOY HN21 H N N 145 TOY HN22 H N N 146 TOY H311 H N N 147 TOY H312 H N N 148 TOY H41 H N N 149 TOY H41O H N N 150 TOY H51 H N N 151 TOY H611 H N N 152 TOY H612 H N N 153 TOY HN61 H N N 154 TOY HN62 H N N 155 TOY H12 H N N 156 TOY HN11 H N N 157 TOY HN12 H N N 158 TOY H221 H N N 159 TOY H222 H N N 160 TOY H32 H N N 161 TOY HN1 H N N 162 TOY HN2 H N N 163 TOY H42 H N N 164 TOY H52 H N N 165 TOY H52O H N N 166 TOY H62 H N N 167 TOY H13 H N N 168 TOY H23 H N N 169 TOY H23O H N N 170 TOY H33 H N N 171 TOY HN31 H N N 172 TOY HN32 H N N 173 TOY H43 H N N 174 TOY H43O H N N 175 TOY H53 H N N 176 TOY H631 H N N 177 TOY H632 H N N 178 TOY H63O H N N 179 U OP3 O N N 180 U P P N N 181 U OP1 O N N 182 U OP2 O N N 183 U "O5'" O N N 184 U "C5'" C N N 185 U "C4'" C N R 186 U "O4'" O N N 187 U "C3'" C N S 188 U "O3'" O N N 189 U "C2'" C N R 190 U "O2'" O N N 191 U "C1'" C N R 192 U N1 N N N 193 U C2 C N N 194 U O2 O N N 195 U N3 N N N 196 U C4 C N N 197 U O4 O N N 198 U C5 C N N 199 U C6 C N N 200 U HOP3 H N N 201 U HOP2 H N N 202 U "H5'" H N N 203 U "H5''" H N N 204 U "H4'" H N N 205 U "H3'" H N N 206 U "HO3'" H N N 207 U "H2'" H N N 208 U "HO2'" H N N 209 U "H1'" H N N 210 U H3 H N N 211 U H5 H N N 212 U H6 H N N 213 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 TOY C11 O11 sing N N 116 TOY C11 C21 sing N N 117 TOY C11 O51 sing N N 118 TOY C11 H11 sing N N 119 TOY O11 C42 sing N N 120 TOY C21 N21 sing N N 121 TOY C21 C31 sing N N 122 TOY C21 H21 sing N N 123 TOY N21 HN21 sing N N 124 TOY N21 HN22 sing N N 125 TOY C31 C41 sing N N 126 TOY C31 H311 sing N N 127 TOY C31 H312 sing N N 128 TOY C41 O41 sing N N 129 TOY C41 C51 sing N N 130 TOY C41 H41 sing N N 131 TOY O41 H41O sing N N 132 TOY C51 O51 sing N N 133 TOY C51 C61 sing N N 134 TOY C51 H51 sing N N 135 TOY C61 N61 sing N N 136 TOY C61 H611 sing N N 137 TOY C61 H612 sing N N 138 TOY N61 HN61 sing N N 139 TOY N61 HN62 sing N N 140 TOY C12 N12 sing N N 141 TOY C12 C22 sing N N 142 TOY C12 C62 sing N N 143 TOY C12 H12 sing N N 144 TOY N12 HN11 sing N N 145 TOY N12 HN12 sing N N 146 TOY C22 C32 sing N N 147 TOY C22 H221 sing N N 148 TOY C22 H222 sing N N 149 TOY C32 N32 sing N N 150 TOY C32 C42 sing N N 151 TOY C32 H32 sing N N 152 TOY N32 HN1 sing N N 153 TOY N32 HN2 sing N N 154 TOY C42 C52 sing N N 155 TOY C42 H42 sing N N 156 TOY C52 O52 sing N N 157 TOY C52 C62 sing N N 158 TOY C52 H52 sing N N 159 TOY O52 H52O sing N N 160 TOY C62 O62 sing N N 161 TOY C62 H62 sing N N 162 TOY O62 C13 sing N N 163 TOY C13 C23 sing N N 164 TOY C13 O53 sing N N 165 TOY C13 H13 sing N N 166 TOY C23 O23 sing N N 167 TOY C23 C33 sing N N 168 TOY C23 H23 sing N N 169 TOY O23 H23O sing N N 170 TOY C33 N33 sing N N 171 TOY C33 C43 sing N N 172 TOY C33 H33 sing N N 173 TOY N33 HN31 sing N N 174 TOY N33 HN32 sing N N 175 TOY C43 O43 sing N N 176 TOY C43 C53 sing N N 177 TOY C43 H43 sing N N 178 TOY O43 H43O sing N N 179 TOY C53 O53 sing N N 180 TOY C53 C63 sing N N 181 TOY C53 H53 sing N N 182 TOY C63 O63 sing N N 183 TOY C63 H631 sing N N 184 TOY C63 H632 sing N N 185 TOY O63 H63O sing N N 186 U OP3 P sing N N 187 U OP3 HOP3 sing N N 188 U P OP1 doub N N 189 U P OP2 sing N N 190 U P "O5'" sing N N 191 U OP2 HOP2 sing N N 192 U "O5'" "C5'" sing N N 193 U "C5'" "C4'" sing N N 194 U "C5'" "H5'" sing N N 195 U "C5'" "H5''" sing N N 196 U "C4'" "O4'" sing N N 197 U "C4'" "C3'" sing N N 198 U "C4'" "H4'" sing N N 199 U "O4'" "C1'" sing N N 200 U "C3'" "O3'" sing N N 201 U "C3'" "C2'" sing N N 202 U "C3'" "H3'" sing N N 203 U "O3'" "HO3'" sing N N 204 U "C2'" "O2'" sing N N 205 U "C2'" "C1'" sing N N 206 U "C2'" "H2'" sing N N 207 U "O2'" "HO2'" sing N N 208 U "C1'" N1 sing N N 209 U "C1'" "H1'" sing N N 210 U N1 C2 sing N N 211 U N1 C6 sing N N 212 U C2 O2 doub N N 213 U C2 N3 sing N N 214 U N3 C4 sing N N 215 U N3 H3 sing N N 216 U C4 O4 doub N N 217 U C4 C5 sing N N 218 U C5 C6 doub N N 219 U C5 H5 sing N N 220 U C6 H6 sing N N 221 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9HRO 'double helix' 9HRO 'a-form double helix' 9HRO tetraloop 9HRO 'bulge loop' 9HRO 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 35 1_555 -0.756 -0.344 0.360 -9.246 -19.663 -4.361 1 A_G1:C35_A A 1 ? A 35 ? 19 1 1 A G 2 1_555 A C 34 1_555 -0.440 -0.243 0.344 -7.518 -23.998 -4.148 2 A_G2:C34_A A 2 ? A 34 ? 19 1 1 A U 3 1_555 A A 33 1_555 0.278 -0.217 0.659 -7.010 -18.392 -8.044 3 A_U3:A33_A A 3 ? A 33 ? 20 1 1 A G 4 1_555 A C 32 1_555 0.338 -0.174 0.583 -5.010 -17.561 -4.959 4 A_G4:C32_A A 4 ? A 32 ? 19 1 1 A U 5 1_555 A G 31 1_555 2.216 -0.433 0.256 -6.222 -11.893 -5.753 5 A_U5:G31_A A 5 ? A 31 ? 28 1 1 A U 7 1_555 A A 30 1_555 -0.831 -0.138 -0.623 -0.517 8.605 -8.693 6 A_U7:A30_A A 7 ? A 30 ? 20 1 1 A C 8 1_555 A G 29 1_555 -0.527 -0.114 0.692 -7.044 -6.720 -4.565 7 A_C8:G29_A A 8 ? A 29 ? 19 1 1 A G 9 1_555 A C 28 1_555 0.434 -0.043 0.064 -0.356 -10.524 -2.278 8 A_G9:C28_A A 9 ? A 28 ? 19 1 1 A G 10 1_555 A C 27 1_555 -0.041 -0.042 -1.149 -29.966 -17.345 1.657 9 A_G10:C27_A A 10 ? A 27 ? 19 1 1 A A 11 1_555 A C 24 1_555 -1.752 -0.392 0.453 -11.338 -3.122 -1.236 10 A_A11:C24_A A 11 ? A 24 ? ? 1 1 A A 12 1_555 A U 23 1_555 -0.320 -0.167 0.695 9.660 -16.424 -8.377 11 A_A12:U23_A A 12 ? A 23 ? 20 1 1 A A 13 1_555 A U 22 1_555 -0.290 -0.053 0.351 22.476 -27.930 -6.985 12 A_A13:U22_A A 13 ? A 22 ? 20 1 1 A G 14 1_555 A C 21 1_555 -0.420 -0.224 0.755 21.143 -11.078 -5.135 13 A_G14:C21_A A 14 ? A 21 ? 19 1 1 A C 15 1_555 A G 20 1_555 0.838 -0.306 -0.771 17.902 -9.410 -1.553 14 A_C15:G20_A A 15 ? A 20 ? 19 1 1 A U 16 1_555 A G 19 1_555 0.352 -5.647 0.176 -3.557 5.948 -114.416 15 A_U16:G19_A A 16 ? A 19 ? ? 6 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 35 1_555 A G 2 1_555 A C 34 1_555 -0.240 -2.092 2.980 -2.220 8.404 33.691 -4.578 0.118 2.415 14.208 3.753 34.763 1 AA_G1G2:C34C35_AA A 1 ? A 35 ? A 2 ? A 34 ? 1 A G 2 1_555 A C 34 1_555 A U 3 1_555 A A 33 1_555 -0.018 -1.998 3.031 -0.707 -2.514 38.311 -2.741 -0.057 3.151 -3.825 1.076 38.397 2 AA_G2U3:A33C34_AA A 2 ? A 34 ? A 3 ? A 33 ? 1 A U 3 1_555 A A 33 1_555 A G 4 1_555 A C 32 1_555 0.312 -2.057 3.058 2.181 0.596 35.370 -3.461 -0.214 3.037 0.979 -3.585 35.440 3 AA_U3G4:C32A33_AA A 3 ? A 33 ? A 4 ? A 32 ? 1 A G 4 1_555 A C 32 1_555 A U 5 1_555 A G 31 1_555 0.185 -2.108 3.233 5.928 3.317 40.530 -3.353 0.360 3.055 4.747 -8.485 41.072 4 AA_G4U5:G31C32_AA A 4 ? A 32 ? A 5 ? A 31 ? 1 A U 5 1_555 A G 31 1_555 A U 7 1_555 A A 30 1_555 -2.711 -2.168 3.642 4.879 -8.451 36.861 -2.105 4.857 3.658 -13.086 -7.554 38.087 5 AA_U5U7:A30G31_AA A 5 ? A 31 ? A 7 ? A 30 ? 1 A U 7 1_555 A A 30 1_555 A C 8 1_555 A G 29 1_555 0.315 -2.637 3.889 -4.232 -0.194 29.989 -5.002 -1.616 3.826 -0.372 8.127 30.280 6 AA_U7C8:G29A30_AA A 7 ? A 30 ? A 8 ? A 29 ? 1 A C 8 1_555 A G 29 1_555 A G 9 1_555 A C 28 1_555 -0.114 -1.993 2.940 2.011 3.979 32.525 -4.115 0.500 2.672 7.062 -3.570 32.821 7 AA_C8G9:C28G29_AA A 8 ? A 29 ? A 9 ? A 28 ? 1 A G 9 1_555 A C 28 1_555 A G 10 1_555 A C 27 1_555 1.104 -1.307 4.248 8.219 39.798 39.286 -4.174 -0.603 2.308 46.778 -9.660 55.938 8 AA_G9G10:C27C28_AA A 9 ? A 28 ? A 10 ? A 27 ? 1 A G 10 1_555 A C 27 1_555 A A 11 1_555 A C 24 1_555 1.684 -1.046 2.502 -8.669 6.006 35.438 -2.204 -3.457 1.857 9.607 13.867 36.926 9 AA_G10A11:C24C27_AA A 10 ? A 27 ? A 11 ? A 24 ? 1 A A 11 1_555 A C 24 1_555 A A 12 1_555 A U 23 1_555 -0.415 -2.015 3.275 -0.400 -15.278 32.664 -0.779 0.607 3.820 -25.498 0.667 35.975 10 AA_A11A12:U23C24_AA A 11 ? A 24 ? A 12 ? A 23 ? 1 A A 12 1_555 A U 23 1_555 A A 13 1_555 A U 22 1_555 -0.124 -1.594 2.816 2.485 6.223 36.041 -3.236 0.477 2.502 9.952 -3.974 36.639 11 AA_A12A13:U22U23_AA A 12 ? A 23 ? A 13 ? A 22 ? 1 A A 13 1_555 A U 22 1_555 A G 14 1_555 A C 21 1_555 -0.225 -1.659 2.967 -7.279 11.106 35.258 -3.791 -0.448 2.356 17.584 11.525 37.601 12 AA_A13G14:C21U22_AA A 13 ? A 22 ? A 14 ? A 21 ? 1 A G 14 1_555 A C 21 1_555 A C 15 1_555 A G 20 1_555 0.298 -2.151 3.586 2.980 -2.448 34.616 -3.177 0.011 3.736 -4.098 -4.990 34.823 13 AA_G14C15:G20C21_AA A 14 ? A 21 ? A 15 ? A 20 ? 1 A C 15 1_555 A G 20 1_555 A U 16 1_555 A G 19 1_555 -1.832 -1.675 4.063 10.902 12.885 104.009 -1.271 1.337 3.756 8.139 -6.887 104.975 14 AA_C15U16:G19G20_AA A 15 ? A 20 ? A 16 ? A 19 ? # _pdbx_audit_support.funding_organization 'German Research Foundation (DFG)' _pdbx_audit_support.country Germany _pdbx_audit_support.grant_number SFB902-B17 _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE NEO' ? Bruker 600 '5 mm TCI cryo 1H,15N,13C probe' 2 'AVANCE III HD' ? Bruker 700 '5 mm QCI cryo 1H,15N,13C, 31P probe' 3 'AVANCE III HD' ? Bruker 800 '5 mm TCI cryo 1H,15N,13C probe' 4 'AVANCE NEO' ? Bruker 900 '5 mm TCI cryo 1H,15N,13C probe' 5 'AVANCE III' ? Bruker 950 '5 mm TCI cryo 1H,15N,13C probe' 6 'AVANCE II' ? Bruker 600 '5 mm TCI cryo 1H,15N,13C probe' # _atom_sites.entry_id 9HRO _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #