data_9I8B # _entry.id 9I8B # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.406 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9I8B pdb_00009i8b 10.2210/pdb9i8b/pdb WWPDB D_1292145270 ? ? BMRB 52888 ? 10.13018/BMR52888 # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-03-12 ? 2 'Structure model' 1 1 2025-09-24 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_ASTM' 4 2 'Structure model' '_citation.journal_id_CSD' 5 2 'Structure model' '_citation.journal_id_ISSN' 6 2 'Structure model' '_citation.journal_volume' 7 2 'Structure model' '_citation.pdbx_database_id_DOI' 8 2 'Structure model' '_citation.pdbx_database_id_PubMed' 9 2 'Structure model' '_citation.title' 10 2 'Structure model' '_citation.year' 11 2 'Structure model' '_citation_author.identifier_ORCID' 12 2 'Structure model' '_citation_author.name' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9I8B _pdbx_database_status.recvd_initial_deposition_date 2025-02-04 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type BMRB . 52888 unspecified SASBDB . SASDWM5 'associated SAS data' # _pdbx_contact_author.id 2 _pdbx_contact_author.email michael.sattler@helmholtz-munich.de _pdbx_contact_author.name_first Michael _pdbx_contact_author.name_last Sattler _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-1594-0527 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Mueller-Hermes, C.' 1 ? 'Sattler, M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Unique conformational dynamics and protein recognition of A-to-I hyper-edited dsRNA.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf550 _citation.pdbx_database_id_PubMed 40568935 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Muller-Hermes, C.' 1 ? primary 'Piomponi, V.' 2 ? primary 'Hilber, S.' 3 ? primary 'Asami, S.' 4 ? primary 'Kreutz, C.' 5 0000-0002-7018-9326 primary 'Bussi, G.' 6 0000-0001-9216-5782 primary 'Sattler, M.' 7 0000-0002-1594-0527 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*AP*CP*UP*GP*GP*AP*CP*AP*AP*AP*UP*AP*CP*UP*CP*CP*GP*AP*GP*G)-3') ; 6429.919 1 ? ? ? ? 2 polymer syn ;RNA (5'-R(*CP*CP*UP*CP*GP*GP*AP*GP*UP*AP*UP*UP*UP*GP*UP*CP*CP*AP*GP*U)-3') ; 6337.759 1 ? ? ? ? # loop_ _entity_poly.entity_id _entity_poly.type _entity_poly.nstd_linkage _entity_poly.nstd_monomer _entity_poly.pdbx_seq_one_letter_code _entity_poly.pdbx_seq_one_letter_code_can _entity_poly.pdbx_strand_id _entity_poly.pdbx_target_identifier 1 polyribonucleotide no no ACUGGACAAAUACUCCGAGG ACUGGACAAAUACUCCGAGG A ? 2 polyribonucleotide no no CCUCGGAGUAUUUGUCCAGU CCUCGGAGUAUUUGUCCAGU B ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 A n 1 2 C n 1 3 U n 1 4 G n 1 5 G n 1 6 A n 1 7 C n 1 8 A n 1 9 A n 1 10 A n 1 11 U n 1 12 A n 1 13 C n 1 14 U n 1 15 C n 1 16 C n 1 17 G n 1 18 A n 1 19 G n 1 20 G n 2 1 C n 2 2 C n 2 3 U n 2 4 C n 2 5 G n 2 6 G n 2 7 A n 2 8 G n 2 9 U n 2 10 A n 2 11 U n 2 12 U n 2 13 U n 2 14 G n 2 15 U n 2 16 C n 2 17 C n 2 18 A n 2 19 G n 2 20 U n # loop_ _pdbx_entity_src_syn.entity_id _pdbx_entity_src_syn.pdbx_src_id _pdbx_entity_src_syn.pdbx_alt_source_flag _pdbx_entity_src_syn.pdbx_beg_seq_num _pdbx_entity_src_syn.pdbx_end_seq_num _pdbx_entity_src_syn.organism_scientific _pdbx_entity_src_syn.organism_common_name _pdbx_entity_src_syn.ncbi_taxonomy_id _pdbx_entity_src_syn.details 1 1 sample 1 20 'Rattus norvegicus' ? 10116 ? 2 1 sample 1 20 'Rattus norvegicus' ? 10116 ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 A 1 1 1 A A A . n A 1 2 C 2 2 2 C C A . n A 1 3 U 3 3 3 U U A . n A 1 4 G 4 4 4 G G A . n A 1 5 G 5 5 5 G G A . n A 1 6 A 6 6 6 A A A . n A 1 7 C 7 7 7 C C A . n A 1 8 A 8 8 8 A A A . n A 1 9 A 9 9 9 A A A . n A 1 10 A 10 10 10 A A A . n A 1 11 U 11 11 11 U U A . n A 1 12 A 12 12 12 A A A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 C 16 16 16 C C A . n A 1 17 G 17 17 17 G G A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 G 20 20 20 G G A . n B 2 1 C 1 21 21 C C B . n B 2 2 C 2 22 22 C C B . n B 2 3 U 3 23 23 U U B . n B 2 4 C 4 24 24 C C B . n B 2 5 G 5 25 25 G G B . n B 2 6 G 6 26 26 G G B . n B 2 7 A 7 27 27 A A B . n B 2 8 G 8 28 28 G G B . n B 2 9 U 9 29 29 U U B . n B 2 10 A 10 30 30 A A B . n B 2 11 U 11 31 31 U U B . n B 2 12 U 12 32 32 U U B . n B 2 13 U 13 33 33 U U B . n B 2 14 G 14 34 34 G G B . n B 2 15 U 15 35 35 U U B . n B 2 16 C 16 36 36 C C B . n B 2 17 C 17 37 37 C C B . n B 2 18 A 18 38 38 A A B . n B 2 19 G 19 39 39 G G B . n B 2 20 U 20 40 40 U U B . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9I8B _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9I8B _struct.title 'NMR-based model of an A-form 20mer dsRNA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9I8B _struct_keywords.text 'A-form, Duplex, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # loop_ _struct_ref.id _struct_ref.db_name _struct_ref.db_code _struct_ref.pdbx_db_accession _struct_ref.pdbx_db_isoform _struct_ref.entity_id _struct_ref.pdbx_seq_one_letter_code _struct_ref.pdbx_align_begin 1 PDB 9I8B 9I8B ? 1 ? 1 2 PDB 9I8B 9I8B ? 2 ? 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 9I8B A 1 ? 20 ? 9I8B 1 ? 20 ? 1 20 2 2 9I8B B 1 ? 20 ? 9I8B 21 ? 40 ? 21 40 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A A 1 N1 ? ? ? 1_555 B U 20 N3 ? ? A A 1 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A A 1 N6 ? ? ? 1_555 B U 20 O4 ? ? A A 1 B U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 2 N3 ? ? ? 1_555 B G 19 N1 ? ? A C 2 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 2 N4 ? ? ? 1_555 B G 19 O6 ? ? A C 2 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 2 O2 ? ? ? 1_555 B G 19 N2 ? ? A C 2 B G 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 3 N3 ? ? ? 1_555 B A 18 N1 ? ? A U 3 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 3 O4 ? ? ? 1_555 B A 18 N6 ? ? A U 3 B A 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 17 N3 ? ? A G 4 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 17 O2 ? ? A G 4 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 17 N4 ? ? A G 4 B C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 16 N3 ? ? A G 5 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 16 O2 ? ? A G 5 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 16 N4 ? ? A G 5 B C 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A A 6 N1 ? ? ? 1_555 B U 15 N3 ? ? A A 6 B U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N6 ? ? ? 1_555 B U 15 O4 ? ? A A 6 B U 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N3 ? ? ? 1_555 B G 14 N1 ? ? A C 7 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N4 ? ? ? 1_555 B G 14 O6 ? ? A C 7 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 O2 ? ? ? 1_555 B G 14 N2 ? ? A C 7 B G 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 8 N1 ? ? ? 1_555 B U 13 N3 ? ? A A 8 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 8 N6 ? ? ? 1_555 B U 13 O4 ? ? A A 8 B U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 9 N1 ? ? ? 1_555 B U 12 N3 ? ? A A 9 B U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 9 N6 ? ? ? 1_555 B U 12 O4 ? ? A A 9 B U 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 10 N1 ? ? ? 1_555 B U 11 N3 ? ? A A 10 B U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 10 N6 ? ? ? 1_555 B U 11 O4 ? ? A A 10 B U 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 11 N3 ? ? ? 1_555 B A 10 N1 ? ? A U 11 B A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 11 O4 ? ? ? 1_555 B A 10 N6 ? ? A U 11 B A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 12 N1 ? ? ? 1_555 B U 9 N3 ? ? A A 12 B U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 12 N6 ? ? ? 1_555 B U 9 O4 ? ? A A 12 B U 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N3 ? ? ? 1_555 B G 8 N1 ? ? A C 13 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N4 ? ? ? 1_555 B G 8 O6 ? ? A C 13 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 O2 ? ? ? 1_555 B G 8 N2 ? ? A C 13 B G 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 N3 ? ? ? 1_555 B A 7 N1 ? ? A U 14 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 14 O4 ? ? ? 1_555 B A 7 N6 ? ? A U 14 B A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N3 ? ? ? 1_555 B G 6 N1 ? ? A C 15 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 N4 ? ? ? 1_555 B G 6 O6 ? ? A C 15 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 15 O2 ? ? ? 1_555 B G 6 N2 ? ? A C 15 B G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 16 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 16 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 16 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 16 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 16 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 16 B G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 17 N1 ? ? ? 1_555 B C 4 N3 ? ? A G 17 B C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 17 N2 ? ? ? 1_555 B C 4 O2 ? ? A G 17 B C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 17 O6 ? ? ? 1_555 B C 4 N4 ? ? A G 17 B C 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 18 N1 ? ? ? 1_555 B U 3 N3 ? ? A A 18 B U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 18 N6 ? ? ? 1_555 B U 3 O4 ? ? A A 18 B U 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 19 N1 ? ? ? 1_555 B C 2 N3 ? ? A G 19 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 19 N2 ? ? ? 1_555 B C 2 O2 ? ? A G 19 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 19 O6 ? ? ? 1_555 B C 2 N4 ? ? A G 19 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 20 N1 ? ? ? 1_555 B C 1 N3 ? ? A G 20 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 20 N2 ? ? ? 1_555 B C 1 O2 ? ? A G 20 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 20 O6 ? ? ? 1_555 B C 1 N4 ? ? A G 20 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9I8B _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # _pdbx_nmr_ensemble.entry_id 9I8B _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9I8B _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '500 uM ARNA_TS, 500 uM ARNA_BS, 25 mM sodium phosphate, 25 mM sodium chloride, 100% D2O' _pdbx_nmr_sample_details.solvent_system '100% D2O' _pdbx_nmr_sample_details.label ARNA _pdbx_nmr_sample_details.type solution _pdbx_nmr_sample_details.details ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 ARNA_TS 500 ? uM 'natural abundance' 1 ARNA_BS 500 ? uM 'natural abundance' 1 'sodium phosphate' 25 ? mM 'natural abundance' 1 'sodium chloride' 25 ? mM 'natural abundance' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 6.4 _pdbx_nmr_exptl_sample_conditions.ionic_strength 60 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label non-exchanging _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # _pdbx_nmr_exptl.experiment_id 1 _pdbx_nmr_exptl.conditions_id 1 _pdbx_nmr_exptl.solution_id 1 _pdbx_nmr_exptl.type '2D NOESY' _pdbx_nmr_exptl.spectrometer_id 1 _pdbx_nmr_exptl.sample_state isotropic # _pdbx_nmr_refine.entry_id 9I8B _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 processing TopSpin 3.7.0 'Bruker Biospin' 5 'chemical shift assignment' 'CcpNmr Analysis' 2.4.2 CCPN 2 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _ndb_struct_conf_na.entry_id 9I8B _ndb_struct_conf_na.feature 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A A 1 1_555 B U 20 1_555 -0.372 -0.210 0.176 3.142 -7.244 -1.401 1 A_A1:U40_B A 1 ? B 40 ? 20 1 1 A C 2 1_555 B G 19 1_555 0.692 -0.284 0.164 1.913 -17.844 3.637 2 A_C2:G39_B A 2 ? B 39 ? 19 1 1 A U 3 1_555 B A 18 1_555 0.398 -0.059 0.153 -4.791 -8.740 0.499 3 A_U3:A38_B A 3 ? B 38 ? 20 1 1 A G 4 1_555 B C 17 1_555 0.052 0.025 -0.153 -6.754 -4.338 3.544 4 A_G4:C37_B A 4 ? B 37 ? 19 1 1 A G 5 1_555 B C 16 1_555 0.083 0.037 -0.140 -6.109 -5.100 2.863 5 A_G5:C36_B A 5 ? B 36 ? 19 1 1 A A 6 1_555 B U 15 1_555 -0.009 -0.223 0.079 -3.180 -12.778 -5.222 6 A_A6:U35_B A 6 ? B 35 ? 20 1 1 A C 7 1_555 B G 14 1_555 0.302 -0.081 0.040 0.848 -11.046 3.784 7 A_C7:G34_B A 7 ? B 34 ? 19 1 1 A A 8 1_555 B U 13 1_555 -0.173 -0.089 0.057 -2.733 -5.349 -1.723 8 A_A8:U33_B A 8 ? B 33 ? 20 1 1 A A 9 1_555 B U 12 1_555 -0.268 -0.262 0.196 -1.222 -10.523 -1.501 9 A_A9:U32_B A 9 ? B 32 ? 20 1 1 A A 10 1_555 B U 11 1_555 -0.217 -0.281 0.331 -5.717 -15.459 0.182 10 A_A10:U31_B A 10 ? B 31 ? 20 1 1 A U 11 1_555 B A 10 1_555 0.672 -0.273 0.302 -3.426 -11.430 0.374 11 A_U11:A30_B A 11 ? B 30 ? 20 1 1 A A 12 1_555 B U 9 1_555 0.087 -0.182 0.178 -2.736 -6.195 -0.677 12 A_A12:U29_B A 12 ? B 29 ? 20 1 1 A C 13 1_555 B G 8 1_555 0.515 -0.118 0.081 3.081 -13.159 2.666 13 A_C13:G28_B A 13 ? B 28 ? 19 1 1 A U 14 1_555 B A 7 1_555 0.239 -0.218 0.027 0.897 -10.803 0.286 14 A_U14:A27_B A 14 ? B 27 ? 20 1 1 A C 15 1_555 B G 6 1_555 0.162 -0.037 -0.116 4.359 -6.362 4.391 15 A_C15:G26_B A 15 ? B 26 ? 19 1 1 A C 16 1_555 B G 5 1_555 0.330 -0.060 -0.104 2.952 -7.518 4.387 16 A_C16:G25_B A 16 ? B 25 ? 19 1 1 A G 17 1_555 B C 4 1_555 -0.254 -0.043 -0.105 -1.030 -6.252 4.617 17 A_G17:C24_B A 17 ? B 24 ? 19 1 1 A A 18 1_555 B U 3 1_555 -0.274 -0.211 0.035 -1.845 -10.206 -0.077 18 A_A18:U23_B A 18 ? B 23 ? 20 1 1 A G 19 1_555 B C 2 1_555 -0.204 -0.077 0.036 -5.043 -14.665 4.383 19 A_G19:C22_B A 19 ? B 22 ? 19 1 1 A G 20 1_555 B C 1 1_555 0.307 0.045 0.138 -11.602 -6.336 3.622 20 A_G20:C21_B A 20 ? B 21 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A A 1 1_555 B U 20 1_555 A C 2 1_555 B G 19 1_555 0.443 -1.427 3.192 1.284 3.113 39.136 -2.479 -0.513 3.086 4.637 -1.913 39.275 1 AA_A1C2:G39U40_BB A 1 ? B 40 ? A 2 ? B 39 ? 1 A C 2 1_555 B G 19 1_555 A U 3 1_555 B A 18 1_555 -0.067 -1.660 3.309 1.492 4.894 32.313 -3.772 0.371 3.025 8.724 -2.661 32.705 2 AA_C2U3:A38G39_BB A 2 ? B 39 ? A 3 ? B 38 ? 1 A U 3 1_555 B A 18 1_555 A G 4 1_555 B C 17 1_555 0.162 -1.627 3.270 2.199 6.622 29.305 -4.416 0.115 2.846 12.860 -4.270 30.107 3 AA_U3G4:C37A38_BB A 3 ? B 38 ? A 4 ? B 37 ? 1 A G 4 1_555 B C 17 1_555 A G 5 1_555 B C 16 1_555 0.211 -1.788 3.236 0.341 3.076 30.489 -3.968 -0.334 3.048 5.830 -0.646 30.642 4 AA_G4G5:C36C37_BB A 4 ? B 37 ? A 5 ? B 36 ? 1 A G 5 1_555 B C 16 1_555 A A 6 1_555 B U 15 1_555 -0.338 -1.666 3.229 -0.847 -2.554 31.040 -2.611 0.467 3.359 -4.761 1.578 31.153 5 AA_G5A6:U35C36_BB A 5 ? B 36 ? A 6 ? B 35 ? 1 A A 6 1_555 B U 15 1_555 A C 7 1_555 B G 14 1_555 0.437 -1.566 3.283 0.494 -6.513 33.128 -1.588 -0.668 3.524 -11.286 -0.856 33.748 6 AA_A6C7:G34U35_BB A 6 ? B 35 ? A 7 ? B 34 ? 1 A C 7 1_555 B G 14 1_555 A A 8 1_555 B U 13 1_555 -0.227 -1.653 3.310 -0.737 6.204 29.743 -4.354 0.292 2.917 11.921 1.417 30.378 7 AA_C7A8:U33G34_BB A 7 ? B 34 ? A 8 ? B 33 ? 1 A A 8 1_555 B U 13 1_555 A A 9 1_555 B U 12 1_555 0.036 -1.693 3.289 -1.701 -1.230 29.358 -3.066 -0.440 3.348 -2.424 3.351 29.432 8 AA_A8A9:U32U33_BB A 8 ? B 33 ? A 9 ? B 32 ? 1 A A 9 1_555 B U 12 1_555 A A 10 1_555 B U 11 1_555 0.150 -1.621 3.310 -1.252 3.804 34.157 -3.326 -0.447 3.109 6.449 2.122 34.384 9 AA_A9A10:U31U32_BB A 9 ? B 32 ? A 10 ? B 31 ? 1 A A 10 1_555 B U 11 1_555 A U 11 1_555 B A 10 1_555 0.021 -1.572 3.212 0.764 -2.560 36.590 -2.148 0.071 3.311 -4.071 -1.214 36.684 10 AA_A10U11:A30U31_BB A 10 ? B 31 ? A 11 ? B 30 ? 1 A U 11 1_555 B A 10 1_555 A A 12 1_555 B U 9 1_555 -0.021 -1.580 3.166 1.551 6.595 28.910 -4.355 0.340 2.741 12.986 -3.053 29.677 11 AA_U11A12:U29A30_BB A 11 ? B 30 ? A 12 ? B 29 ? 1 A A 12 1_555 B U 9 1_555 A C 13 1_555 B G 8 1_555 0.371 -1.546 3.223 2.219 -3.696 32.418 -2.097 -0.269 3.390 -6.583 -3.954 32.696 12 AA_A12C13:G28U29_BB A 12 ? B 29 ? A 13 ? B 28 ? 1 A C 13 1_555 B G 8 1_555 A U 14 1_555 B A 7 1_555 -0.193 -1.613 3.251 0.994 4.571 30.840 -3.834 0.541 2.979 8.533 -1.856 31.184 13 AA_C13U14:A27G28_BB A 13 ? B 28 ? A 14 ? B 27 ? 1 A U 14 1_555 B A 7 1_555 A C 15 1_555 B G 6 1_555 0.222 -1.602 3.146 1.379 2.706 30.542 -3.529 -0.164 3.003 5.121 -2.610 30.689 14 AA_U14C15:G26A27_BB A 14 ? B 27 ? A 15 ? B 26 ? 1 A C 15 1_555 B G 6 1_555 A C 16 1_555 B G 5 1_555 -0.072 -1.662 3.242 0.804 6.668 31.218 -4.160 0.268 2.832 12.213 -1.473 31.915 15 AA_C15C16:G25G26_BB A 15 ? B 26 ? A 16 ? B 25 ? 1 A C 16 1_555 B G 5 1_555 A G 17 1_555 B C 4 1_555 -0.056 -1.738 3.231 -0.149 9.783 27.919 -5.278 0.082 2.492 19.531 0.298 29.552 16 AA_C16G17:C24G25_BB A 16 ? B 25 ? A 17 ? B 24 ? 1 A G 17 1_555 B C 4 1_555 A A 18 1_555 B U 3 1_555 -0.232 -1.596 3.238 -1.792 6.005 30.857 -4.004 0.110 2.892 11.141 3.324 31.472 17 AA_G17A18:U23C24_BB A 17 ? B 24 ? A 18 ? B 23 ? 1 A A 18 1_555 B U 3 1_555 A G 19 1_555 B C 2 1_555 0.234 -1.624 3.217 -0.002 4.727 33.014 -3.577 -0.407 2.963 8.265 0.003 33.341 18 AA_A18G19:C22U23_BB A 18 ? B 23 ? A 19 ? B 22 ? 1 A G 19 1_555 B C 2 1_555 A G 20 1_555 B C 1 1_555 0.149 -1.684 3.325 -0.924 6.664 34.830 -3.714 -0.377 2.957 11.006 1.525 35.454 19 AA_G19G20:C21C22_BB A 19 ? B 22 ? A 20 ? B 21 ? # _pdbx_audit_support.funding_organization 'German Research Foundation (DFG)' _pdbx_audit_support.country Germany _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'AVANCE III' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 950 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 9I8B _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #