data_9JA7 # _entry.id 9JA7 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.404 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9JA7 pdb_00009ja7 10.2210/pdb9ja7/pdb WWPDB D_1300050755 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-09-03 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9JA7 _pdbx_database_status.recvd_initial_deposition_date 2024-08-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email j.kondo@sophia.ac.jp _pdbx_contact_author.name_first Jiro _pdbx_contact_author.name_last Kondo _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5682-3685 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 0000-0002-5682-3685 'Ohtani, Y.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of theophylline aptamer obtained in the presence of caffeine' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kondo, J.' 1 0000-0002-5682-3685 primary 'Ohtani, Y.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'Theophylline aptamer' 10637.426 1 ? ? ? ? 2 non-polymer syn 'COBALT HEXAMMINE(III)' 161.116 6 ? ? ? ? 3 non-polymer syn 'POTASSIUM ION' 39.098 1 ? ? ? ? 4 water nat water 18.015 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCGAUACCAGCCGAAAGGCCCUUGGCAGCGCC _entity_poly.pdbx_seq_one_letter_code_can GGCGAUACCAGCCGAAAGGCCCUUGGCAGCGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'COBALT HEXAMMINE(III)' NCO 3 'POTASSIUM ION' K 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 G n 1 5 A n 1 6 U n 1 7 A n 1 8 C n 1 9 C n 1 10 A n 1 11 G n 1 12 C n 1 13 C n 1 14 G n 1 15 A n 1 16 A n 1 17 A n 1 18 G n 1 19 G n 1 20 C n 1 21 C n 1 22 C n 1 23 U n 1 24 U n 1 25 G n 1 26 G n 1 27 C n 1 28 A n 1 29 G n 1 30 C n 1 31 G n 1 32 C n 1 33 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 33 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 NCO non-polymer . 'COBALT HEXAMMINE(III)' ? 'Co H18 N6 3' 161.116 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 C 3 3 3 C C A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 U 6 6 6 U U A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 C 9 9 9 C C A . n A 1 10 A 10 10 10 A A A . n A 1 11 G 11 11 11 G G A . n A 1 12 C 12 12 12 C C A . n A 1 13 C 13 13 13 C C A . n A 1 14 G 14 14 14 G G A . n A 1 15 A 15 15 15 A A A . n A 1 16 A 16 16 16 A A A . n A 1 17 A 17 17 17 A A A . n A 1 18 G 18 18 18 G G A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 C 21 21 21 C C A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 U 24 24 24 U U A . n A 1 25 G 25 25 25 G G A . n A 1 26 G 26 26 26 G G A . n A 1 27 C 27 27 27 C C A . n A 1 28 A 28 28 28 A A A . n A 1 29 G 29 29 29 G G A . n A 1 30 C 30 30 30 C C A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 C 33 33 33 C C A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 NCO 1 101 101 NCO NCO A . C 2 NCO 1 102 102 NCO NCO A . D 2 NCO 1 103 103 NCO NCO A . E 2 NCO 1 104 104 NCO NCO A . F 2 NCO 1 105 105 NCO NCO A . G 2 NCO 1 106 106 NCO NCO A . H 3 K 1 107 1 K K A . I 4 HOH 1 201 7 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? AutoSol ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9JA7 _cell.details ? _cell.formula_units_Z ? _cell.length_a 46.925 _cell.length_a_esd ? _cell.length_b 46.925 _cell.length_b_esd ? _cell.length_c 180.258 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9JA7 _symmetry.cell_setting ? _symmetry.Int_Tables_number 178 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 61 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9JA7 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.69 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 54.32 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'MOPS (pH7), Hexammine cobalt chloride, Potassium chloride, MPD' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-03-24 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.605 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.605 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9JA7 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.59 _reflns.d_resolution_low 33.66 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6866 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 5.00 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 16.42 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.059 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.998 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.053 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.59 2.66 ? ? ? ? ? ? 485 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.377 ? ? 1 1 0.951 ? ? ? ? 0.337 ? ? ? ? ? ? ? ? ? 2.66 2.73 ? ? ? ? ? ? 506 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.305 ? ? 2 1 0.981 ? ? ? ? 0.273 ? ? ? ? ? ? ? ? ? 2.73 2.81 ? ? ? ? ? ? 485 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.236 ? ? 3 1 0.993 ? ? ? ? 0.211 ? ? ? ? ? ? ? ? ? 2.81 2.9 ? ? ? ? ? ? 465 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.145 ? ? 4 1 0.998 ? ? ? ? 0.13 ? ? ? ? ? ? ? ? ? 2.90 2.99 ? ? ? ? ? ? 454 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.104 ? ? 5 1 0.997 ? ? ? ? 0.092 ? ? ? ? ? ? ? ? ? 2.99 3.1 ? ? ? ? ? ? 450 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.07 ? ? 6 1 0.999 ? ? ? ? 0.063 ? ? ? ? ? ? ? ? ? 3.10 3.22 ? ? ? ? ? ? 409 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.058 ? ? 7 1 0.999 ? ? ? ? 0.052 ? ? ? ? ? ? ? ? ? 3.22 3.35 ? ? ? ? ? ? 425 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.058 ? ? 8 1 0.999 ? ? ? ? 0.053 ? ? ? ? ? ? ? ? ? 3.35 3.5 ? ? ? ? ? ? 371 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.056 ? ? 9 1 0.999 ? ? ? ? 0.051 ? ? ? ? ? ? ? ? ? 3.50 3.67 ? ? ? ? ? ? 382 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.062 ? ? 10 1 0.999 ? ? ? ? 0.056 ? ? ? ? ? ? ? ? ? 3.67 3.87 ? ? ? ? ? ? 363 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.048 ? ? 11 1 0.999 ? ? ? ? 0.044 ? ? ? ? ? ? ? ? ? 3.87 4.1 ? ? ? ? ? ? 328 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.054 ? ? 12 1 0.998 ? ? ? ? 0.049 ? ? ? ? ? ? ? ? ? 4.10 4.38 ? ? ? ? ? ? 318 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.054 ? ? 13 1 0.998 ? ? ? ? 0.049 ? ? ? ? ? ? ? ? ? 4.38 4.73 ? ? ? ? ? ? 302 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.057 ? ? 14 1 0.995 ? ? ? ? 0.051 ? ? ? ? ? ? ? ? ? 4.73 5.19 ? ? ? ? ? ? 273 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.056 ? ? 15 1 0.997 ? ? ? ? 0.051 ? ? ? ? ? ? ? ? ? 5.19 5.8 ? ? ? ? ? ? 242 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.057 ? ? 16 1 0.997 ? ? ? ? 0.051 ? ? ? ? ? ? ? ? ? 5.80 6.7 ? ? ? ? ? ? 217 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.049 ? ? 17 1 0.997 ? ? ? ? 0.044 ? ? ? ? ? ? ? ? ? 6.70 8.2 ? ? ? ? ? ? 178 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.057 ? ? 18 1 0.994 ? ? ? ? 0.051 ? ? ? ? ? ? ? ? ? 8.20 11.6 ? ? ? ? ? ? 143 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.05 ? ? 19 1 0.998 ? ? ? ? 0.045 ? ? ? ? ? ? ? ? ? 11.60 33.66 ? ? ? ? ? ? 70 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.042 ? ? 20 1 0.997 ? ? ? ? 0.037 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9JA7 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.59 _refine.ls_d_res_low 33.66 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6785 _refine.ls_number_reflns_R_free 677 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.36 _refine.ls_percent_reflns_R_free 9.98 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2114 _refine.ls_R_factor_R_free 0.2603 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2060 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 2.01 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 34.03 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.44 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 704 _refine_hist.pdbx_number_atoms_ligand 43 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 748 _refine_hist.d_res_high 2.59 _refine_hist.d_res_low 33.66 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? ? ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.013 ? ? ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 11.738 ? 392 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.045 ? 164 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 33 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.59 2.79 . . 133 1217 98.00 . . . . 0.3654 . . . . . . . . . . . 0.4465 'X-RAY DIFFRACTION' 2.79 3.07 . . 131 1215 98.00 . . . . 0.3102 . . . . . . . . . . . 0.3578 'X-RAY DIFFRACTION' 3.07 3.52 . . 143 1191 97.00 . . . . 0.2529 . . . . . . . . . . . 0.2893 'X-RAY DIFFRACTION' 3.52 4.43 . . 130 1244 100.00 . . . . 0.1880 . . . . . . . . . . . 0.2460 'X-RAY DIFFRACTION' 4.43 33.66 . . 140 1241 100.00 . . . . 0.1527 . . . . . . . . . . . 0.2080 # _struct.entry_id 9JA7 _struct.title 'Crystal structure of theophylline aptamer obtained in the presence of caffeine' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9JA7 _struct_keywords.text 'theophylline aptamer, caffeine, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 3 ? I N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9JA7 _struct_ref.pdbx_db_accession 9JA7 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9JA7 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 33 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9JA7 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 33 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 33 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 260 ? 1 MORE -3 ? 1 'SSA (A^2)' 5860 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A C 22 "O4'" ? ? ? 1_555 H K . K ? ? A C 22 A K 107 1_555 ? ? ? ? ? ? ? 2.791 ? ? metalc2 metalc ? ? A C 22 O2 ? ? ? 1_555 H K . K ? ? A C 22 A K 107 1_555 ? ? ? ? ? ? ? 3.185 ? ? metalc3 metalc ? ? A G 25 O6 ? ? ? 1_555 H K . K ? ? A G 25 A K 107 1_555 ? ? ? ? ? ? ? 2.593 ? ? metalc4 metalc ? ? A G 26 O6 ? ? ? 1_555 H K . K ? ? A G 26 A K 107 1_555 ? ? ? ? ? ? ? 3.037 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 33 N3 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 33 O2 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 33 N4 ? ? A G 1 A C 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 2 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 3 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 3 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 3 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 30 N3 ? ? A G 4 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 30 O2 ? ? A G 4 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 30 N4 ? ? A G 4 A C 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N1 ? ? ? 1_555 A G 29 N1 ? ? A A 5 A G 29 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A A 5 N6 ? ? ? 1_555 A G 29 O6 ? ? A A 5 A G 29 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog15 hydrog ? ? A U 6 N3 ? ? ? 1_555 A U 23 O4 ? ? A U 6 A U 23 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 6 O2 ? ? ? 1_555 A A 28 N6 ? ? A U 6 A A 28 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog17 hydrog ? ? A A 7 N6 ? ? ? 1_555 A C 22 N3 ? ? A A 7 A C 22 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog18 hydrog ? ? A A 7 N7 ? ? ? 1_555 A C 22 N4 ? ? A A 7 A C 22 1_555 ? ? ? ? ? ? TYPE_25_PAIR ? ? ? hydrog19 hydrog ? ? A A 7 N6 ? ? ? 1_555 A C 27 N3 ? ? A A 7 A C 27 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog20 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 26 N1 ? ? A C 8 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 26 O6 ? ? A C 8 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 26 N2 ? ? A C 8 A G 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 25 N1 ? ? A C 9 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 25 O6 ? ? A C 9 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 25 N2 ? ? A C 9 A G 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 10 N6 ? ? ? 1_555 A C 21 O2 ? ? A A 10 A C 21 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog27 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 20 N3 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 20 O2 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 20 N4 ? ? A G 11 A C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 12 A G 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 18 N1 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 18 O6 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 18 N2 ? ? A C 13 A G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 14 N2 ? ? ? 1_555 A A 17 N7 ? ? A G 14 A A 17 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog37 hydrog ? ? A C 22 O2 ? ? ? 1_555 A C 27 N4 ? ? A C 22 A C 27 1_555 ? ? ? ? ? ? 'C-C MISPAIR' ? ? ? hydrog38 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 28 N7 ? ? A U 23 A A 28 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? hydrog39 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 28 N6 ? ? A U 23 A A 28 1_555 ? ? ? ? ? ? HOOGSTEEN ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O4'" ? A C 22 ? A C 22 ? 1_555 K ? H K . ? A K 107 ? 1_555 O2 ? A C 22 ? A C 22 ? 1_555 66.8 ? 2 "O4'" ? A C 22 ? A C 22 ? 1_555 K ? H K . ? A K 107 ? 1_555 O6 ? A G 25 ? A G 25 ? 1_555 139.9 ? 3 O2 ? A C 22 ? A C 22 ? 1_555 K ? H K . ? A K 107 ? 1_555 O6 ? A G 25 ? A G 25 ? 1_555 145.5 ? 4 "O4'" ? A C 22 ? A C 22 ? 1_555 K ? H K . ? A K 107 ? 1_555 O6 ? A G 26 ? A G 26 ? 1_555 136.2 ? 5 O2 ? A C 22 ? A C 22 ? 1_555 K ? H K . ? A K 107 ? 1_555 O6 ? A G 26 ? A G 26 ? 1_555 69.4 ? 6 O6 ? A G 25 ? A G 25 ? 1_555 K ? H K . ? A K 107 ? 1_555 O6 ? A G 26 ? A G 26 ? 1_555 81.5 ? # _pdbx_entry_details.entry_id 9JA7 _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 K K K N N 114 NCO CO CO N N 115 NCO N1 N N N 116 NCO N2 N N N 117 NCO N3 N N N 118 NCO N4 N N N 119 NCO N5 N N N 120 NCO N6 N N N 121 NCO HN11 H N N 122 NCO HN12 H N N 123 NCO HN13 H N N 124 NCO HN21 H N N 125 NCO HN22 H N N 126 NCO HN23 H N N 127 NCO HN31 H N N 128 NCO HN32 H N N 129 NCO HN33 H N N 130 NCO HN41 H N N 131 NCO HN42 H N N 132 NCO HN43 H N N 133 NCO HN51 H N N 134 NCO HN52 H N N 135 NCO HN53 H N N 136 NCO HN61 H N N 137 NCO HN62 H N N 138 NCO HN63 H N N 139 U OP3 O N N 140 U P P N N 141 U OP1 O N N 142 U OP2 O N N 143 U "O5'" O N N 144 U "C5'" C N N 145 U "C4'" C N R 146 U "O4'" O N N 147 U "C3'" C N S 148 U "O3'" O N N 149 U "C2'" C N R 150 U "O2'" O N N 151 U "C1'" C N R 152 U N1 N N N 153 U C2 C N N 154 U O2 O N N 155 U N3 N N N 156 U C4 C N N 157 U O4 O N N 158 U C5 C N N 159 U C6 C N N 160 U HOP3 H N N 161 U HOP2 H N N 162 U "H5'" H N N 163 U "H5''" H N N 164 U "H4'" H N N 165 U "H3'" H N N 166 U "HO3'" H N N 167 U "H2'" H N N 168 U "HO2'" H N N 169 U "H1'" H N N 170 U H3 H N N 171 U H5 H N N 172 U H6 H N N 173 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 NCO CO N1 sing N N 118 NCO CO N2 sing N N 119 NCO CO N3 sing N N 120 NCO CO N4 sing N N 121 NCO CO N5 sing N N 122 NCO CO N6 sing N N 123 NCO N1 HN11 sing N N 124 NCO N1 HN12 sing N N 125 NCO N1 HN13 sing N N 126 NCO N2 HN21 sing N N 127 NCO N2 HN22 sing N N 128 NCO N2 HN23 sing N N 129 NCO N3 HN31 sing N N 130 NCO N3 HN32 sing N N 131 NCO N3 HN33 sing N N 132 NCO N4 HN41 sing N N 133 NCO N4 HN42 sing N N 134 NCO N4 HN43 sing N N 135 NCO N5 HN51 sing N N 136 NCO N5 HN52 sing N N 137 NCO N5 HN53 sing N N 138 NCO N6 HN61 sing N N 139 NCO N6 HN62 sing N N 140 NCO N6 HN63 sing N N 141 U OP3 P sing N N 142 U OP3 HOP3 sing N N 143 U P OP1 doub N N 144 U P OP2 sing N N 145 U P "O5'" sing N N 146 U OP2 HOP2 sing N N 147 U "O5'" "C5'" sing N N 148 U "C5'" "C4'" sing N N 149 U "C5'" "H5'" sing N N 150 U "C5'" "H5''" sing N N 151 U "C4'" "O4'" sing N N 152 U "C4'" "C3'" sing N N 153 U "C4'" "H4'" sing N N 154 U "O4'" "C1'" sing N N 155 U "C3'" "O3'" sing N N 156 U "C3'" "C2'" sing N N 157 U "C3'" "H3'" sing N N 158 U "O3'" "HO3'" sing N N 159 U "C2'" "O2'" sing N N 160 U "C2'" "C1'" sing N N 161 U "C2'" "H2'" sing N N 162 U "O2'" "HO2'" sing N N 163 U "C1'" N1 sing N N 164 U "C1'" "H1'" sing N N 165 U N1 C2 sing N N 166 U N1 C6 sing N N 167 U C2 O2 doub N N 168 U C2 N3 sing N N 169 U N3 C4 sing N N 170 U N3 H3 sing N N 171 U C4 O4 doub N N 172 U C4 C5 sing N N 173 U C5 C6 doub N N 174 U C5 H5 sing N N 175 U C6 H6 sing N N 176 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9JA7 'double helix' 9JA7 'a-form double helix' 9JA7 tetraloop 9JA7 'bulge loop' 9JA7 'mismatched base pair' 9JA7 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 33 1_555 -0.203 -0.453 -0.040 -5.428 -4.767 -2.529 1 A_G1:C33_A A 1 ? A 33 ? 19 1 1 A G 2 1_555 A C 32 1_555 -0.306 -0.351 -0.233 -7.570 -13.939 -0.714 2 A_G2:C32_A A 2 ? A 32 ? 19 1 1 A C 3 1_555 A G 31 1_555 -0.004 -0.157 -0.071 -2.822 -7.147 -0.211 3 A_C3:G31_A A 3 ? A 31 ? 19 1 1 A G 4 1_555 A C 30 1_555 -0.361 -0.366 -0.133 -6.254 -7.076 -2.770 4 A_G4:C30_A A 4 ? A 30 ? 19 1 1 A A 5 1_555 A G 29 1_555 -0.350 1.375 -0.235 2.319 -13.001 -13.495 5 A_A5:G29_A A 5 ? A 29 ? 8 1 1 A U 23 1_555 A A 28 1_555 -0.875 3.512 0.328 0.784 -7.699 -73.696 6 A_U23:A28_A A 23 ? A 28 ? 23 3 1 A A 7 1_555 A C 22 1_555 -3.368 -0.730 -0.348 -5.431 -0.615 -94.878 7 A_A7:C22_A A 7 ? A 22 ? 25 4 1 A C 8 1_555 A G 26 1_555 0.398 -0.091 -0.097 17.030 -19.124 0.553 8 A_C8:G26_A A 8 ? A 26 ? 19 1 1 A C 9 1_555 A G 25 1_555 -0.387 -0.293 0.053 4.206 -7.076 -0.090 9 A_C9:G25_A A 9 ? A 25 ? 19 1 1 A A 10 1_555 A C 21 1_555 -4.396 -0.529 0.047 10.399 -0.887 4.390 10 A_A10:C21_A A 10 ? A 21 ? ? 1 1 A G 11 1_555 A C 20 1_555 -0.420 -0.154 -0.018 6.969 -12.986 2.428 11 A_G11:C20_A A 11 ? A 20 ? 19 1 1 A C 12 1_555 A G 19 1_555 0.091 -0.186 -0.362 4.135 -15.346 2.052 12 A_C12:G19_A A 12 ? A 19 ? 19 1 1 A C 13 1_555 A G 18 1_555 0.536 -0.200 -0.009 -0.965 -3.082 4.985 13 A_C13:G18_A A 13 ? A 18 ? 19 1 1 A G 14 1_555 A A 17 1_555 7.136 -5.003 0.860 13.084 -1.191 -22.586 14 A_G14:A17_A A 14 ? A 17 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 33 1_555 A G 2 1_555 A C 32 1_555 -0.746 -1.881 3.302 -0.605 9.025 29.539 -5.164 1.292 2.641 17.199 1.153 30.864 1 AA_G1G2:C32C33_AA A 1 ? A 33 ? A 2 ? A 32 ? 1 A G 2 1_555 A C 32 1_555 A C 3 1_555 A G 31 1_555 0.255 -1.743 3.194 -0.047 7.921 30.521 -4.556 -0.477 2.668 14.738 0.087 31.509 2 AA_G2C3:G31C32_AA A 2 ? A 32 ? A 3 ? A 31 ? 1 A C 3 1_555 A G 31 1_555 A G 4 1_555 A C 30 1_555 0.859 -1.679 3.370 4.132 6.306 31.325 -4.150 -0.814 3.068 11.472 -7.516 32.198 3 AA_C3G4:C30G31_AA A 3 ? A 31 ? A 4 ? A 30 ? 1 A G 4 1_555 A C 30 1_555 A A 5 1_555 A G 29 1_555 -0.553 -2.355 3.143 2.682 2.622 26.446 -5.725 1.837 2.832 5.694 -5.824 26.706 4 AA_G4A5:G29C30_AA A 4 ? A 30 ? A 5 ? A 29 ? 1 A A 5 1_555 A G 29 1_555 A U 23 1_555 A A 28 1_555 0.491 -4.596 0.647 -113.917 -129.244 125.576 -2.059 -0.457 2.001 -64.942 57.240 176.473 5 AA_A5U23:A28G29_AA A 5 ? A 29 ? A 23 ? A 28 ? 1 A U 23 1_555 A A 28 1_555 A A 7 1_555 A C 22 1_555 0.987 3.675 0.783 -169.291 7.052 -38.931 -1.872 -0.153 1.047 -3.673 -88.159 -170.043 6 AA_U23A7:C22A28_AA A 23 ? A 28 ? A 7 ? A 22 ? 1 A A 7 1_555 A C 22 1_555 A C 8 1_555 A G 26 1_555 -1.587 -2.069 2.735 0.419 14.758 -16.272 -0.786 -3.993 3.447 -42.456 1.204 -21.938 7 AA_A7C8:G26C22_AA A 7 ? A 22 ? A 8 ? A 26 ? 1 A C 8 1_555 A G 26 1_555 A C 9 1_555 A G 25 1_555 -0.122 -2.476 3.479 -3.877 12.619 26.693 -7.218 -0.497 2.115 25.450 7.818 29.726 8 AA_C8C9:G25G26_AA A 8 ? A 26 ? A 9 ? A 25 ? 1 A C 9 1_555 A G 25 1_555 A A 10 1_555 A C 21 1_555 3.707 -0.627 3.173 -2.930 -1.061 44.056 -0.741 -5.187 2.946 -1.412 3.900 44.161 9 AA_C9A10:C21G25_AA A 9 ? A 25 ? A 10 ? A 21 ? 1 A A 10 1_555 A C 21 1_555 A G 11 1_555 A C 20 1_555 0.134 -1.469 3.460 -3.154 5.111 44.044 -2.431 -0.478 3.262 6.778 4.183 44.431 10 AA_A10G11:C20C21_AA A 10 ? A 21 ? A 11 ? A 20 ? 1 A G 11 1_555 A C 20 1_555 A C 12 1_555 A G 19 1_555 -0.213 -1.788 3.447 1.384 -2.061 35.471 -2.607 0.564 3.531 -3.377 -2.268 35.555 11 AA_G11C12:G19C20_AA A 11 ? A 20 ? A 12 ? A 19 ? 1 A C 12 1_555 A G 19 1_555 A C 13 1_555 A G 18 1_555 -0.035 -1.955 3.572 -2.302 6.415 29.912 -5.001 -0.402 3.090 12.229 4.389 30.661 12 AA_C12C13:G18G19_AA A 12 ? A 19 ? A 13 ? A 18 ? 1 A C 13 1_555 A G 18 1_555 A G 14 1_555 A A 17 1_555 -2.794 -1.125 2.875 0.467 10.209 46.754 -2.073 3.480 2.563 12.688 -0.580 47.796 13 AA_C13G14:A17G18_AA A 13 ? A 18 ? A 14 ? A 17 ? # _pdbx_audit_support.funding_organization 'Japan Agency for Medical Research and Development (AMED)' _pdbx_audit_support.country Japan _pdbx_audit_support.grant_number JP23ama121014 _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9JA7 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.021311 _atom_sites.fract_transf_matrix[1][2] 0.012304 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.024607 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.005548 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C CO K N O P # loop_ #