data_9K8N # _entry.id 9K8N # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.406 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9K8N pdb_00009k8n 10.2210/pdb9k8n/pdb WWPDB D_1300052942 ? ? BMRB 36699 ? 10.13018/BMR36699 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-10-29 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9K8N _pdbx_database_status.recvd_initial_deposition_date 2024-10-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Solution structure of a short zinc-dependent DNAzyme minGAA' _pdbx_database_related.db_id 36699 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email k-yamasaki@aist.go.jp _pdbx_contact_author.name_first Kazuhiko _pdbx_contact_author.name_last Yamasaki _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-0320-9697 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Yamasaki, K.' 1 ? 'Yamasaki, T.' 2 ? 'Takeuchi, K.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'A minimal Zn2+-dependent RNA-cleaving DNAzyme and its B-DNA-like crystal and solution structures' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Yamasaki, K.' 1 ? primary 'Inomata, R.' 2 ? primary 'Yamasaki, T.' 3 ? primary 'Kubota, T.' 4 ? primary 'Miyashita, N.' 5 ? primary 'Takeuchi, K.' 6 ? primary 'Miyagishi, M.' 7 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'DNAzyme minGAA' 8094.208 1 ? ? ? ? 2 non-polymer syn 'ZINC ION' 65.409 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type 'polydeoxyribonucleotide/polyribonucleotide hybrid' _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(DG)(DG)(DA)(DT)(DC)(DA)(DC)(DC)(DC)(DG)(DC)(DG)(DA)(DA)(DG)(DC)(DG)(OMG)AA(DG) (DG)(DA)(DT)(DC)(DC) ; _entity_poly.pdbx_seq_one_letter_code_can GGATCACCCGCGAAGCGGAAGGATCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'ZINC ION' _pdbx_entity_nonpoly.comp_id ZN # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DG n 1 3 DA n 1 4 DT n 1 5 DC n 1 6 DA n 1 7 DC n 1 8 DC n 1 9 DC n 1 10 DG n 1 11 DC n 1 12 DG n 1 13 DA n 1 14 DA n 1 15 DG n 1 16 DC n 1 17 DG n 1 18 OMG n 1 19 A n 1 20 A n 1 21 DG n 1 22 DG n 1 23 DA n 1 24 DT n 1 25 DC n 1 26 DC n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 26 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 OMG 'RNA linking' n "O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE" ? 'C11 H16 N5 O8 P' 377.247 ZN non-polymer . 'ZINC ION' ? 'Zn 2' 65.409 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DG 2 2 2 DG DG A . n A 1 3 DA 3 3 3 DA DA A . n A 1 4 DT 4 4 4 DT DT A . n A 1 5 DC 5 5 5 DC DC A . n A 1 6 DA 6 6 6 DA DA A . n A 1 7 DC 7 7 7 DC DC A . n A 1 8 DC 8 8 8 DC DC A . n A 1 9 DC 9 9 9 DC DC A . n A 1 10 DG 10 10 10 DG DG A . n A 1 11 DC 11 11 11 DC DC A . n A 1 12 DG 12 12 12 DG DG A . n A 1 13 DA 13 13 13 DA DA A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DG 15 15 15 DG DG A . n A 1 16 DC 16 16 16 DC DC A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 OMG 18 18 18 OMG OMG A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 DG 21 21 21 DG DG A . n A 1 22 DG 22 22 22 DG DG A . n A 1 23 DA 23 23 23 DA DA A . n A 1 24 DT 24 24 24 DT DT A . n A 1 25 DC 25 25 25 DC DC A . n A 1 26 DC 26 26 26 DC DC A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id ZN _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id ZN _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id ZN _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 27 _pdbx_nonpoly_scheme.pdb_mon_id ZN _pdbx_nonpoly_scheme.auth_mon_id ZN2 _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9K8N _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9K8N _struct.title 'Solution structure of a short zinc-dependent DNAzyme minGAA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9K8N _struct_keywords.text 'DNAzyme, RNA cleavage, Zinc-dependent, DNA-RNA HYBRID' _struct_keywords.pdbx_keywords 'DNA-RNA HYBRID' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9K8N _struct_ref.pdbx_db_accession 9K8N _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9K8N _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 26 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9K8N _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 26 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 26 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DG 17 "O3'" ? ? ? 1_555 A OMG 18 P ? ? A DG 17 A OMG 18 1_555 ? ? ? ? ? ? ? 1.611 ? ? covale2 covale both ? A OMG 18 "O3'" ? ? ? 1_555 A A 19 P ? ? A OMG 18 A A 19 1_555 ? ? ? ? ? ? ? 1.607 ? ? metalc1 metalc ? ? A DG 21 N7 ? ? ? 1_555 B ZN . ZN ? ? A DG 21 A ZN 101 1_555 ? ? ? ? ? ? ? 2.299 ? ? hydrog1 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DC 26 N3 ? ? A DG 1 A DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DC 26 O2 ? ? A DG 1 A DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DC 26 N4 ? ? A DG 1 A DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DC 25 N3 ? ? A DG 2 A DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DC 25 O2 ? ? A DG 2 A DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DC 25 N4 ? ? A DG 2 A DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 3 N1 ? ? ? 1_555 A DT 24 N3 ? ? A DA 3 A DT 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DA 3 N6 ? ? ? 1_555 A DT 24 O4 ? ? A DA 3 A DT 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DT 4 N3 ? ? ? 1_555 A DA 23 N1 ? ? A DT 4 A DA 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DT 4 O4 ? ? ? 1_555 A DA 23 N6 ? ? A DT 4 A DA 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DC 5 N3 ? ? ? 1_555 A DG 22 N1 ? ? A DC 5 A DG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DC 5 N4 ? ? ? 1_555 A DG 22 O6 ? ? A DC 5 A DG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DC 5 O2 ? ? ? 1_555 A DG 22 N2 ? ? A DC 5 A DG 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DA 6 N1 ? ? ? 1_555 A DG 21 N1 ? ? A DA 6 A DG 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog15 hydrog ? ? A DA 6 N6 ? ? ? 1_555 A DG 21 O6 ? ? A DA 6 A DG 21 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog16 hydrog ? ? A DC 8 N3 ? ? ? 1_555 A OMG 18 N1 ? ? A DC 8 A OMG 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 N4 ? ? ? 1_555 A OMG 18 O6 ? ? A DC 8 A OMG 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 8 O2 ? ? ? 1_555 A OMG 18 N2 ? ? A DC 8 A OMG 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DC 8 O2 ? ? ? 1_555 A DG 21 N2 ? ? A DC 8 A DG 21 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? hydrog20 hydrog ? ? A DC 9 N3 ? ? ? 1_555 A DG 17 N1 ? ? A DC 9 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DC 9 N4 ? ? ? 1_555 A DG 17 O6 ? ? A DC 9 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A DC 9 O2 ? ? ? 1_555 A DG 17 N2 ? ? A DC 9 A DG 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A DG 10 N1 ? ? ? 1_555 A DC 16 N3 ? ? A DG 10 A DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A DG 10 N2 ? ? ? 1_555 A DC 16 O2 ? ? A DG 10 A DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A DG 10 O6 ? ? ? 1_555 A DC 16 N4 ? ? A DG 10 A DC 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DC 11 N3 ? ? ? 1_555 A DG 15 N1 ? ? A DC 11 A DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DC 11 N4 ? ? ? 1_555 A DG 15 O6 ? ? A DC 11 A DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A DC 11 O2 ? ? ? 1_555 A DG 15 N2 ? ? A DC 11 A DG 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A DG 12 N2 ? ? ? 1_555 A DA 14 N7 ? ? A DG 12 A DA 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog30 hydrog ? ? A DG 12 N3 ? ? ? 1_555 A DA 14 N6 ? ? A DG 12 A DA 14 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog31 hydrog ? ? A OMG 18 N3 ? ? ? 1_555 A A 20 N6 ? ? A OMG 18 A A 20 1_555 ? ? ? ? ? ? 'OMG-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9K8N _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_nmr_ensemble.entry_id 9K8N _pdbx_nmr_ensemble.conformers_calculated_total_number 100 _pdbx_nmr_ensemble.conformers_submitted_total_number 20 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the least restraint violations' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9K8N _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # _pdbx_nmr_sample_details.solution_id 1 _pdbx_nmr_sample_details.contents '0.44 mM NA DNAzyme minGAA, 10 mM deuterated Tris-D11, 1 mM NA ZnCl2, 0.1 mM NA DSS, 95% H2O/5% D2O' _pdbx_nmr_sample_details.solvent_system '95% H2O/5% D2O' _pdbx_nmr_sample_details.label unlabeled _pdbx_nmr_sample_details.type solution _pdbx_nmr_sample_details.details ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'DNAzyme minGAA' 0.44 ? mM NA 1 Tris-D11 10 ? mM deuterated 1 ZnCl2 1 ? mM NA 1 DSS 0.1 ? mM NA # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units atm _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 7.0 _pdbx_nmr_exptl_sample_conditions.ionic_strength 11 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units mM _pdbx_nmr_exptl_sample_conditions.label condition_1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 1 '2D 1H-1H TOCSY' 1 isotropic 3 1 1 '2D DQF-COSY' 1 isotropic 4 1 1 '2D 1H-13C HSQC' 1 isotropic # _pdbx_nmr_refine.entry_id 9K8N _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 refinement CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 2 'structure calculation' CNS 1.3 'Brunger, Adams, Clore, Gros, Nilges and Read' 3 'chemical shift assignment' Felix ? 'Accelrys Software Inc.' 4 'peak picking' Felix ? 'Accelrys Software Inc.' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 DA OP3 O N N 38 DA P P N N 39 DA OP1 O N N 40 DA OP2 O N N 41 DA "O5'" O N N 42 DA "C5'" C N N 43 DA "C4'" C N R 44 DA "O4'" O N N 45 DA "C3'" C N S 46 DA "O3'" O N N 47 DA "C2'" C N N 48 DA "C1'" C N R 49 DA N9 N Y N 50 DA C8 C Y N 51 DA N7 N Y N 52 DA C5 C Y N 53 DA C6 C Y N 54 DA N6 N N N 55 DA N1 N Y N 56 DA C2 C Y N 57 DA N3 N Y N 58 DA C4 C Y N 59 DA HOP3 H N N 60 DA HOP2 H N N 61 DA "H5'" H N N 62 DA "H5''" H N N 63 DA "H4'" H N N 64 DA "H3'" H N N 65 DA "HO3'" H N N 66 DA "H2'" H N N 67 DA "H2''" H N N 68 DA "H1'" H N N 69 DA H8 H N N 70 DA H61 H N N 71 DA H62 H N N 72 DA H2 H N N 73 DC OP3 O N N 74 DC P P N N 75 DC OP1 O N N 76 DC OP2 O N N 77 DC "O5'" O N N 78 DC "C5'" C N N 79 DC "C4'" C N R 80 DC "O4'" O N N 81 DC "C3'" C N S 82 DC "O3'" O N N 83 DC "C2'" C N N 84 DC "C1'" C N R 85 DC N1 N N N 86 DC C2 C N N 87 DC O2 O N N 88 DC N3 N N N 89 DC C4 C N N 90 DC N4 N N N 91 DC C5 C N N 92 DC C6 C N N 93 DC HOP3 H N N 94 DC HOP2 H N N 95 DC "H5'" H N N 96 DC "H5''" H N N 97 DC "H4'" H N N 98 DC "H3'" H N N 99 DC "HO3'" H N N 100 DC "H2'" H N N 101 DC "H2''" H N N 102 DC "H1'" H N N 103 DC H41 H N N 104 DC H42 H N N 105 DC H5 H N N 106 DC H6 H N N 107 DG OP3 O N N 108 DG P P N N 109 DG OP1 O N N 110 DG OP2 O N N 111 DG "O5'" O N N 112 DG "C5'" C N N 113 DG "C4'" C N R 114 DG "O4'" O N N 115 DG "C3'" C N S 116 DG "O3'" O N N 117 DG "C2'" C N N 118 DG "C1'" C N R 119 DG N9 N Y N 120 DG C8 C Y N 121 DG N7 N Y N 122 DG C5 C Y N 123 DG C6 C N N 124 DG O6 O N N 125 DG N1 N N N 126 DG C2 C N N 127 DG N2 N N N 128 DG N3 N N N 129 DG C4 C Y N 130 DG HOP3 H N N 131 DG HOP2 H N N 132 DG "H5'" H N N 133 DG "H5''" H N N 134 DG "H4'" H N N 135 DG "H3'" H N N 136 DG "HO3'" H N N 137 DG "H2'" H N N 138 DG "H2''" H N N 139 DG "H1'" H N N 140 DG H8 H N N 141 DG H1 H N N 142 DG H21 H N N 143 DG H22 H N N 144 DT OP3 O N N 145 DT P P N N 146 DT OP1 O N N 147 DT OP2 O N N 148 DT "O5'" O N N 149 DT "C5'" C N N 150 DT "C4'" C N R 151 DT "O4'" O N N 152 DT "C3'" C N S 153 DT "O3'" O N N 154 DT "C2'" C N N 155 DT "C1'" C N R 156 DT N1 N N N 157 DT C2 C N N 158 DT O2 O N N 159 DT N3 N N N 160 DT C4 C N N 161 DT O4 O N N 162 DT C5 C N N 163 DT C7 C N N 164 DT C6 C N N 165 DT HOP3 H N N 166 DT HOP2 H N N 167 DT "H5'" H N N 168 DT "H5''" H N N 169 DT "H4'" H N N 170 DT "H3'" H N N 171 DT "HO3'" H N N 172 DT "H2'" H N N 173 DT "H2''" H N N 174 DT "H1'" H N N 175 DT H3 H N N 176 DT H71 H N N 177 DT H72 H N N 178 DT H73 H N N 179 DT H6 H N N 180 OMG P P N N 181 OMG OP1 O N N 182 OMG OP2 O N N 183 OMG OP3 O N N 184 OMG "O5'" O N N 185 OMG "C5'" C N N 186 OMG "C4'" C N R 187 OMG "O4'" O N N 188 OMG "C3'" C N R 189 OMG "O3'" O N N 190 OMG "C2'" C N R 191 OMG "O2'" O N N 192 OMG CM2 C N N 193 OMG "C1'" C N R 194 OMG N9 N Y N 195 OMG C8 C Y N 196 OMG N7 N Y N 197 OMG C5 C Y N 198 OMG C6 C N N 199 OMG O6 O N N 200 OMG N1 N N N 201 OMG C2 C N N 202 OMG N2 N N N 203 OMG N3 N N N 204 OMG C4 C Y N 205 OMG HOP2 H N N 206 OMG HOP3 H N N 207 OMG "H5'" H N N 208 OMG "H5''" H N N 209 OMG "H4'" H N N 210 OMG "H3'" H N N 211 OMG "HO3'" H N N 212 OMG "H2'" H N N 213 OMG HM21 H N N 214 OMG HM22 H N N 215 OMG HM23 H N N 216 OMG "H1'" H N N 217 OMG H8 H N N 218 OMG HN1 H N N 219 OMG HN21 H N N 220 OMG HN22 H N N 221 ZN ZN ZN N N 222 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 DA OP3 P sing N N 40 DA OP3 HOP3 sing N N 41 DA P OP1 doub N N 42 DA P OP2 sing N N 43 DA P "O5'" sing N N 44 DA OP2 HOP2 sing N N 45 DA "O5'" "C5'" sing N N 46 DA "C5'" "C4'" sing N N 47 DA "C5'" "H5'" sing N N 48 DA "C5'" "H5''" sing N N 49 DA "C4'" "O4'" sing N N 50 DA "C4'" "C3'" sing N N 51 DA "C4'" "H4'" sing N N 52 DA "O4'" "C1'" sing N N 53 DA "C3'" "O3'" sing N N 54 DA "C3'" "C2'" sing N N 55 DA "C3'" "H3'" sing N N 56 DA "O3'" "HO3'" sing N N 57 DA "C2'" "C1'" sing N N 58 DA "C2'" "H2'" sing N N 59 DA "C2'" "H2''" sing N N 60 DA "C1'" N9 sing N N 61 DA "C1'" "H1'" sing N N 62 DA N9 C8 sing Y N 63 DA N9 C4 sing Y N 64 DA C8 N7 doub Y N 65 DA C8 H8 sing N N 66 DA N7 C5 sing Y N 67 DA C5 C6 sing Y N 68 DA C5 C4 doub Y N 69 DA C6 N6 sing N N 70 DA C6 N1 doub Y N 71 DA N6 H61 sing N N 72 DA N6 H62 sing N N 73 DA N1 C2 sing Y N 74 DA C2 N3 doub Y N 75 DA C2 H2 sing N N 76 DA N3 C4 sing Y N 77 DC OP3 P sing N N 78 DC OP3 HOP3 sing N N 79 DC P OP1 doub N N 80 DC P OP2 sing N N 81 DC P "O5'" sing N N 82 DC OP2 HOP2 sing N N 83 DC "O5'" "C5'" sing N N 84 DC "C5'" "C4'" sing N N 85 DC "C5'" "H5'" sing N N 86 DC "C5'" "H5''" sing N N 87 DC "C4'" "O4'" sing N N 88 DC "C4'" "C3'" sing N N 89 DC "C4'" "H4'" sing N N 90 DC "O4'" "C1'" sing N N 91 DC "C3'" "O3'" sing N N 92 DC "C3'" "C2'" sing N N 93 DC "C3'" "H3'" sing N N 94 DC "O3'" "HO3'" sing N N 95 DC "C2'" "C1'" sing N N 96 DC "C2'" "H2'" sing N N 97 DC "C2'" "H2''" sing N N 98 DC "C1'" N1 sing N N 99 DC "C1'" "H1'" sing N N 100 DC N1 C2 sing N N 101 DC N1 C6 sing N N 102 DC C2 O2 doub N N 103 DC C2 N3 sing N N 104 DC N3 C4 doub N N 105 DC C4 N4 sing N N 106 DC C4 C5 sing N N 107 DC N4 H41 sing N N 108 DC N4 H42 sing N N 109 DC C5 C6 doub N N 110 DC C5 H5 sing N N 111 DC C6 H6 sing N N 112 DG OP3 P sing N N 113 DG OP3 HOP3 sing N N 114 DG P OP1 doub N N 115 DG P OP2 sing N N 116 DG P "O5'" sing N N 117 DG OP2 HOP2 sing N N 118 DG "O5'" "C5'" sing N N 119 DG "C5'" "C4'" sing N N 120 DG "C5'" "H5'" sing N N 121 DG "C5'" "H5''" sing N N 122 DG "C4'" "O4'" sing N N 123 DG "C4'" "C3'" sing N N 124 DG "C4'" "H4'" sing N N 125 DG "O4'" "C1'" sing N N 126 DG "C3'" "O3'" sing N N 127 DG "C3'" "C2'" sing N N 128 DG "C3'" "H3'" sing N N 129 DG "O3'" "HO3'" sing N N 130 DG "C2'" "C1'" sing N N 131 DG "C2'" "H2'" sing N N 132 DG "C2'" "H2''" sing N N 133 DG "C1'" N9 sing N N 134 DG "C1'" "H1'" sing N N 135 DG N9 C8 sing Y N 136 DG N9 C4 sing Y N 137 DG C8 N7 doub Y N 138 DG C8 H8 sing N N 139 DG N7 C5 sing Y N 140 DG C5 C6 sing N N 141 DG C5 C4 doub Y N 142 DG C6 O6 doub N N 143 DG C6 N1 sing N N 144 DG N1 C2 sing N N 145 DG N1 H1 sing N N 146 DG C2 N2 sing N N 147 DG C2 N3 doub N N 148 DG N2 H21 sing N N 149 DG N2 H22 sing N N 150 DG N3 C4 sing N N 151 DT OP3 P sing N N 152 DT OP3 HOP3 sing N N 153 DT P OP1 doub N N 154 DT P OP2 sing N N 155 DT P "O5'" sing N N 156 DT OP2 HOP2 sing N N 157 DT "O5'" "C5'" sing N N 158 DT "C5'" "C4'" sing N N 159 DT "C5'" "H5'" sing N N 160 DT "C5'" "H5''" sing N N 161 DT "C4'" "O4'" sing N N 162 DT "C4'" "C3'" sing N N 163 DT "C4'" "H4'" sing N N 164 DT "O4'" "C1'" sing N N 165 DT "C3'" "O3'" sing N N 166 DT "C3'" "C2'" sing N N 167 DT "C3'" "H3'" sing N N 168 DT "O3'" "HO3'" sing N N 169 DT "C2'" "C1'" sing N N 170 DT "C2'" "H2'" sing N N 171 DT "C2'" "H2''" sing N N 172 DT "C1'" N1 sing N N 173 DT "C1'" "H1'" sing N N 174 DT N1 C2 sing N N 175 DT N1 C6 sing N N 176 DT C2 O2 doub N N 177 DT C2 N3 sing N N 178 DT N3 C4 sing N N 179 DT N3 H3 sing N N 180 DT C4 O4 doub N N 181 DT C4 C5 sing N N 182 DT C5 C7 sing N N 183 DT C5 C6 doub N N 184 DT C7 H71 sing N N 185 DT C7 H72 sing N N 186 DT C7 H73 sing N N 187 DT C6 H6 sing N N 188 OMG P OP1 doub N N 189 OMG P OP2 sing N N 190 OMG P OP3 sing N N 191 OMG P "O5'" sing N N 192 OMG OP2 HOP2 sing N N 193 OMG OP3 HOP3 sing N N 194 OMG "O5'" "C5'" sing N N 195 OMG "C5'" "C4'" sing N N 196 OMG "C5'" "H5'" sing N N 197 OMG "C5'" "H5''" sing N N 198 OMG "C4'" "O4'" sing N N 199 OMG "C4'" "C3'" sing N N 200 OMG "C4'" "H4'" sing N N 201 OMG "O4'" "C1'" sing N N 202 OMG "C3'" "O3'" sing N N 203 OMG "C3'" "C2'" sing N N 204 OMG "C3'" "H3'" sing N N 205 OMG "O3'" "HO3'" sing N N 206 OMG "C2'" "O2'" sing N N 207 OMG "C2'" "C1'" sing N N 208 OMG "C2'" "H2'" sing N N 209 OMG "O2'" CM2 sing N N 210 OMG CM2 HM21 sing N N 211 OMG CM2 HM22 sing N N 212 OMG CM2 HM23 sing N N 213 OMG "C1'" N9 sing N N 214 OMG "C1'" "H1'" sing N N 215 OMG N9 C8 sing Y N 216 OMG N9 C4 sing Y N 217 OMG C8 N7 doub Y N 218 OMG C8 H8 sing N N 219 OMG N7 C5 sing Y N 220 OMG C5 C6 sing N N 221 OMG C5 C4 doub Y N 222 OMG C6 O6 doub N N 223 OMG C6 N1 sing N N 224 OMG N1 C2 sing N N 225 OMG N1 HN1 sing N N 226 OMG C2 N2 sing N N 227 OMG C2 N3 doub N N 228 OMG N2 HN21 sing N N 229 OMG N2 HN22 sing N N 230 OMG N3 C4 sing N N 231 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9K8N 'double helix' 9K8N 'b-form double helix' 9K8N 'hairpin loop' 9K8N 'mismatched base pair' 9K8N 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 1 1_555 A DC 26 1_555 -1.104 -0.505 -0.207 -7.254 0.481 -3.539 1 A_DG1:DC26_A A 1 ? A 26 ? 19 1 1 A DG 2 1_555 A DC 25 1_555 -0.534 -0.131 0.121 4.780 3.370 1.010 2 A_DG2:DC25_A A 2 ? A 25 ? 19 1 1 A DA 3 1_555 A DT 24 1_555 -0.390 -0.132 0.147 -1.398 6.478 -7.746 3 A_DA3:DT24_A A 3 ? A 24 ? 20 1 1 A DT 4 1_555 A DA 23 1_555 0.968 -0.434 0.347 -4.646 11.864 -2.614 4 A_DT4:DA23_A A 4 ? A 23 ? 20 1 1 A DC 5 1_555 A DG 22 1_555 0.082 -0.132 0.501 1.303 -10.715 -0.813 5 A_DC5:DG22_A A 5 ? A 22 ? 19 1 1 A DA 6 1_555 A DG 21 1_555 0.240 1.864 -0.812 -5.031 -43.705 -9.821 6 A_DA6:DG21_A A 6 ? A 21 ? 8 1 1 A DC 8 1_555 A OMG 18 1_555 -0.174 0.010 -0.038 3.912 -1.787 -0.985 7 A_DC8:OMG18_A A 8 ? A 18 ? 19 1 1 A DC 9 1_555 A DG 17 1_555 0.436 -0.187 0.315 -8.377 8.981 -4.128 8 A_DC9:DG17_A A 9 ? A 17 ? 19 1 1 A DG 10 1_555 A DC 16 1_555 -0.597 -0.208 -0.787 -16.835 1.397 -3.341 9 A_DG10:DC16_A A 10 ? A 16 ? 19 1 1 A DC 11 1_555 A DG 15 1_555 0.772 -0.251 0.006 -2.674 8.928 0.802 10 A_DC11:DG15_A A 11 ? A 15 ? 19 1 1 A DG 12 1_555 A DA 14 1_555 6.547 -4.639 1.657 17.991 -25.417 13.831 11 A_DG12:DA14_A A 12 ? A 14 ? 11 9 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 1 1_555 A DC 26 1_555 A DG 2 1_555 A DC 25 1_555 -0.346 0.234 3.419 -5.054 14.716 31.821 -1.950 -0.232 3.232 25.054 8.604 35.332 1 AA_DG1DG2:DC25DC26_AA A 1 ? A 26 ? A 2 ? A 25 ? 1 A DG 2 1_555 A DC 25 1_555 A DA 3 1_555 A DT 24 1_555 -1.167 -0.101 3.645 -4.784 21.153 32.811 -3.043 1.086 3.158 33.305 7.533 39.165 2 AA_DG2DA3:DT24DC25_AA A 2 ? A 25 ? A 3 ? A 24 ? 1 A DA 3 1_555 A DT 24 1_555 A DT 4 1_555 A DA 23 1_555 0.809 -0.459 4.416 0.371 0.001 34.574 -0.773 -1.284 4.424 0.002 -0.624 34.576 3 AA_DA3DT4:DA23DT24_AA A 3 ? A 24 ? A 4 ? A 23 ? 1 A DT 4 1_555 A DA 23 1_555 A DC 5 1_555 A DG 22 1_555 -0.318 -0.058 3.499 1.460 12.548 27.634 -2.808 0.921 3.156 24.701 -2.873 30.333 4 AA_DT4DC5:DG22DA23_AA A 4 ? A 23 ? A 5 ? A 22 ? 1 A DC 5 1_555 A DG 22 1_555 A DA 6 1_555 A DG 21 1_555 -1.500 0.962 4.112 3.685 -12.945 39.828 2.957 2.554 3.501 -18.377 -5.232 41.953 5 AA_DC5DA6:DG21DG22_AA A 5 ? A 22 ? A 6 ? A 21 ? 1 A DA 6 1_555 A DG 21 1_555 A DC 8 1_555 A OMG 18 1_555 2.166 3.607 2.395 -3.745 -24.300 91.304 2.744 -1.525 1.551 -16.750 2.581 93.845 6 AA_DA6DC8:OMG18DG21_AA A 6 ? A 21 ? A 8 ? A 18 ? 1 A DC 8 1_555 A OMG 18 1_555 A DC 9 1_555 A DG 17 1_555 -0.127 0.188 4.903 -2.927 -13.899 40.167 2.369 -0.269 4.594 -19.515 4.110 42.507 7 AA_DC8DC9:DG17OMG18_AA A 8 ? A 18 ? A 9 ? A 17 ? 1 A DC 9 1_555 A DG 17 1_555 A DG 10 1_555 A DC 16 1_555 -0.663 0.096 4.165 1.265 12.774 29.582 -2.745 1.485 3.847 23.664 -2.344 32.191 8 AA_DC9DG10:DC16DG17_AA A 9 ? A 17 ? A 10 ? A 16 ? 1 A DG 10 1_555 A DC 16 1_555 A DC 11 1_555 A DG 15 1_555 0.014 -0.067 3.716 -5.332 -4.355 36.613 0.553 -0.827 3.662 -6.858 8.397 37.232 9 AA_DG10DC11:DG15DC16_AA A 10 ? A 16 ? A 11 ? A 15 ? 1 A DC 11 1_555 A DG 15 1_555 A DG 12 1_555 A DA 14 1_555 -0.282 2.696 2.969 5.165 6.471 56.124 2.498 0.570 3.201 6.836 -5.456 56.683 10 AA_DC11DG12:DA14DG15_AA A 11 ? A 15 ? A 12 ? A 14 ? # _pdbx_audit_support.funding_organization 'Not funded' _pdbx_audit_support.country ? _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_nmr_spectrometer.spectrometer_id 1 _pdbx_nmr_spectrometer.model 'AVANCE III HD' _pdbx_nmr_spectrometer.type ? _pdbx_nmr_spectrometer.manufacturer Bruker _pdbx_nmr_spectrometer.field_strength 900 _pdbx_nmr_spectrometer.details ? # _atom_sites.entry_id 9K8N _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P ZN # loop_ #