data_9J6P
#
_entry.id 9J6P
#
_audit_conform.dict_name mmcif_pdbx.dic
_audit_conform.dict_version 5.399
_audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic
#
loop_
_database_2.database_id
_database_2.database_code
_database_2.pdbx_database_accession
_database_2.pdbx_DOI
PDB 9J6P pdb_00009j6p 10.2210/pdb9j6p/pdb
WWPDB D_1300050452 ? ?
#
_pdbx_audit_revision_history.ordinal 1
_pdbx_audit_revision_history.data_content_type 'Structure model'
_pdbx_audit_revision_history.major_revision 1
_pdbx_audit_revision_history.minor_revision 0
_pdbx_audit_revision_history.revision_date 2025-01-15
#
_pdbx_audit_revision_details.ordinal 1
_pdbx_audit_revision_details.revision_ordinal 1
_pdbx_audit_revision_details.data_content_type 'Structure model'
_pdbx_audit_revision_details.provider repository
_pdbx_audit_revision_details.type 'Initial release'
_pdbx_audit_revision_details.description ?
_pdbx_audit_revision_details.details ?
#
_pdbx_database_status.status_code REL
_pdbx_database_status.status_code_sf REL
_pdbx_database_status.status_code_mr ?
_pdbx_database_status.entry_id 9J6P
_pdbx_database_status.recvd_initial_deposition_date 2024-08-16
_pdbx_database_status.SG_entry N
_pdbx_database_status.deposit_site PDBJ
_pdbx_database_status.process_site PDBJ
_pdbx_database_status.status_code_cs ?
_pdbx_database_status.status_code_nmr_data ?
_pdbx_database_status.methods_development_category ?
_pdbx_database_status.pdb_format_compatible N
#
_pdbx_contact_author.id 2
_pdbx_contact_author.email j.kondo@sophia.ac.jp
_pdbx_contact_author.name_first Jiro
_pdbx_contact_author.name_last Kondo
_pdbx_contact_author.name_mi ?
_pdbx_contact_author.role 'principal investigator/group leader'
_pdbx_contact_author.identifier_ORCID 0000-0002-5682-3685
#
loop_
_audit_author.name
_audit_author.pdbx_ordinal
_audit_author.identifier_ORCID
'Kondo, J.' 1 0000-0002-5682-3685
'Nagasawa, R.' 2 ?
'Onizuka, K.' 3 ?
'Kawamura, K.' 4 ?
'Tsuzuki, K.' 5 ?
'Murase, H.' 6 ?
'Komatsu, K.R.' 7 ?
'Miyashita, E.' 8 ?
'Saito, H.' 9 ?
'Nagatsugi, F.' 10 ?
#
_citation.abstract ?
_citation.abstract_id_CAS ?
_citation.book_id_ISBN ?
_citation.book_publisher ?
_citation.book_publisher_city ?
_citation.book_title ?
_citation.coordinate_linkage ?
_citation.country ?
_citation.database_id_Medline ?
_citation.details ?
_citation.id primary
_citation.journal_abbrev 'To Be Published'
_citation.journal_id_ASTM ?
_citation.journal_id_CSD 0353
_citation.journal_id_ISSN ?
_citation.journal_full ?
_citation.journal_issue ?
_citation.journal_volume ?
_citation.language ?
_citation.page_first ?
_citation.page_last ?
_citation.title 'pre-mir-125a internal loop in complex with G-clamp'
_citation.year ?
_citation.database_id_CSD ?
_citation.pdbx_database_id_DOI ?
_citation.pdbx_database_id_PubMed ?
_citation.pdbx_database_id_patent ?
_citation.unpublished_flag ?
#
loop_
_citation_author.citation_id
_citation_author.name
_citation_author.ordinal
_citation_author.identifier_ORCID
primary 'Nagasawa, R.' 1 ?
primary 'Onizuka, K.' 2 ?
primary 'Kawamura, K.' 3 ?
primary 'Tsuzuki, K.' 4 ?
primary 'Murase, H.' 5 ?
primary 'Komatsu, K.R.' 6 ?
primary 'Miyashita, E.' 7 ?
primary 'Saito, H.' 8 ?
primary 'Kondo, J.' 9 0000-0002-5682-3685
primary 'Nagatsugi, F.' 10 ?
#
loop_
_entity.id
_entity.type
_entity.src_method
_entity.pdbx_description
_entity.formula_weight
_entity.pdbx_number_of_molecules
_entity.pdbx_ec
_entity.pdbx_mutation
_entity.pdbx_fragment
_entity.details
1 polymer syn
;RNA (5'-R(P*UP*GP*CP*GP*GP*GP*GP*UP*CP*CP*CP*GP*GP*GP*AP*GP*GP*AP*CP*CP*GP*C)-3')
;
7159.323 2 ? ? ? ?
2 non-polymer syn
;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide
;
492.525 2 ? ? ? ?
3 water nat water 18.015 13 ? ? ? ?
#
_entity_poly.entity_id 1
_entity_poly.type polyribonucleotide
_entity_poly.nstd_linkage no
_entity_poly.nstd_monomer no
_entity_poly.pdbx_seq_one_letter_code UGCGGGGUCCCGGGAGGACCGC
_entity_poly.pdbx_seq_one_letter_code_can UGCGGGGUCCCGGGAGGACCGC
_entity_poly.pdbx_strand_id A,B
_entity_poly.pdbx_target_identifier ?
#
loop_
_pdbx_entity_nonpoly.entity_id
_pdbx_entity_nonpoly.name
_pdbx_entity_nonpoly.comp_id
2
;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide
;
A1L3Y
3 water HOH
#
loop_
_entity_poly_seq.entity_id
_entity_poly_seq.num
_entity_poly_seq.mon_id
_entity_poly_seq.hetero
1 1 U n
1 2 G n
1 3 C n
1 4 G n
1 5 G n
1 6 G n
1 7 G n
1 8 U n
1 9 C n
1 10 C n
1 11 C n
1 12 G n
1 13 G n
1 14 G n
1 15 A n
1 16 G n
1 17 G n
1 18 A n
1 19 C n
1 20 C n
1 21 G n
1 22 C n
#
_pdbx_entity_src_syn.entity_id 1
_pdbx_entity_src_syn.pdbx_src_id 1
_pdbx_entity_src_syn.pdbx_alt_source_flag sample
_pdbx_entity_src_syn.pdbx_beg_seq_num 1
_pdbx_entity_src_syn.pdbx_end_seq_num 22
_pdbx_entity_src_syn.organism_scientific 'synthetic construct'
_pdbx_entity_src_syn.organism_common_name ?
_pdbx_entity_src_syn.ncbi_taxonomy_id 32630
_pdbx_entity_src_syn.details ?
#
loop_
_chem_comp.id
_chem_comp.type
_chem_comp.mon_nstd_flag
_chem_comp.name
_chem_comp.pdbx_synonyms
_chem_comp.formula
_chem_comp.formula_weight
A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221
A1L3Y non-polymer .
;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide
;
? 'C22 H32 N6 O7' 492.525
C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197
G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221
HOH non-polymer . WATER ? 'H2 O' 18.015
U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181
#
loop_
_pdbx_poly_seq_scheme.asym_id
_pdbx_poly_seq_scheme.entity_id
_pdbx_poly_seq_scheme.seq_id
_pdbx_poly_seq_scheme.mon_id
_pdbx_poly_seq_scheme.ndb_seq_num
_pdbx_poly_seq_scheme.pdb_seq_num
_pdbx_poly_seq_scheme.auth_seq_num
_pdbx_poly_seq_scheme.pdb_mon_id
_pdbx_poly_seq_scheme.auth_mon_id
_pdbx_poly_seq_scheme.pdb_strand_id
_pdbx_poly_seq_scheme.pdb_ins_code
_pdbx_poly_seq_scheme.hetero
A 1 1 U 1 2 2 U U A . n
A 1 2 G 2 3 3 G G A . n
A 1 3 C 3 4 4 C C A . n
A 1 4 G 4 5 5 G G A . n
A 1 5 G 5 6 6 G G A . n
A 1 6 G 6 7 7 G G A . n
A 1 7 G 7 8 8 G G A . n
A 1 8 U 8 9 9 U U A . n
A 1 9 C 9 10 10 C C A . n
A 1 10 C 10 11 11 C C A . n
A 1 11 C 11 12 12 C C A . n
A 1 12 G 12 13 13 G G A . n
A 1 13 G 13 14 14 G G A . n
A 1 14 G 14 15 15 G G A . n
A 1 15 A 15 16 16 A A A . n
A 1 16 G 16 17 17 G G A . n
A 1 17 G 17 18 18 G G A . n
A 1 18 A 18 19 19 A A A . n
A 1 19 C 19 20 20 C C A . n
A 1 20 C 20 21 21 C C A . n
A 1 21 G 21 22 22 G G A . n
A 1 22 C 22 23 23 C C A . n
B 1 1 U 1 2 ? ? ? B . n
B 1 2 G 2 3 3 G G B . n
B 1 3 C 3 4 4 C C B . n
B 1 4 G 4 5 5 G G B . n
B 1 5 G 5 6 6 G G B . n
B 1 6 G 6 7 7 G G B . n
B 1 7 G 7 8 8 G G B . n
B 1 8 U 8 9 9 U U B . n
B 1 9 C 9 10 10 C C B . n
B 1 10 C 10 11 11 C C B . n
B 1 11 C 11 12 12 C C B . n
B 1 12 G 12 13 13 G G B . n
B 1 13 G 13 14 14 G G B . n
B 1 14 G 14 15 15 G G B . n
B 1 15 A 15 16 16 A A B . n
B 1 16 G 16 17 17 G G B . n
B 1 17 G 17 18 18 G G B . n
B 1 18 A 18 19 19 A A B . n
B 1 19 C 19 20 20 C C B . n
B 1 20 C 20 21 21 C C B . n
B 1 21 G 21 22 22 G G B . n
B 1 22 C 22 23 23 C C B . n
#
_pdbx_entity_instance_feature.ordinal 1
_pdbx_entity_instance_feature.comp_id A1L3Y
_pdbx_entity_instance_feature.asym_id ?
_pdbx_entity_instance_feature.seq_num ?
_pdbx_entity_instance_feature.auth_comp_id A1L3Y
_pdbx_entity_instance_feature.auth_asym_id ?
_pdbx_entity_instance_feature.auth_seq_num ?
_pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION'
_pdbx_entity_instance_feature.details ?
#
loop_
_pdbx_nonpoly_scheme.asym_id
_pdbx_nonpoly_scheme.entity_id
_pdbx_nonpoly_scheme.mon_id
_pdbx_nonpoly_scheme.ndb_seq_num
_pdbx_nonpoly_scheme.pdb_seq_num
_pdbx_nonpoly_scheme.auth_seq_num
_pdbx_nonpoly_scheme.pdb_mon_id
_pdbx_nonpoly_scheme.auth_mon_id
_pdbx_nonpoly_scheme.pdb_strand_id
_pdbx_nonpoly_scheme.pdb_ins_code
C 2 A1L3Y 1 101 102 A1L3Y LIG A .
D 2 A1L3Y 1 101 101 A1L3Y LIG B .
E 3 HOH 1 201 1 HOH HOH A .
E 3 HOH 2 202 9 HOH HOH A .
E 3 HOH 3 203 7 HOH HOH A .
E 3 HOH 4 204 3 HOH HOH A .
E 3 HOH 5 205 6 HOH HOH A .
E 3 HOH 6 206 4 HOH HOH A .
E 3 HOH 7 207 12 HOH HOH A .
E 3 HOH 8 208 5 HOH HOH A .
E 3 HOH 9 209 2 HOH HOH A .
E 3 HOH 10 210 13 HOH HOH A .
F 3 HOH 1 201 8 HOH HOH B .
F 3 HOH 2 202 11 HOH HOH B .
F 3 HOH 3 203 10 HOH HOH B .
#
loop_
_pdbx_unobs_or_zero_occ_atoms.id
_pdbx_unobs_or_zero_occ_atoms.PDB_model_num
_pdbx_unobs_or_zero_occ_atoms.polymer_flag
_pdbx_unobs_or_zero_occ_atoms.occupancy_flag
_pdbx_unobs_or_zero_occ_atoms.auth_asym_id
_pdbx_unobs_or_zero_occ_atoms.auth_comp_id
_pdbx_unobs_or_zero_occ_atoms.auth_seq_id
_pdbx_unobs_or_zero_occ_atoms.PDB_ins_code
_pdbx_unobs_or_zero_occ_atoms.auth_atom_id
_pdbx_unobs_or_zero_occ_atoms.label_alt_id
_pdbx_unobs_or_zero_occ_atoms.label_asym_id
_pdbx_unobs_or_zero_occ_atoms.label_comp_id
_pdbx_unobs_or_zero_occ_atoms.label_seq_id
_pdbx_unobs_or_zero_occ_atoms.label_atom_id
1 1 N 1 A A1L3Y 101 ? C03 ? C A1L3Y 1 C03
2 1 N 1 A A1L3Y 101 ? C08 ? C A1L3Y 1 C08
3 1 N 1 A A1L3Y 101 ? O01 ? C A1L3Y 1 O01
4 1 N 1 A A1L3Y 101 ? C04 ? C A1L3Y 1 C04
5 1 N 1 A A1L3Y 101 ? N01 ? C A1L3Y 1 N01
6 1 N 1 B A1L3Y 101 ? C04 ? D A1L3Y 1 C04
7 1 N 1 B A1L3Y 101 ? N01 ? D A1L3Y 1 N01
#
loop_
_software.citation_id
_software.classification
_software.compiler_name
_software.compiler_version
_software.contact_author
_software.contact_author_email
_software.date
_software.description
_software.dependencies
_software.hardware
_software.language
_software.location
_software.mods
_software.name
_software.os
_software.os_version
_software.type
_software.version
_software.pdbx_ordinal
? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.17.1_3660: ???)' 1
? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 2
? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3
? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4
#
_cell.angle_alpha 90.00
_cell.angle_alpha_esd ?
_cell.angle_beta 90.00
_cell.angle_beta_esd ?
_cell.angle_gamma 120.00
_cell.angle_gamma_esd ?
_cell.entry_id 9J6P
_cell.details ?
_cell.formula_units_Z ?
_cell.length_a 46.156
_cell.length_a_esd ?
_cell.length_b 46.156
_cell.length_b_esd ?
_cell.length_c 336.178
_cell.length_c_esd ?
_cell.volume ?
_cell.volume_esd ?
_cell.Z_PDB 36
_cell.reciprocal_angle_alpha ?
_cell.reciprocal_angle_beta ?
_cell.reciprocal_angle_gamma ?
_cell.reciprocal_angle_alpha_esd ?
_cell.reciprocal_angle_beta_esd ?
_cell.reciprocal_angle_gamma_esd ?
_cell.reciprocal_length_a ?
_cell.reciprocal_length_b ?
_cell.reciprocal_length_c ?
_cell.reciprocal_length_a_esd ?
_cell.reciprocal_length_b_esd ?
_cell.reciprocal_length_c_esd ?
_cell.pdbx_unique_axis ?
_cell.pdbx_esd_method ?
#
_symmetry.entry_id 9J6P
_symmetry.cell_setting ?
_symmetry.Int_Tables_number 155
_symmetry.space_group_name_Hall ?
_symmetry.space_group_name_H-M 'H 3 2'
_symmetry.pdbx_full_space_group_name_H-M ?
#
_exptl.absorpt_coefficient_mu ?
_exptl.absorpt_correction_T_max ?
_exptl.absorpt_correction_T_min ?
_exptl.absorpt_correction_type ?
_exptl.absorpt_process_details ?
_exptl.entry_id 9J6P
_exptl.crystals_number 1
_exptl.details ?
_exptl.method 'X-RAY DIFFRACTION'
_exptl.method_details ?
#
_exptl_crystal.colour ?
_exptl_crystal.density_diffrn ?
_exptl_crystal.density_Matthews 2.46
_exptl_crystal.density_method ?
_exptl_crystal.density_percent_sol 49.98
_exptl_crystal.description ?
_exptl_crystal.F_000 ?
_exptl_crystal.id 1
_exptl_crystal.preparation ?
_exptl_crystal.size_max ?
_exptl_crystal.size_mid ?
_exptl_crystal.size_min ?
_exptl_crystal.size_rad ?
_exptl_crystal.colour_lustre ?
_exptl_crystal.colour_modifier ?
_exptl_crystal.colour_primary ?
_exptl_crystal.density_meas ?
_exptl_crystal.density_meas_esd ?
_exptl_crystal.density_meas_gt ?
_exptl_crystal.density_meas_lt ?
_exptl_crystal.density_meas_temp ?
_exptl_crystal.density_meas_temp_esd ?
_exptl_crystal.density_meas_temp_gt ?
_exptl_crystal.density_meas_temp_lt ?
_exptl_crystal.pdbx_crystal_image_url ?
_exptl_crystal.pdbx_crystal_image_format ?
_exptl_crystal.pdbx_mosaicity ?
_exptl_crystal.pdbx_mosaicity_esd ?
_exptl_crystal.pdbx_mosaic_method ?
_exptl_crystal.pdbx_mosaic_block_size ?
_exptl_crystal.pdbx_mosaic_block_size_esd ?
#
_exptl_crystal_grow.apparatus ?
_exptl_crystal_grow.atmosphere ?
_exptl_crystal_grow.crystal_id 1
_exptl_crystal_grow.details ?
_exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP'
_exptl_crystal_grow.method_ref ?
_exptl_crystal_grow.pH ?
_exptl_crystal_grow.pressure ?
_exptl_crystal_grow.pressure_esd ?
_exptl_crystal_grow.seeding ?
_exptl_crystal_grow.seeding_ref ?
_exptl_crystal_grow.temp_details ?
_exptl_crystal_grow.temp_esd ?
_exptl_crystal_grow.time ?
_exptl_crystal_grow.pdbx_details 'MPD, spermine, MOPS'
_exptl_crystal_grow.pdbx_pH_range ?
_exptl_crystal_grow.temp 293
#
_diffrn.ambient_environment ?
_diffrn.ambient_temp 100
_diffrn.ambient_temp_details ?
_diffrn.ambient_temp_esd ?
_diffrn.crystal_id 1
_diffrn.crystal_support ?
_diffrn.crystal_treatment ?
_diffrn.details ?
_diffrn.id 1
_diffrn.ambient_pressure ?
_diffrn.ambient_pressure_esd ?
_diffrn.ambient_pressure_gt ?
_diffrn.ambient_pressure_lt ?
_diffrn.ambient_temp_gt ?
_diffrn.ambient_temp_lt ?
_diffrn.pdbx_serial_crystal_experiment N
#
_diffrn_detector.details ?
_diffrn_detector.detector PIXEL
_diffrn_detector.diffrn_id 1
_diffrn_detector.type 'DECTRIS EIGER X 16M'
_diffrn_detector.area_resol_mean ?
_diffrn_detector.dtime ?
_diffrn_detector.pdbx_frames_total ?
_diffrn_detector.pdbx_collection_time_total ?
_diffrn_detector.pdbx_collection_date 2023-11-26
_diffrn_detector.pdbx_frequency ?
_diffrn_detector.id ?
_diffrn_detector.number_of_axes ?
#
_diffrn_radiation.collimation ?
_diffrn_radiation.diffrn_id 1
_diffrn_radiation.filter_edge ?
_diffrn_radiation.inhomogeneity ?
_diffrn_radiation.monochromator ?
_diffrn_radiation.polarisn_norm ?
_diffrn_radiation.polarisn_ratio ?
_diffrn_radiation.probe ?
_diffrn_radiation.type ?
_diffrn_radiation.xray_symbol ?
_diffrn_radiation.wavelength_id 1
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l M
_diffrn_radiation.pdbx_wavelength_list ?
_diffrn_radiation.pdbx_wavelength ?
_diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH'
_diffrn_radiation.pdbx_analyzer ?
_diffrn_radiation.pdbx_scattering_type x-ray
#
_diffrn_radiation_wavelength.id 1
_diffrn_radiation_wavelength.wavelength 1.605
_diffrn_radiation_wavelength.wt 1.0
#
_diffrn_source.current ?
_diffrn_source.details ?
_diffrn_source.diffrn_id 1
_diffrn_source.power ?
_diffrn_source.size ?
_diffrn_source.source SYNCHROTRON
_diffrn_source.target ?
_diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A'
_diffrn_source.voltage ?
_diffrn_source.take-off_angle ?
_diffrn_source.pdbx_wavelength_list 1.605
_diffrn_source.pdbx_wavelength ?
_diffrn_source.pdbx_synchrotron_beamline BL-17A
_diffrn_source.pdbx_synchrotron_site 'Photon Factory'
#
_reflns.B_iso_Wilson_estimate ?
_reflns.entry_id 9J6P
_reflns.data_reduction_details ?
_reflns.data_reduction_method ?
_reflns.d_resolution_high 2.49
_reflns.d_resolution_low 39.7
_reflns.details ?
_reflns.limit_h_max ?
_reflns.limit_h_min ?
_reflns.limit_k_max ?
_reflns.limit_k_min ?
_reflns.limit_l_max ?
_reflns.limit_l_min ?
_reflns.number_all ?
_reflns.number_obs 9098
_reflns.observed_criterion ?
_reflns.observed_criterion_F_max ?
_reflns.observed_criterion_F_min ?
_reflns.observed_criterion_I_max ?
_reflns.observed_criterion_I_min ?
_reflns.observed_criterion_sigma_F ?
_reflns.observed_criterion_sigma_I ?
_reflns.percent_possible_obs 97.2
_reflns.R_free_details ?
_reflns.Rmerge_F_all ?
_reflns.Rmerge_F_obs ?
_reflns.Friedel_coverage ?
_reflns.number_gt ?
_reflns.threshold_expression ?
_reflns.pdbx_redundancy 10.3
_reflns.pdbx_netI_over_av_sigmaI ?
_reflns.pdbx_netI_over_sigmaI 19.09
_reflns.pdbx_res_netI_over_av_sigmaI_2 ?
_reflns.pdbx_res_netI_over_sigmaI_2 ?
_reflns.pdbx_chi_squared ?
_reflns.pdbx_scaling_rejects ?
_reflns.pdbx_d_res_high_opt ?
_reflns.pdbx_d_res_low_opt ?
_reflns.pdbx_d_res_opt_method ?
_reflns.phase_calculation_details ?
_reflns.pdbx_Rrim_I_all 0.095
_reflns.pdbx_Rpim_I_all ?
_reflns.pdbx_d_opt ?
_reflns.pdbx_number_measured_all ?
_reflns.pdbx_diffrn_id 1
_reflns.pdbx_ordinal 1
_reflns.pdbx_CC_half 0.993
_reflns.pdbx_CC_star ?
_reflns.pdbx_R_split ?
_reflns.pdbx_Rmerge_I_obs 0.09
_reflns.pdbx_Rmerge_I_all ?
_reflns.pdbx_Rsym_value ?
_reflns.pdbx_CC_split_method ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ?
_reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ?
_reflns.pdbx_aniso_diffraction_limit_1 ?
_reflns.pdbx_aniso_diffraction_limit_2 ?
_reflns.pdbx_aniso_diffraction_limit_3 ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ?
_reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_1 ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_2 ?
_reflns.pdbx_aniso_B_tensor_eigenvalue_3 ?
_reflns.pdbx_orthogonalization_convention ?
_reflns.pdbx_percent_possible_ellipsoidal ?
_reflns.pdbx_percent_possible_spherical ?
_reflns.pdbx_percent_possible_ellipsoidal_anomalous ?
_reflns.pdbx_percent_possible_spherical_anomalous ?
_reflns.pdbx_redundancy_anomalous ?
_reflns.pdbx_CC_half_anomalous ?
_reflns.pdbx_absDiff_over_sigma_anomalous ?
_reflns.pdbx_percent_possible_anomalous ?
_reflns.pdbx_observed_signal_threshold ?
_reflns.pdbx_signal_type ?
_reflns.pdbx_signal_details ?
_reflns.pdbx_signal_software_id ?
#
loop_
_reflns_shell.d_res_high
_reflns_shell.d_res_low
_reflns_shell.meanI_over_sigI_all
_reflns_shell.meanI_over_sigI_obs
_reflns_shell.number_measured_all
_reflns_shell.number_measured_obs
_reflns_shell.number_possible
_reflns_shell.number_unique_all
_reflns_shell.number_unique_obs
_reflns_shell.percent_possible_obs
_reflns_shell.Rmerge_F_all
_reflns_shell.Rmerge_F_obs
_reflns_shell.meanI_over_sigI_gt
_reflns_shell.meanI_over_uI_all
_reflns_shell.meanI_over_uI_gt
_reflns_shell.number_measured_gt
_reflns_shell.number_unique_gt
_reflns_shell.percent_possible_gt
_reflns_shell.Rmerge_F_gt
_reflns_shell.Rmerge_I_gt
_reflns_shell.pdbx_redundancy
_reflns_shell.pdbx_chi_squared
_reflns_shell.pdbx_netI_over_sigmaI_all
_reflns_shell.pdbx_netI_over_sigmaI_obs
_reflns_shell.pdbx_Rrim_I_all
_reflns_shell.pdbx_Rpim_I_all
_reflns_shell.pdbx_rejects
_reflns_shell.pdbx_ordinal
_reflns_shell.pdbx_diffrn_id
_reflns_shell.pdbx_CC_half
_reflns_shell.pdbx_CC_star
_reflns_shell.pdbx_R_split
_reflns_shell.percent_possible_all
_reflns_shell.Rmerge_I_all
_reflns_shell.Rmerge_I_obs
_reflns_shell.pdbx_Rsym_value
_reflns_shell.pdbx_percent_possible_ellipsoidal
_reflns_shell.pdbx_percent_possible_spherical
_reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous
_reflns_shell.pdbx_percent_possible_spherical_anomalous
_reflns_shell.pdbx_redundancy_anomalous
_reflns_shell.pdbx_CC_half_anomalous
_reflns_shell.pdbx_absDiff_over_sigma_anomalous
_reflns_shell.pdbx_percent_possible_anomalous
2.49 2.56 ? ? ? ? ? ? 671 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.364 ? ? 1 1 0.964 ? ? ? ? 0.346 ? ? ? ? ? ? ? ? ?
2.56 2.63 ? ? ? ? ? ? 623 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.303 ? ? 2 1 0.987 ? ? ? ? 0.289 ? ? ? ? ? ? ? ? ?
2.63 2.7 ? ? ? ? ? ? 653 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.241 ? ? 3 1 0.991 ? ? ? ? 0.229 ? ? ? ? ? ? ? ? ?
2.70 2.79 ? ? ? ? ? ? 584 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.201 ? ? 4 1 0.991 ? ? ? ? 0.191 ? ? ? ? ? ? ? ? ?
2.79 2.88 ? ? ? ? ? ? 638 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.166 ? ? 5 1 0.993 ? ? ? ? 0.157 ? ? ? ? ? ? ? ? ?
2.88 2.98 ? ? ? ? ? ? 546 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.129 ? ? 6 1 0.996 ? ? ? ? 0.122 ? ? ? ? ? ? ? ? ?
2.98 3.09 ? ? ? ? ? ? 574 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.109 ? ? 7 1 0.993 ? ? ? ? 0.102 ? ? ? ? ? ? ? ? ?
3.09 3.22 ? ? ? ? ? ? 532 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.106 ? ? 8 1 0.997 ? ? ? ? 0.101 ? ? ? ? ? ? ? ? ?
3.22 3.36 ? ? ? ? ? ? 515 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.106 ? ? 9 1 0.995 ? ? ? ? 0.101 ? ? ? ? ? ? ? ? ?
3.36 3.53 ? ? ? ? ? ? 500 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.109 ? ? 10 1 0.994 ? ? ? ? 0.103 ? ? ? ? ? ? ? ? ?
3.53 3.72 ? ? ? ? ? ? 458 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.095 ? ? 11 1 0.994 ? ? ? ? 0.089 ? ? ? ? ? ? ? ? ?
3.72 3.94 ? ? ? ? ? ? 460 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.078 ? ? 12 1 0.999 ? ? ? ? 0.075 ? ? ? ? ? ? ? ? ?
3.94 4.21 ? ? ? ? ? ? 436 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.079 ? ? 13 1 0.997 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ?
4.21 4.55 ? ? ? ? ? ? 378 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.078 ? ? 14 1 0.997 ? ? ? ? 0.074 ? ? ? ? ? ? ? ? ?
4.55 4.99 ? ? ? ? ? ? 363 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.08 ? ? 15 1 0.998 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ?
4.99 5.58 ? ? ? ? ? ? 333 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.09 ? ? 16 1 0.994 ? ? ? ? 0.086 ? ? ? ? ? ? ? ? ?
5.58 6.44 ? ? ? ? ? ? 297 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.09 ? ? 17 1 0.996 ? ? ? ? 0.086 ? ? ? ? ? ? ? ? ?
6.44 7.88 ? ? ? ? ? ? 243 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.084 ? ? 18 1 0.997 ? ? ? ? 0.08 ? ? ? ? ? ? ? ? ?
7.88 11.15 ? ? ? ? ? ? 193 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.095 ? ? 19 1 0.997 ? ? ? ? 0.09 ? ? ? ? ? ? ? ? ?
11.15 39.7 ? ? ? ? ? ? 101 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.083 ? ? 20 1 0.99 ? ? ? ? 0.077 ? ? ? ? ? ? ? ? ?
#
_refine.aniso_B[1][1] ?
_refine.aniso_B[1][2] ?
_refine.aniso_B[1][3] ?
_refine.aniso_B[2][2] ?
_refine.aniso_B[2][3] ?
_refine.aniso_B[3][3] ?
_refine.B_iso_max ?
_refine.B_iso_mean ?
_refine.B_iso_min ?
_refine.correlation_coeff_Fo_to_Fc ?
_refine.correlation_coeff_Fo_to_Fc_free ?
_refine.details ?
_refine.diff_density_max ?
_refine.diff_density_max_esd ?
_refine.diff_density_min ?
_refine.diff_density_min_esd ?
_refine.diff_density_rms ?
_refine.diff_density_rms_esd ?
_refine.entry_id 9J6P
_refine.pdbx_refine_id 'X-RAY DIFFRACTION'
_refine.ls_abs_structure_details ?
_refine.ls_abs_structure_Flack ?
_refine.ls_abs_structure_Flack_esd ?
_refine.ls_abs_structure_Rogers ?
_refine.ls_abs_structure_Rogers_esd ?
_refine.ls_d_res_high 2.49
_refine.ls_d_res_low 39.69
_refine.ls_extinction_coef ?
_refine.ls_extinction_coef_esd ?
_refine.ls_extinction_expression ?
_refine.ls_extinction_method ?
_refine.ls_goodness_of_fit_all ?
_refine.ls_goodness_of_fit_all_esd ?
_refine.ls_goodness_of_fit_obs ?
_refine.ls_goodness_of_fit_obs_esd ?
_refine.ls_hydrogen_treatment ?
_refine.ls_matrix_type ?
_refine.ls_number_constraints ?
_refine.ls_number_parameters ?
_refine.ls_number_reflns_all ?
_refine.ls_number_reflns_obs 9010
_refine.ls_number_reflns_R_free 898
_refine.ls_number_reflns_R_work ?
_refine.ls_number_restraints ?
_refine.ls_percent_reflns_obs 96.31
_refine.ls_percent_reflns_R_free 9.97
_refine.ls_R_factor_all ?
_refine.ls_R_factor_obs 0.2069
_refine.ls_R_factor_R_free 0.2680
_refine.ls_R_factor_R_free_error ?
_refine.ls_R_factor_R_free_error_details ?
_refine.ls_R_factor_R_work 0.2004
_refine.ls_R_Fsqd_factor_obs ?
_refine.ls_R_I_factor_obs ?
_refine.ls_redundancy_reflns_all ?
_refine.ls_redundancy_reflns_obs ?
_refine.ls_restrained_S_all ?
_refine.ls_restrained_S_obs ?
_refine.ls_shift_over_esd_max ?
_refine.ls_shift_over_esd_mean ?
_refine.ls_structure_factor_coef ?
_refine.ls_weighting_details ?
_refine.ls_weighting_scheme ?
_refine.ls_wR_factor_all ?
_refine.ls_wR_factor_obs ?
_refine.ls_wR_factor_R_free ?
_refine.ls_wR_factor_R_work ?
_refine.occupancy_max ?
_refine.occupancy_min ?
_refine.solvent_model_details 'FLAT BULK SOLVENT MODEL'
_refine.solvent_model_param_bsol ?
_refine.solvent_model_param_ksol ?
_refine.pdbx_R_complete ?
_refine.ls_R_factor_gt ?
_refine.ls_goodness_of_fit_gt ?
_refine.ls_goodness_of_fit_ref ?
_refine.ls_shift_over_su_max ?
_refine.ls_shift_over_su_max_lt ?
_refine.ls_shift_over_su_mean ?
_refine.ls_shift_over_su_mean_lt ?
_refine.pdbx_ls_sigma_I ?
_refine.pdbx_ls_sigma_F 1.97
_refine.pdbx_ls_sigma_Fsqd ?
_refine.pdbx_data_cutoff_high_absF ?
_refine.pdbx_data_cutoff_high_rms_absF ?
_refine.pdbx_data_cutoff_low_absF ?
_refine.pdbx_isotropic_thermal_model ?
_refine.pdbx_ls_cross_valid_method 'FREE R-VALUE'
_refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT'
_refine.pdbx_starting_model ?
_refine.pdbx_stereochemistry_target_values ML
_refine.pdbx_R_Free_selection_details ?
_refine.pdbx_stereochem_target_val_spec_case ?
_refine.pdbx_overall_ESU_R ?
_refine.pdbx_overall_ESU_R_Free ?
_refine.pdbx_solvent_vdw_probe_radii 1.11
_refine.pdbx_solvent_ion_probe_radii ?
_refine.pdbx_solvent_shrinkage_radii 0.90
_refine.pdbx_real_space_R ?
_refine.pdbx_density_correlation ?
_refine.pdbx_pd_number_of_powder_patterns ?
_refine.pdbx_pd_number_of_points ?
_refine.pdbx_pd_meas_number_of_points ?
_refine.pdbx_pd_proc_ls_prof_R_factor ?
_refine.pdbx_pd_proc_ls_prof_wR_factor ?
_refine.pdbx_pd_Marquardt_correlation_coeff ?
_refine.pdbx_pd_Fsqrd_R_factor ?
_refine.pdbx_pd_ls_matrix_band_width ?
_refine.pdbx_overall_phase_error 31.14
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI ?
_refine.pdbx_overall_SU_R_free_Blow_DPI ?
_refine.pdbx_overall_SU_R_Blow_DPI ?
_refine.pdbx_TLS_residual_ADP_flag ?
_refine.pdbx_diffrn_id 1
_refine.overall_SU_B ?
_refine.overall_SU_ML 0.43
_refine.overall_SU_R_Cruickshank_DPI ?
_refine.overall_SU_R_free ?
_refine.overall_FOM_free_R_set ?
_refine.overall_FOM_work_R_set ?
_refine.pdbx_average_fsc_overall ?
_refine.pdbx_average_fsc_work ?
_refine.pdbx_average_fsc_free ?
#
_refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION'
_refine_hist.cycle_id LAST
_refine_hist.pdbx_number_atoms_protein 0
_refine_hist.pdbx_number_atoms_nucleic_acid 934
_refine_hist.pdbx_number_atoms_ligand 63
_refine_hist.number_atoms_solvent 13
_refine_hist.number_atoms_total 1010
_refine_hist.d_res_high 2.49
_refine_hist.d_res_low 39.69
#
loop_
_refine_ls_restr.pdbx_refine_id
_refine_ls_restr.criterion
_refine_ls_restr.dev_ideal
_refine_ls_restr.dev_ideal_target
_refine_ls_restr.number
_refine_ls_restr.rejects
_refine_ls_restr.type
_refine_ls_restr.weight
_refine_ls_restr.pdbx_restraint_function
'X-RAY DIFFRACTION' ? 0.007 ? 1111 ? f_bond_d ? ?
'X-RAY DIFFRACTION' ? 1.199 ? 1715 ? f_angle_d ? ?
'X-RAY DIFFRACTION' ? 9.606 ? 529 ? f_dihedral_angle_d ? ?
'X-RAY DIFFRACTION' ? 0.043 ? 215 ? f_chiral_restr ? ?
'X-RAY DIFFRACTION' ? 0.006 ? 47 ? f_plane_restr ? ?
#
loop_
_refine_ls_shell.pdbx_refine_id
_refine_ls_shell.d_res_high
_refine_ls_shell.d_res_low
_refine_ls_shell.number_reflns_all
_refine_ls_shell.number_reflns_obs
_refine_ls_shell.number_reflns_R_free
_refine_ls_shell.number_reflns_R_work
_refine_ls_shell.percent_reflns_obs
_refine_ls_shell.percent_reflns_R_free
_refine_ls_shell.R_factor_all
_refine_ls_shell.R_factor_obs
_refine_ls_shell.R_factor_R_free_error
_refine_ls_shell.R_factor_R_work
_refine_ls_shell.redundancy_reflns_all
_refine_ls_shell.redundancy_reflns_obs
_refine_ls_shell.wR_factor_all
_refine_ls_shell.wR_factor_obs
_refine_ls_shell.wR_factor_R_free
_refine_ls_shell.wR_factor_R_work
_refine_ls_shell.pdbx_R_complete
_refine_ls_shell.pdbx_total_number_of_bins_used
_refine_ls_shell.pdbx_phase_error
_refine_ls_shell.pdbx_fsc_work
_refine_ls_shell.pdbx_fsc_free
_refine_ls_shell.R_factor_R_free
'X-RAY DIFFRACTION' 2.49 2.65 . . 151 1345 96.00 . . . . 0.3207 . . . . . . . . . . . 0.4482
'X-RAY DIFFRACTION' 2.65 2.85 . . 150 1349 97.00 . . . . 0.3001 . . . . . . . . . . . 0.3594
'X-RAY DIFFRACTION' 2.85 3.14 . . 149 1337 96.00 . . . . 0.2697 . . . . . . . . . . . 0.3402
'X-RAY DIFFRACTION' 3.14 3.59 . . 145 1325 94.00 . . . . 0.2180 . . . . . . . . . . . 0.2729
'X-RAY DIFFRACTION' 3.60 4.52 . . 154 1359 97.00 . . . . 0.1738 . . . . . . . . . . . 0.2419
'X-RAY DIFFRACTION' 4.53 39.69 . . 149 1397 99.00 . . . . 0.1508 . . . . . . . . . . . 0.2084
#
_struct.entry_id 9J6P
_struct.title 'pre-mir-125a internal loop in complex with G-clamp'
_struct.pdbx_model_details ?
_struct.pdbx_formula_weight ?
_struct.pdbx_formula_weight_method ?
_struct.pdbx_model_type_details ?
_struct.pdbx_CASP_flag N
#
_struct_keywords.entry_id 9J6P
_struct_keywords.text 'micro RNA, G-clamp, RNA'
_struct_keywords.pdbx_keywords RNA
#
loop_
_struct_asym.id
_struct_asym.pdbx_blank_PDB_chainid_flag
_struct_asym.pdbx_modified
_struct_asym.entity_id
_struct_asym.details
A N N 1 ?
B N N 1 ?
C N N 2 ?
D N N 2 ?
E N N 3 ?
F N N 3 ?
#
_struct_ref.id 1
_struct_ref.db_name PDB
_struct_ref.db_code 9J6P
_struct_ref.pdbx_db_accession 9J6P
_struct_ref.pdbx_db_isoform ?
_struct_ref.entity_id 1
_struct_ref.pdbx_seq_one_letter_code ?
_struct_ref.pdbx_align_begin 1
#
loop_
_struct_ref_seq.align_id
_struct_ref_seq.ref_id
_struct_ref_seq.pdbx_PDB_id_code
_struct_ref_seq.pdbx_strand_id
_struct_ref_seq.seq_align_beg
_struct_ref_seq.pdbx_seq_align_beg_ins_code
_struct_ref_seq.seq_align_end
_struct_ref_seq.pdbx_seq_align_end_ins_code
_struct_ref_seq.pdbx_db_accession
_struct_ref_seq.db_align_beg
_struct_ref_seq.pdbx_db_align_beg_ins_code
_struct_ref_seq.db_align_end
_struct_ref_seq.pdbx_db_align_end_ins_code
_struct_ref_seq.pdbx_auth_seq_align_beg
_struct_ref_seq.pdbx_auth_seq_align_end
1 1 9J6P A 1 ? 22 ? 9J6P 2 ? 23 ? 2 23
2 1 9J6P B 1 ? 22 ? 9J6P 2 ? 23 ? 2 23
#
_pdbx_struct_assembly.id 1
_pdbx_struct_assembly.details author_and_software_defined_assembly
_pdbx_struct_assembly.method_details PISA
_pdbx_struct_assembly.oligomeric_details dimeric
_pdbx_struct_assembly.oligomeric_count 2
#
loop_
_pdbx_struct_assembly_prop.biol_id
_pdbx_struct_assembly_prop.type
_pdbx_struct_assembly_prop.value
_pdbx_struct_assembly_prop.details
1 'ABSA (A^2)' 2510 ?
1 MORE -9 ?
1 'SSA (A^2)' 8470 ?
#
_pdbx_struct_assembly_gen.assembly_id 1
_pdbx_struct_assembly_gen.oper_expression 1
_pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F
#
_pdbx_struct_assembly_auth_evidence.id 1
_pdbx_struct_assembly_auth_evidence.assembly_id 1
_pdbx_struct_assembly_auth_evidence.experimental_support none
_pdbx_struct_assembly_auth_evidence.details ?
#
_pdbx_struct_oper_list.id 1
_pdbx_struct_oper_list.type 'identity operation'
_pdbx_struct_oper_list.name 1_555
_pdbx_struct_oper_list.symmetry_operation x,y,z
_pdbx_struct_oper_list.matrix[1][1] 1.0000000000
_pdbx_struct_oper_list.matrix[1][2] 0.0000000000
_pdbx_struct_oper_list.matrix[1][3] 0.0000000000
_pdbx_struct_oper_list.vector[1] 0.0000000000
_pdbx_struct_oper_list.matrix[2][1] 0.0000000000
_pdbx_struct_oper_list.matrix[2][2] 1.0000000000
_pdbx_struct_oper_list.matrix[2][3] 0.0000000000
_pdbx_struct_oper_list.vector[2] 0.0000000000
_pdbx_struct_oper_list.matrix[3][1] 0.0000000000
_pdbx_struct_oper_list.matrix[3][2] 0.0000000000
_pdbx_struct_oper_list.matrix[3][3] 1.0000000000
_pdbx_struct_oper_list.vector[3] 0.0000000000
#
loop_
_struct_conn.id
_struct_conn.conn_type_id
_struct_conn.pdbx_leaving_atom_flag
_struct_conn.pdbx_PDB_id
_struct_conn.ptnr1_label_asym_id
_struct_conn.ptnr1_label_comp_id
_struct_conn.ptnr1_label_seq_id
_struct_conn.ptnr1_label_atom_id
_struct_conn.pdbx_ptnr1_label_alt_id
_struct_conn.pdbx_ptnr1_PDB_ins_code
_struct_conn.pdbx_ptnr1_standard_comp_id
_struct_conn.ptnr1_symmetry
_struct_conn.ptnr2_label_asym_id
_struct_conn.ptnr2_label_comp_id
_struct_conn.ptnr2_label_seq_id
_struct_conn.ptnr2_label_atom_id
_struct_conn.pdbx_ptnr2_label_alt_id
_struct_conn.pdbx_ptnr2_PDB_ins_code
_struct_conn.ptnr1_auth_asym_id
_struct_conn.ptnr1_auth_comp_id
_struct_conn.ptnr1_auth_seq_id
_struct_conn.ptnr2_auth_asym_id
_struct_conn.ptnr2_auth_comp_id
_struct_conn.ptnr2_auth_seq_id
_struct_conn.ptnr2_symmetry
_struct_conn.pdbx_ptnr3_label_atom_id
_struct_conn.pdbx_ptnr3_label_seq_id
_struct_conn.pdbx_ptnr3_label_comp_id
_struct_conn.pdbx_ptnr3_label_asym_id
_struct_conn.pdbx_ptnr3_label_alt_id
_struct_conn.pdbx_ptnr3_PDB_ins_code
_struct_conn.details
_struct_conn.pdbx_dist_value
_struct_conn.pdbx_value_order
_struct_conn.pdbx_role
hydrog1 hydrog ? ? A U 1 O4 ? ? ? 1_555 B C 19 N4 ? ? A U 2 B C 20 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ?
hydrog2 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog3 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog4 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog5 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog6 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog7 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 19 N3 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 19 O2 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 19 N4 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog14 hydrog ? ? A G 7 N1 ? ? ? 1_555 B G 16 O6 ? ? A G 8 B G 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ?
hydrog15 hydrog ? ? A G 7 N2 ? ? ? 1_555 B G 16 N7 ? ? A G 8 B G 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ?
hydrog16 hydrog ? ? A U 8 N3 ? ? ? 1_555 B A 15 N1 ? ? A U 9 B A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog17 hydrog ? ? A U 8 O4 ? ? ? 1_555 B A 15 N6 ? ? A U 9 B A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog18 hydrog ? ? A C 9 N3 ? ? ? 1_555 B G 14 N1 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog19 hydrog ? ? A C 9 N4 ? ? ? 1_555 B G 14 O6 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog20 hydrog ? ? A C 9 O2 ? ? ? 1_555 B G 14 N2 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog21 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog22 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog23 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog24 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog25 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog26 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog33 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog34 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog35 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog36 hydrog ? ? A A 15 N1 ? ? ? 1_555 B U 8 N3 ? ? A A 16 B U 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog37 hydrog ? ? A A 15 N6 ? ? ? 1_555 B U 8 O4 ? ? A A 16 B U 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog38 hydrog ? ? A G 16 N7 ? ? ? 1_555 B G 7 N2 ? ? A G 17 B G 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ?
hydrog39 hydrog ? ? A G 16 O6 ? ? ? 1_555 B G 7 N1 ? ? A G 17 B G 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ?
hydrog40 hydrog ? ? A C 19 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog41 hydrog ? ? A C 19 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog42 hydrog ? ? A C 19 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog43 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog44 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog45 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog46 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog47 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog48 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog49 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog50 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
hydrog51 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ?
#
_struct_conn_type.id hydrog
_struct_conn_type.criteria ?
_struct_conn_type.reference ?
#
_pdbx_entry_details.entry_id 9J6P
_pdbx_entry_details.has_ligand_of_interest Y
_pdbx_entry_details.compound_details ?
_pdbx_entry_details.source_details ?
_pdbx_entry_details.nonpolymer_details ?
_pdbx_entry_details.sequence_details ?
_pdbx_entry_details.has_protein_modification N
#
loop_
_pdbx_struct_special_symmetry.id
_pdbx_struct_special_symmetry.PDB_model_num
_pdbx_struct_special_symmetry.auth_asym_id
_pdbx_struct_special_symmetry.auth_comp_id
_pdbx_struct_special_symmetry.auth_seq_id
_pdbx_struct_special_symmetry.PDB_ins_code
_pdbx_struct_special_symmetry.label_asym_id
_pdbx_struct_special_symmetry.label_comp_id
_pdbx_struct_special_symmetry.label_seq_id
1 1 A HOH 201 ? E HOH .
2 1 A HOH 206 ? E HOH .
3 1 A HOH 209 ? E HOH .
4 1 A HOH 210 ? E HOH .
#
_pdbx_unobs_or_zero_occ_residues.id 1
_pdbx_unobs_or_zero_occ_residues.PDB_model_num 1
_pdbx_unobs_or_zero_occ_residues.polymer_flag Y
_pdbx_unobs_or_zero_occ_residues.occupancy_flag 1
_pdbx_unobs_or_zero_occ_residues.auth_asym_id B
_pdbx_unobs_or_zero_occ_residues.auth_comp_id U
_pdbx_unobs_or_zero_occ_residues.auth_seq_id 2
_pdbx_unobs_or_zero_occ_residues.PDB_ins_code ?
_pdbx_unobs_or_zero_occ_residues.label_asym_id B
_pdbx_unobs_or_zero_occ_residues.label_comp_id U
_pdbx_unobs_or_zero_occ_residues.label_seq_id 1
#
loop_
_chem_comp_atom.comp_id
_chem_comp_atom.atom_id
_chem_comp_atom.type_symbol
_chem_comp_atom.pdbx_aromatic_flag
_chem_comp_atom.pdbx_stereo_config
_chem_comp_atom.pdbx_ordinal
A OP3 O N N 1
A P P N N 2
A OP1 O N N 3
A OP2 O N N 4
A "O5'" O N N 5
A "C5'" C N N 6
A "C4'" C N R 7
A "O4'" O N N 8
A "C3'" C N S 9
A "O3'" O N N 10
A "C2'" C N R 11
A "O2'" O N N 12
A "C1'" C N R 13
A N9 N Y N 14
A C8 C Y N 15
A N7 N Y N 16
A C5 C Y N 17
A C6 C Y N 18
A N6 N N N 19
A N1 N Y N 20
A C2 C Y N 21
A N3 N Y N 22
A C4 C Y N 23
A HOP3 H N N 24
A HOP2 H N N 25
A "H5'" H N N 26
A "H5''" H N N 27
A "H4'" H N N 28
A "H3'" H N N 29
A "HO3'" H N N 30
A "H2'" H N N 31
A "HO2'" H N N 32
A "H1'" H N N 33
A H8 H N N 34
A H61 H N N 35
A H62 H N N 36
A H2 H N N 37
A1L3Y C10 C N N 38
A1L3Y C13 C N N 39
A1L3Y C15 C N N 40
A1L3Y C17 C Y N 41
A1L3Y C20 C Y N 42
A1L3Y C21 C N N 43
A1L3Y C22 C N N 44
A1L3Y C01 C N N 45
A1L3Y C02 C N N 46
A1L3Y C03 C N N 47
A1L3Y C06 C N N 48
A1L3Y C07 C N N 49
A1L3Y C08 C N N 50
A1L3Y C09 C Y N 51
A1L3Y C11 C N N 52
A1L3Y C12 C Y N 53
A1L3Y C14 C N N 54
A1L3Y C16 C N N 55
A1L3Y C18 C Y N 56
A1L3Y C19 C Y N 57
A1L3Y C23 C N N 58
A1L3Y N02 N N N 59
A1L3Y N03 N N N 60
A1L3Y N04 N N N 61
A1L3Y N05 N N N 62
A1L3Y N06 N N N 63
A1L3Y O01 O N N 64
A1L3Y O02 O N N 65
A1L3Y O03 O N N 66
A1L3Y O05 O N N 67
A1L3Y O06 O N N 68
A1L3Y O07 O N N 69
A1L3Y O08 O N N 70
A1L3Y H1 H N N 71
A1L3Y H2 H N N 72
A1L3Y H3 H N N 73
A1L3Y H5 H N N 74
A1L3Y H6 H N N 75
A1L3Y H7 H N N 76
A1L3Y H8 H N N 77
A1L3Y H9 H N N 78
A1L3Y H10 H N N 79
A1L3Y H11 H N N 80
A1L3Y H12 H N N 81
A1L3Y H13 H N N 82
A1L3Y H14 H N N 83
A1L3Y H15 H N N 84
A1L3Y H17 H N N 85
A1L3Y H18 H N N 86
A1L3Y H19 H N N 87
A1L3Y H20 H N N 88
A1L3Y H21 H N N 89
A1L3Y H22 H N N 90
A1L3Y H23 H N N 91
A1L3Y H24 H N N 92
A1L3Y H25 H N N 93
A1L3Y H26 H N N 94
A1L3Y H27 H N N 95
A1L3Y H28 H N N 96
A1L3Y H31 H N N 97
A1L3Y C04 C N N 98
A1L3Y N01 N N N 99
A1L3Y H29 H N N 100
A1L3Y H32 H N N 101
A1L3Y H33 H N N 102
A1L3Y H34 H N N 103
A1L3Y H4 H N N 104
C OP3 O N N 105
C P P N N 106
C OP1 O N N 107
C OP2 O N N 108
C "O5'" O N N 109
C "C5'" C N N 110
C "C4'" C N R 111
C "O4'" O N N 112
C "C3'" C N S 113
C "O3'" O N N 114
C "C2'" C N R 115
C "O2'" O N N 116
C "C1'" C N R 117
C N1 N N N 118
C C2 C N N 119
C O2 O N N 120
C N3 N N N 121
C C4 C N N 122
C N4 N N N 123
C C5 C N N 124
C C6 C N N 125
C HOP3 H N N 126
C HOP2 H N N 127
C "H5'" H N N 128
C "H5''" H N N 129
C "H4'" H N N 130
C "H3'" H N N 131
C "HO3'" H N N 132
C "H2'" H N N 133
C "HO2'" H N N 134
C "H1'" H N N 135
C H41 H N N 136
C H42 H N N 137
C H5 H N N 138
C H6 H N N 139
G OP3 O N N 140
G P P N N 141
G OP1 O N N 142
G OP2 O N N 143
G "O5'" O N N 144
G "C5'" C N N 145
G "C4'" C N R 146
G "O4'" O N N 147
G "C3'" C N S 148
G "O3'" O N N 149
G "C2'" C N R 150
G "O2'" O N N 151
G "C1'" C N R 152
G N9 N Y N 153
G C8 C Y N 154
G N7 N Y N 155
G C5 C Y N 156
G C6 C N N 157
G O6 O N N 158
G N1 N N N 159
G C2 C N N 160
G N2 N N N 161
G N3 N N N 162
G C4 C Y N 163
G HOP3 H N N 164
G HOP2 H N N 165
G "H5'" H N N 166
G "H5''" H N N 167
G "H4'" H N N 168
G "H3'" H N N 169
G "HO3'" H N N 170
G "H2'" H N N 171
G "HO2'" H N N 172
G "H1'" H N N 173
G H8 H N N 174
G H1 H N N 175
G H21 H N N 176
G H22 H N N 177
HOH O O N N 178
HOH H1 H N N 179
HOH H2 H N N 180
U OP3 O N N 181
U P P N N 182
U OP1 O N N 183
U OP2 O N N 184
U "O5'" O N N 185
U "C5'" C N N 186
U "C4'" C N R 187
U "O4'" O N N 188
U "C3'" C N S 189
U "O3'" O N N 190
U "C2'" C N R 191
U "O2'" O N N 192
U "C1'" C N R 193
U N1 N N N 194
U C2 C N N 195
U O2 O N N 196
U N3 N N N 197
U C4 C N N 198
U O4 O N N 199
U C5 C N N 200
U C6 C N N 201
U HOP3 H N N 202
U HOP2 H N N 203
U "H5'" H N N 204
U "H5''" H N N 205
U "H4'" H N N 206
U "H3'" H N N 207
U "HO3'" H N N 208
U "H2'" H N N 209
U "HO2'" H N N 210
U "H1'" H N N 211
U H3 H N N 212
U H5 H N N 213
U H6 H N N 214
#
loop_
_chem_comp_bond.comp_id
_chem_comp_bond.atom_id_1
_chem_comp_bond.atom_id_2
_chem_comp_bond.value_order
_chem_comp_bond.pdbx_aromatic_flag
_chem_comp_bond.pdbx_stereo_config
_chem_comp_bond.pdbx_ordinal
A OP3 P sing N N 1
A OP3 HOP3 sing N N 2
A P OP1 doub N N 3
A P OP2 sing N N 4
A P "O5'" sing N N 5
A OP2 HOP2 sing N N 6
A "O5'" "C5'" sing N N 7
A "C5'" "C4'" sing N N 8
A "C5'" "H5'" sing N N 9
A "C5'" "H5''" sing N N 10
A "C4'" "O4'" sing N N 11
A "C4'" "C3'" sing N N 12
A "C4'" "H4'" sing N N 13
A "O4'" "C1'" sing N N 14
A "C3'" "O3'" sing N N 15
A "C3'" "C2'" sing N N 16
A "C3'" "H3'" sing N N 17
A "O3'" "HO3'" sing N N 18
A "C2'" "O2'" sing N N 19
A "C2'" "C1'" sing N N 20
A "C2'" "H2'" sing N N 21
A "O2'" "HO2'" sing N N 22
A "C1'" N9 sing N N 23
A "C1'" "H1'" sing N N 24
A N9 C8 sing Y N 25
A N9 C4 sing Y N 26
A C8 N7 doub Y N 27
A C8 H8 sing N N 28
A N7 C5 sing Y N 29
A C5 C6 sing Y N 30
A C5 C4 doub Y N 31
A C6 N6 sing N N 32
A C6 N1 doub Y N 33
A N6 H61 sing N N 34
A N6 H62 sing N N 35
A N1 C2 sing Y N 36
A C2 N3 doub Y N 37
A C2 H2 sing N N 38
A N3 C4 sing Y N 39
A1L3Y C18 C17 sing Y N 40
A1L3Y C18 C19 doub Y N 41
A1L3Y C17 C12 doub Y N 42
A1L3Y C19 C20 sing Y N 43
A1L3Y C12 O05 sing N N 44
A1L3Y C12 C09 sing Y N 45
A1L3Y O05 C16 sing N N 46
A1L3Y C20 C09 doub Y N 47
A1L3Y C20 O08 sing N N 48
A1L3Y C09 N03 sing N N 49
A1L3Y O08 C21 sing N N 50
A1L3Y C16 C15 doub N N 51
A1L3Y C16 C10 sing N N 52
A1L3Y C15 N05 sing N N 53
A1L3Y N03 C10 sing N N 54
A1L3Y C10 N04 doub N N 55
A1L3Y N05 C13 sing N N 56
A1L3Y N05 C11 sing N N 57
A1L3Y C13 C14 sing N N 58
A1L3Y N04 C11 sing N N 59
A1L3Y N02 C22 sing N N 60
A1L3Y C11 O06 doub N N 61
A1L3Y C21 C22 sing N N 62
A1L3Y C08 C06 sing N N 63
A1L3Y C08 O01 sing N N 64
A1L3Y C14 N06 sing N N 65
A1L3Y C14 O07 doub N N 66
A1L3Y C06 O02 sing N N 67
A1L3Y O01 C03 sing N N 68
A1L3Y N06 C23 sing N N 69
A1L3Y O02 C02 sing N N 70
A1L3Y C23 C07 sing N N 71
A1L3Y C02 C01 sing N N 72
A1L3Y C07 O03 sing N N 73
A1L3Y C01 O03 sing N N 74
A1L3Y C13 H1 sing N N 75
A1L3Y C13 H2 sing N N 76
A1L3Y C15 H3 sing N N 77
A1L3Y C17 H5 sing N N 78
A1L3Y C21 H6 sing N N 79
A1L3Y C21 H7 sing N N 80
A1L3Y C22 H8 sing N N 81
A1L3Y C22 H9 sing N N 82
A1L3Y C01 H10 sing N N 83
A1L3Y C01 H11 sing N N 84
A1L3Y C02 H12 sing N N 85
A1L3Y C02 H13 sing N N 86
A1L3Y C03 H14 sing N N 87
A1L3Y C03 H15 sing N N 88
A1L3Y C06 H17 sing N N 89
A1L3Y C06 H18 sing N N 90
A1L3Y C07 H19 sing N N 91
A1L3Y C07 H20 sing N N 92
A1L3Y C08 H21 sing N N 93
A1L3Y C08 H22 sing N N 94
A1L3Y C18 H23 sing N N 95
A1L3Y C19 H24 sing N N 96
A1L3Y C23 H25 sing N N 97
A1L3Y C23 H26 sing N N 98
A1L3Y N02 H27 sing N N 99
A1L3Y N02 H28 sing N N 100
A1L3Y N06 H31 sing N N 101
A1L3Y C03 C04 sing N N 102
A1L3Y C04 N01 sing N N 103
A1L3Y C04 H29 sing N N 104
A1L3Y C04 H32 sing N N 105
A1L3Y N01 H33 sing N N 106
A1L3Y N01 H34 sing N N 107
A1L3Y N03 H4 sing N N 108
C OP3 P sing N N 109
C OP3 HOP3 sing N N 110
C P OP1 doub N N 111
C P OP2 sing N N 112
C P "O5'" sing N N 113
C OP2 HOP2 sing N N 114
C "O5'" "C5'" sing N N 115
C "C5'" "C4'" sing N N 116
C "C5'" "H5'" sing N N 117
C "C5'" "H5''" sing N N 118
C "C4'" "O4'" sing N N 119
C "C4'" "C3'" sing N N 120
C "C4'" "H4'" sing N N 121
C "O4'" "C1'" sing N N 122
C "C3'" "O3'" sing N N 123
C "C3'" "C2'" sing N N 124
C "C3'" "H3'" sing N N 125
C "O3'" "HO3'" sing N N 126
C "C2'" "O2'" sing N N 127
C "C2'" "C1'" sing N N 128
C "C2'" "H2'" sing N N 129
C "O2'" "HO2'" sing N N 130
C "C1'" N1 sing N N 131
C "C1'" "H1'" sing N N 132
C N1 C2 sing N N 133
C N1 C6 sing N N 134
C C2 O2 doub N N 135
C C2 N3 sing N N 136
C N3 C4 doub N N 137
C C4 N4 sing N N 138
C C4 C5 sing N N 139
C N4 H41 sing N N 140
C N4 H42 sing N N 141
C C5 C6 doub N N 142
C C5 H5 sing N N 143
C C6 H6 sing N N 144
G OP3 P sing N N 145
G OP3 HOP3 sing N N 146
G P OP1 doub N N 147
G P OP2 sing N N 148
G P "O5'" sing N N 149
G OP2 HOP2 sing N N 150
G "O5'" "C5'" sing N N 151
G "C5'" "C4'" sing N N 152
G "C5'" "H5'" sing N N 153
G "C5'" "H5''" sing N N 154
G "C4'" "O4'" sing N N 155
G "C4'" "C3'" sing N N 156
G "C4'" "H4'" sing N N 157
G "O4'" "C1'" sing N N 158
G "C3'" "O3'" sing N N 159
G "C3'" "C2'" sing N N 160
G "C3'" "H3'" sing N N 161
G "O3'" "HO3'" sing N N 162
G "C2'" "O2'" sing N N 163
G "C2'" "C1'" sing N N 164
G "C2'" "H2'" sing N N 165
G "O2'" "HO2'" sing N N 166
G "C1'" N9 sing N N 167
G "C1'" "H1'" sing N N 168
G N9 C8 sing Y N 169
G N9 C4 sing Y N 170
G C8 N7 doub Y N 171
G C8 H8 sing N N 172
G N7 C5 sing Y N 173
G C5 C6 sing N N 174
G C5 C4 doub Y N 175
G C6 O6 doub N N 176
G C6 N1 sing N N 177
G N1 C2 sing N N 178
G N1 H1 sing N N 179
G C2 N2 sing N N 180
G C2 N3 doub N N 181
G N2 H21 sing N N 182
G N2 H22 sing N N 183
G N3 C4 sing N N 184
HOH O H1 sing N N 185
HOH O H2 sing N N 186
U OP3 P sing N N 187
U OP3 HOP3 sing N N 188
U P OP1 doub N N 189
U P OP2 sing N N 190
U P "O5'" sing N N 191
U OP2 HOP2 sing N N 192
U "O5'" "C5'" sing N N 193
U "C5'" "C4'" sing N N 194
U "C5'" "H5'" sing N N 195
U "C5'" "H5''" sing N N 196
U "C4'" "O4'" sing N N 197
U "C4'" "C3'" sing N N 198
U "C4'" "H4'" sing N N 199
U "O4'" "C1'" sing N N 200
U "C3'" "O3'" sing N N 201
U "C3'" "C2'" sing N N 202
U "C3'" "H3'" sing N N 203
U "O3'" "HO3'" sing N N 204
U "C2'" "O2'" sing N N 205
U "C2'" "C1'" sing N N 206
U "C2'" "H2'" sing N N 207
U "O2'" "HO2'" sing N N 208
U "C1'" N1 sing N N 209
U "C1'" "H1'" sing N N 210
U N1 C2 sing N N 211
U N1 C6 sing N N 212
U C2 O2 doub N N 213
U C2 N3 sing N N 214
U N3 C4 sing N N 215
U N3 H3 sing N N 216
U C4 O4 doub N N 217
U C4 C5 sing N N 218
U C5 C6 doub N N 219
U C5 H5 sing N N 220
U C6 H6 sing N N 221
#
loop_
_ndb_struct_conf_na.entry_id
_ndb_struct_conf_na.feature
9J6P 'double helix'
9J6P 'a-form double helix'
#
loop_
_ndb_struct_na_base_pair.model_number
_ndb_struct_na_base_pair.i_label_asym_id
_ndb_struct_na_base_pair.i_label_comp_id
_ndb_struct_na_base_pair.i_label_seq_id
_ndb_struct_na_base_pair.i_symmetry
_ndb_struct_na_base_pair.j_label_asym_id
_ndb_struct_na_base_pair.j_label_comp_id
_ndb_struct_na_base_pair.j_label_seq_id
_ndb_struct_na_base_pair.j_symmetry
_ndb_struct_na_base_pair.shear
_ndb_struct_na_base_pair.stretch
_ndb_struct_na_base_pair.stagger
_ndb_struct_na_base_pair.buckle
_ndb_struct_na_base_pair.propeller
_ndb_struct_na_base_pair.opening
_ndb_struct_na_base_pair.pair_number
_ndb_struct_na_base_pair.pair_name
_ndb_struct_na_base_pair.i_auth_asym_id
_ndb_struct_na_base_pair.i_auth_seq_id
_ndb_struct_na_base_pair.i_PDB_ins_code
_ndb_struct_na_base_pair.j_auth_asym_id
_ndb_struct_na_base_pair.j_auth_seq_id
_ndb_struct_na_base_pair.j_PDB_ins_code
_ndb_struct_na_base_pair.hbond_type_28
_ndb_struct_na_base_pair.hbond_type_12
1 A G 2 1_555 B C 22 1_555 -0.056 -0.214 0.175 1.598 -7.788 -3.593 1 A_G3:C23_B A 3 ? B 23 ? 19 1
1 A C 3 1_555 B G 21 1_555 -0.091 -0.101 -0.313 9.091 -14.327 -3.599 2 A_C4:G22_B A 4 ? B 22 ? 19 1
1 A G 4 1_555 B C 20 1_555 -0.184 -0.234 -0.279 -0.013 -8.606 1.164 3 A_G5:C21_B A 5 ? B 21 ? 19 1
1 A G 5 1_555 B C 19 1_555 -0.058 -0.350 -0.140 2.693 2.034 -3.570 4 A_G6:C20_B A 6 ? B 20 ? 19 1
1 A G 7 1_555 B G 16 1_555 1.603 3.616 0.448 -14.265 -2.221 -87.416 5 A_G8:G17_B A 8 ? B 17 ? 6 3
1 A U 8 1_555 B A 15 1_555 -0.130 -0.293 -0.216 2.767 -22.413 0.769 6 A_U9:A16_B A 9 ? B 16 ? 20 1
1 A C 9 1_555 B G 14 1_555 0.238 -0.338 0.224 6.235 -10.403 -1.327 7 A_C10:G15_B A 10 ? B 15 ? 19 1
1 A C 10 1_555 B G 13 1_555 0.004 -0.050 -0.227 3.152 -12.137 0.273 8 A_C11:G14_B A 11 ? B 14 ? 19 1
1 A C 11 1_555 B G 12 1_555 0.049 -0.129 0.063 4.881 -9.586 -3.067 9 A_C12:G13_B A 12 ? B 13 ? 19 1
1 A G 12 1_555 B C 11 1_555 -0.258 -0.162 -0.305 -10.765 -12.888 -3.681 10 A_G13:C12_B A 13 ? B 12 ? 19 1
1 A G 13 1_555 B C 10 1_555 0.063 -0.116 -0.259 -7.811 -9.791 0.286 11 A_G14:C11_B A 14 ? B 11 ? 19 1
1 A G 14 1_555 B C 9 1_555 -0.170 -0.092 0.281 -2.448 -9.589 -0.246 12 A_G15:C10_B A 15 ? B 10 ? 19 1
1 A A 15 1_555 B U 8 1_555 -0.041 -0.066 -0.096 -8.244 -10.410 2.052 13 A_A16:U9_B A 16 ? B 9 ? 20 1
1 A G 16 1_555 B G 7 1_555 -1.965 -3.436 -0.326 12.672 -6.622 86.481 14 A_G17:G8_B A 17 ? B 8 ? 6 3
1 A C 19 1_555 B G 5 1_555 -0.125 -0.205 0.216 -2.637 -2.701 -5.611 15 A_C20:G6_B A 20 ? B 6 ? 19 1
1 A C 20 1_555 B G 4 1_555 0.198 -0.235 -0.361 3.533 -3.448 -1.443 16 A_C21:G5_B A 21 ? B 5 ? 19 1
1 A G 21 1_555 B C 3 1_555 -0.029 -0.072 -0.322 -8.884 -11.836 -0.952 17 A_G22:C4_B A 22 ? B 4 ? 19 1
1 A C 22 1_555 B G 2 1_555 0.276 -0.016 0.074 2.081 -7.052 -2.689 18 A_C23:G3_B A 23 ? B 3 ? 19 1
#
loop_
_ndb_struct_na_base_pair_step.model_number
_ndb_struct_na_base_pair_step.i_label_asym_id_1
_ndb_struct_na_base_pair_step.i_label_comp_id_1
_ndb_struct_na_base_pair_step.i_label_seq_id_1
_ndb_struct_na_base_pair_step.i_symmetry_1
_ndb_struct_na_base_pair_step.j_label_asym_id_1
_ndb_struct_na_base_pair_step.j_label_comp_id_1
_ndb_struct_na_base_pair_step.j_label_seq_id_1
_ndb_struct_na_base_pair_step.j_symmetry_1
_ndb_struct_na_base_pair_step.i_label_asym_id_2
_ndb_struct_na_base_pair_step.i_label_comp_id_2
_ndb_struct_na_base_pair_step.i_label_seq_id_2
_ndb_struct_na_base_pair_step.i_symmetry_2
_ndb_struct_na_base_pair_step.j_label_asym_id_2
_ndb_struct_na_base_pair_step.j_label_comp_id_2
_ndb_struct_na_base_pair_step.j_label_seq_id_2
_ndb_struct_na_base_pair_step.j_symmetry_2
_ndb_struct_na_base_pair_step.shift
_ndb_struct_na_base_pair_step.slide
_ndb_struct_na_base_pair_step.rise
_ndb_struct_na_base_pair_step.tilt
_ndb_struct_na_base_pair_step.roll
_ndb_struct_na_base_pair_step.twist
_ndb_struct_na_base_pair_step.x_displacement
_ndb_struct_na_base_pair_step.y_displacement
_ndb_struct_na_base_pair_step.helical_rise
_ndb_struct_na_base_pair_step.inclination
_ndb_struct_na_base_pair_step.tip
_ndb_struct_na_base_pair_step.helical_twist
_ndb_struct_na_base_pair_step.step_number
_ndb_struct_na_base_pair_step.step_name
_ndb_struct_na_base_pair_step.i_auth_asym_id_1
_ndb_struct_na_base_pair_step.i_auth_seq_id_1
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1
_ndb_struct_na_base_pair_step.j_auth_asym_id_1
_ndb_struct_na_base_pair_step.j_auth_seq_id_1
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1
_ndb_struct_na_base_pair_step.i_auth_asym_id_2
_ndb_struct_na_base_pair_step.i_auth_seq_id_2
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2
_ndb_struct_na_base_pair_step.j_auth_asym_id_2
_ndb_struct_na_base_pair_step.j_auth_seq_id_2
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2
1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 -0.573 -1.901 3.088 2.447 -1.707 32.494 -3.102 1.425 3.130 -3.043
-4.361 32.627 1 AA_G3C4:G22C23_BB A 3 ? B 23 ? A 4 ? B 22 ?
1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 0.762 -1.916 3.546 0.581 10.079 28.893 -5.614 -1.331 2.752 19.466
-1.121 30.570 2 AA_C4G5:C21G22_BB A 4 ? B 22 ? A 5 ? B 21 ?
1 A G 4 1_555 B C 20 1_555 A G 5 1_555 B C 19 1_555 -0.607 -1.983 3.273 -4.367 5.334 31.750 -4.448 0.347 2.964 9.608
7.867 32.471 3 AA_G5G6:C20C21_BB A 5 ? B 21 ? A 6 ? B 20 ?
1 A G 7 1_555 B G 16 1_555 A U 8 1_555 B A 15 1_555 -0.878 1.400 3.055 4.238 9.362 -20.502 -6.416 -0.902 2.333 -24.420
11.055 -22.909 4 AA_G8U9:A16G17_BB A 8 ? B 17 ? A 9 ? B 16 ?
1 A U 8 1_555 B A 15 1_555 A C 9 1_555 B G 14 1_555 0.220 -1.351 3.185 -5.465 6.269 34.298 -3.098 -1.120 2.834 10.440
9.102 35.263 5 AA_U9C10:G15A16_BB A 9 ? B 16 ? A 10 ? B 15 ?
1 A C 9 1_555 B G 14 1_555 A C 10 1_555 B G 13 1_555 0.405 -1.870 3.302 4.771 8.014 28.734 -5.133 0.139 2.724 15.636
-9.310 30.179 6 AA_C10C11:G14G15_BB A 10 ? B 15 ? A 11 ? B 14 ?
1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.332 -2.059 3.199 -3.445 5.336 31.432 -4.625 0.022 2.839 9.726
6.280 32.052 7 AA_C11C12:G13G14_BB A 11 ? B 14 ? A 12 ? B 13 ?
1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 -0.154 -1.960 3.634 1.337 11.906 28.401 -6.009 0.551 2.610 23.015
-2.584 30.777 8 AA_C12G13:C12G13_BB A 12 ? B 13 ? A 13 ? B 12 ?
1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.158 -1.828 3.118 -0.787 11.515 32.131 -4.693 -0.377 2.339 20.015
1.368 34.089 9 AA_G13G14:C11C12_BB A 13 ? B 12 ? A 14 ? B 11 ?
1 A G 13 1_555 B C 10 1_555 A G 14 1_555 B C 9 1_555 0.550 -1.946 3.089 -2.345 6.643 28.274 -5.136 -1.540 2.523 13.339
4.708 29.121 10 AA_G14G15:C10C11_BB A 14 ? B 11 ? A 15 ? B 10 ?
1 A G 14 1_555 B C 9 1_555 A A 15 1_555 B U 8 1_555 0.127 -1.644 3.271 5.544 9.104 33.271 -4.040 0.579 2.726 15.416
-9.387 34.891 11 AA_G15A16:U9C10_BB A 15 ? B 10 ? A 16 ? B 9 ?
1 A A 15 1_555 B U 8 1_555 A G 16 1_555 B G 7 1_555 0.167 3.079 -1.237 171.231 -34.284 -166.768 -1.553 0.015 -1.178 17.146
85.633 -179.381 12 AA_A16G17:G8U9_BB A 16 ? B 9 ? A 17 ? B 8 ?
1 A C 19 1_555 B G 5 1_555 A C 20 1_555 B G 4 1_555 1.018 -2.559 3.168 4.779 0.054 27.891 -5.248 -0.982 3.289 0.110
-9.823 28.290 13 AA_C20C21:G5G6_BB A 20 ? B 6 ? A 21 ? B 5 ?
1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 -1.310 -2.253 3.854 -2.830 6.724 26.991 -6.452 1.961 3.323 14.082
5.926 27.942 14 AA_C21G22:C4G5_BB A 21 ? B 5 ? A 22 ? B 4 ?
1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 0.292 -1.616 3.069 -2.887 0.096 34.364 -2.740 -0.912 3.031 0.162
4.875 34.482 15 AA_G22C23:G3C4_BB A 22 ? B 4 ? A 23 ? B 3 ?
#
loop_
_pdbx_audit_support.funding_organization
_pdbx_audit_support.country
_pdbx_audit_support.grant_number
_pdbx_audit_support.ordinal
'Japan Agency for Medical Research and Development (AMED)' Japan JP23ama121014 1
'Japan Science and Technology' Japan JPMJFR2002 2
'Japan Science and Technology' Japan JPMJSP2114 3
#
_pdbx_initial_refinement_model.id 1
_pdbx_initial_refinement_model.entity_id_list ?
_pdbx_initial_refinement_model.type 'in silico model'
_pdbx_initial_refinement_model.source_name Other
_pdbx_initial_refinement_model.accession_code ?
_pdbx_initial_refinement_model.details Coot
#
_atom_sites.entry_id 9J6P
_atom_sites.Cartn_transf_matrix[1][1] ?
_atom_sites.Cartn_transf_matrix[1][2] ?
_atom_sites.Cartn_transf_matrix[1][3] ?
_atom_sites.Cartn_transf_matrix[2][1] ?
_atom_sites.Cartn_transf_matrix[2][2] ?
_atom_sites.Cartn_transf_matrix[2][3] ?
_atom_sites.Cartn_transf_matrix[3][1] ?
_atom_sites.Cartn_transf_matrix[3][2] ?
_atom_sites.Cartn_transf_matrix[3][3] ?
_atom_sites.Cartn_transf_vector[1] ?
_atom_sites.Cartn_transf_vector[2] ?
_atom_sites.Cartn_transf_vector[3] ?
_atom_sites.Cartn_transform_axes ?
_atom_sites.fract_transf_matrix[1][1] 0.021666
_atom_sites.fract_transf_matrix[1][2] 0.012509
_atom_sites.fract_transf_matrix[1][3] 0.000000
_atom_sites.fract_transf_matrix[2][1] 0.000000
_atom_sites.fract_transf_matrix[2][2] 0.025017
_atom_sites.fract_transf_matrix[2][3] 0.000000
_atom_sites.fract_transf_matrix[3][1] 0.000000
_atom_sites.fract_transf_matrix[3][2] 0.000000
_atom_sites.fract_transf_matrix[3][3] 0.002975
_atom_sites.fract_transf_vector[1] 0.00000
_atom_sites.fract_transf_vector[2] 0.00000
_atom_sites.fract_transf_vector[3] 0.00000
_atom_sites.solution_primary ?
_atom_sites.solution_secondary ?
_atom_sites.solution_hydrogens ?
_atom_sites.special_details ?
#
loop_
_atom_type.symbol
C
N
O
P
#
loop_