data_9L8F # _entry.id 9L8F # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.414 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9L8F pdb_00009l8f 10.2210/pdb9l8f/pdb WWPDB D_1300055102 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-07-01 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9L8F _pdbx_database_status.recvd_initial_deposition_date 2024-12-27 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible N # _pdbx_contact_author.id 3 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of RhoBAST aptamer in complex with TMR' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (57-MER)' 18574.088 1 ? ? ? ? 2 non-polymer syn 'SELENIUM ATOM' 78.960 7 ? ? ? ? 3 non-polymer syn '[9-(2-carboxyphenyl)-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium' 387.451 1 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 3 ? ? ? ? 5 water nat water 18.015 10 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GDP)GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC' _entity_poly.pdbx_seq_one_letter_code_can GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id U _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'SELENIUM ATOM' SE 3 '[9-(2-carboxyphenyl)-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium' A1EI4 4 'MAGNESIUM ION' MG 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GDP n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 C n 1 7 U n 1 8 C n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 G n 1 18 G n 1 19 C n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 G n 1 32 G n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 G n 1 39 G n 1 40 U n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 A n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 57 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 A1EI4 non-polymer . '[9-(2-carboxyphenyl)-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium' '9-(2-carboxyphenyl)-3,6-bis(dimethylamino)xanthylium' 'C24 H23 N2 O3 1' 387.451 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GDP 'RNA linking' n "GUANOSINE-5'-DIPHOSPHATE" ? 'C10 H15 N5 O11 P2' 443.201 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 SE non-polymer . 'SELENIUM ATOM' ? Se 78.960 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GDP 1 1 1 GDP GDP U . n A 1 2 G 2 2 2 G G U . n A 1 3 A 3 3 3 A A U . n A 1 4 A 4 4 4 A A U . n A 1 5 C 5 5 5 C C U . n A 1 6 C 6 6 6 C C U . n A 1 7 U 7 7 7 U U U . n A 1 8 C 8 8 8 C C U . n A 1 9 C 9 9 9 C C U . n A 1 10 G 10 10 10 G G U . n A 1 11 C 11 11 11 C C U . n A 1 12 C 12 12 12 C C U . n A 1 13 G 13 13 13 G G U . n A 1 14 A 14 14 14 A A U . n A 1 15 A 15 15 15 A A U . n A 1 16 A 16 16 16 A A U . n A 1 17 G 17 17 17 G G U . n A 1 18 G 18 18 18 G G U . n A 1 19 C 19 19 19 C C U . n A 1 20 G 20 20 20 G G U . n A 1 21 G 21 21 21 G G U . n A 1 22 U 22 22 22 U U U . n A 1 23 G 23 23 23 G G U . n A 1 24 A 24 24 24 A A U . n A 1 25 A 25 25 25 A A U . n A 1 26 G 26 26 26 G G U . n A 1 27 G 27 27 27 G G U . n A 1 28 A 28 28 28 A A U . n A 1 29 G 29 29 29 G G U . n A 1 30 A 30 30 30 A A U . n A 1 31 G 31 31 31 G G U . n A 1 32 G 32 32 32 G G U . n A 1 33 C 33 33 33 C C U . n A 1 34 G 34 34 34 G G U . n A 1 35 C 35 35 35 C C U . n A 1 36 A 36 36 36 A A U . n A 1 37 A 37 37 37 A A U . n A 1 38 G 38 38 38 G G U . n A 1 39 G 39 39 39 G G U . n A 1 40 U 40 40 40 U U U . n A 1 41 U 41 41 41 U U U . n A 1 42 A 42 42 42 A A U . n A 1 43 A 43 43 43 A A U . n A 1 44 C 44 44 44 C C U . n A 1 45 C 45 45 45 C C U . n A 1 46 G 46 46 46 G G U . n A 1 47 C 47 47 47 C C U . n A 1 48 C 48 48 48 C C U . n A 1 49 U 49 49 49 U U U . n A 1 50 C 50 50 50 C C U . n A 1 51 A 51 51 51 A A U . n A 1 52 G 52 52 52 G G U . n A 1 53 G 53 53 53 G G U . n A 1 54 U 54 54 54 U U U . n A 1 55 U 55 55 55 U U U . n A 1 56 C 56 56 56 C C U . n A 1 57 C 57 57 57 C C U . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id A1EI4 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id A1EI4 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 SE 1 101 21 SE SE U . C 2 SE 1 102 22 SE SE U . D 2 SE 1 103 23 SE SE U . E 2 SE 1 104 24 SE SE U . F 2 SE 1 105 25 SE SE U . G 2 SE 1 106 26 SE SE U . H 2 SE 1 107 27 SE SE U . I 3 A1EI4 1 108 1 A1EI4 TMR U . J 4 MG 1 109 1 MG MG U . K 4 MG 1 110 2 MG MG U . L 4 MG 1 111 3 MG MG U . M 5 HOH 1 201 31 HOH HOH U . M 5 HOH 2 202 26 HOH HOH U . M 5 HOH 3 203 27 HOH HOH U . M 5 HOH 4 204 24 HOH HOH U . M 5 HOH 5 205 28 HOH HOH U . M 5 HOH 6 206 29 HOH HOH U . M 5 HOH 7 207 30 HOH HOH U . M 5 HOH 8 208 25 HOH HOH U . M 5 HOH 9 209 11 HOH HOH U . M 5 HOH 10 210 23 HOH HOH U . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9L8F _cell.details ? _cell.formula_units_Z ? _cell.length_a 84.462 _cell.length_a_esd ? _cell.length_b 84.462 _cell.length_b_esd ? _cell.length_c 107.316 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9L8F _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9L8F _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 3.13 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 58.65 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '0.01 M Magnesium sulfate heptahydrate, 0.05 M Sodium cacodylate trihydrate pH 7.1, 2.2 M Ammonium sulfate' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER2 S 9M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2023-03-25 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.9792 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL02U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.9792 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL02U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9L8F _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.51 _reflns.d_resolution_low 43.27 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 36717 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 94.5 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 35.5 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 41.1 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.072 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.51 _reflns_shell.d_res_low 2.65 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 36717 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.818 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9L8F _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.51 _refine.ls_d_res_low 30.22 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 13843 _refine.ls_number_reflns_R_free 660 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 94.45 _refine.ls_percent_reflns_R_free 4.77 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2312 _refine.ls_R_factor_R_free 0.2600 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2294 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 34.31 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.51 _refine_hist.d_res_low 30.22 _refine_hist.number_atoms_solvent 10 _refine_hist.number_atoms_total 1282 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1233 _refine_hist.pdbx_number_atoms_ligand 39 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 ? ? ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.262 ? ? ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 16.537 ? 706 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.059 ? 284 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.009 ? 75 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.51 2.65 . . 120 2061 99.00 . . . . 0.5393 . . . . . . . . . . . 0.6127 'X-RAY DIFFRACTION' 2.71 2.98 . . 138 2734 100.00 . . . . 0.38 . . . . . . . . . . . 0.3813 'X-RAY DIFFRACTION' 2.98 3.41 . . 125 2810 100.00 . . . . 0.2853 . . . . . . . . . . . 0.2923 'X-RAY DIFFRACTION' 3.41 4.29 . . 141 2777 100.00 . . . . 0.2259 . . . . . . . . . . . 0.2822 'X-RAY DIFFRACTION' 4.29 30.22 . . 136 2801 100.00 . . . . 0.1619 . . . . . . . . . . . 0.1895 # _struct.entry_id 9L8F _struct.title 'Crystal structure of RhoBAST aptamer in complex with TMR' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9L8F _struct_keywords.text 'Aptamer, RhoBAST, TMR, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? I N N 3 ? J N N 4 ? K N N 4 ? L N N 4 ? M N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9L8F _struct_ref.pdbx_db_accession 9L8F _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9L8F _struct_ref_seq.pdbx_strand_id U _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9L8F _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 3430 ? 1 MORE -104 ? 1 'SSA (A^2)' 19460 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H,I,J,K,L,M # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 10_666 -y+1,-x+1,-z+7/6 0.5000000000 -0.8660254038 0.0000000000 42.2310000000 -0.8660254038 -0.5000000000 0.0000000000 73.1462376544 0.0000000000 0.0000000000 -1.0000000000 125.2020000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GDP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? U GDP 1 U G 2 1_555 ? ? ? ? ? ? ? 1.558 ? ? metalc1 metalc ? ? A C 6 OP2 ? ? ? 1_555 K MG . MG ? ? U C 6 U MG 110 1_555 ? ? ? ? ? ? ? 1.785 ? ? metalc2 metalc ? ? A U 7 OP1 ? ? ? 1_555 J MG . MG ? ? U U 7 U MG 109 1_555 ? ? ? ? ? ? ? 2.646 ? ? metalc3 metalc ? ? A U 7 OP2 ? ? ? 1_555 J MG . MG ? ? U U 7 U MG 109 1_555 ? ? ? ? ? ? ? 2.143 ? ? metalc4 metalc ? ? A G 27 OP1 ? ? ? 1_555 L MG . MG ? ? U G 27 U MG 111 1_555 ? ? ? ? ? ? ? 1.923 ? ? metalc5 metalc ? ? A G 27 "O5'" ? ? ? 1_555 L MG . MG ? ? U G 27 U MG 111 1_555 ? ? ? ? ? ? ? 2.203 ? ? hydrog1 hydrog ? ? A GDP 1 N1 ? ? ? 1_555 A C 57 N3 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GDP 1 N2 ? ? ? 1_555 A C 57 O2 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GDP 1 O6 ? ? ? 1_555 A C 57 N4 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 55 N3 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 55 O4 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 54 N3 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 54 O4 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 53 N1 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 53 O6 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 53 N2 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 52 N1 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 52 O6 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 52 N2 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 51 N1 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 51 N6 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 20 N1 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 20 O6 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 20 N2 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 18 N1 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 18 O6 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 18 N2 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? U G 13 U A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog35 hydrog ? ? A G 13 N3 ? ? ? 1_555 A A 16 N6 ? ? U G 13 U A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog36 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 24 N1 ? ? ? 1_555 A A 42 N6 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 42 N7 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog43 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 43 N7 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog44 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 43 N6 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog45 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 35 N3 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 35 O2 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 35 N4 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 50 N3 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 29 N2 ? ? ? 1_555 A C 50 O2 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 29 O6 ? ? ? 1_555 A C 50 N4 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 49 N3 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 49 O4 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 48 N3 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 48 O2 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 48 N4 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog57 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 46 N1 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 46 O6 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 46 N2 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 39 N3 ? ? ? 1_555 A U 41 N3 ? ? U G 39 U U 41 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 7 ? U U 7 ? 1_555 MG ? J MG . ? U MG 109 ? 1_555 OP2 ? A U 7 ? U U 7 ? 1_555 64.4 ? 2 OP1 ? A G 27 ? U G 27 ? 1_555 MG ? L MG . ? U MG 111 ? 1_555 "O5'" ? A G 27 ? U G 27 ? 1_555 75.9 ? # _pdbx_entry_details.entry_id 9L8F _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O3'" U G 26 ? ? MG U MG 111 ? ? 1.69 2 1 N3 U G 38 ? ? O U HOH 201 ? ? 1.99 3 1 N3 U G 21 ? ? O U HOH 202 ? ? 2.12 4 1 "O2'" U C 6 ? ? O U HOH 203 ? ? 2.17 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" U GDP 1 ? ? "O3'" U GDP 1 ? ? P U G 2 ? ? 100.07 119.70 -19.63 1.20 Y 2 1 "O3'" U GDP 1 ? ? P U G 2 ? ? "O5'" U G 2 ? ? 130.87 104.00 26.87 1.90 Y 3 1 "O3'" U GDP 1 ? ? P U G 2 ? ? OP1 U G 2 ? ? 85.19 105.20 -20.01 2.20 Y # _pdbx_struct_special_symmetry.id 1 _pdbx_struct_special_symmetry.PDB_model_num 1 _pdbx_struct_special_symmetry.auth_asym_id U _pdbx_struct_special_symmetry.auth_comp_id SE _pdbx_struct_special_symmetry.auth_seq_id 105 _pdbx_struct_special_symmetry.PDB_ins_code ? _pdbx_struct_special_symmetry.label_asym_id F _pdbx_struct_special_symmetry.label_comp_id SE _pdbx_struct_special_symmetry.label_seq_id . # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 A1EI4 C1 C N N 38 A1EI4 C3 C N N 39 A1EI4 C4 C N N 40 A1EI4 C5 C N N 41 A1EI4 C6 C N N 42 A1EI4 C7 C N N 43 A1EI4 C10 C Y N 44 A1EI4 C11 C Y N 45 A1EI4 C12 C Y N 46 A1EI4 C13 C Y N 47 A1EI4 C14 C Y N 48 A1EI4 C15 C N N 49 A1EI4 C18 C Y N 50 A1EI4 C19 C Y N 51 A1EI4 C20 C Y N 52 A1EI4 C21 C Y N 53 A1EI4 C23 C N N 54 A1EI4 C24 C N N 55 A1EI4 C25 C Y N 56 A1EI4 C26 C Y N 57 A1EI4 C28 C N N 58 A1EI4 C29 C N N 59 A1EI4 C8 C N N 60 A1EI4 C9 C Y N 61 A1EI4 N2 N N N 62 A1EI4 N22 N N N 63 A1EI4 O16 O N N 64 A1EI4 O17 O N N 65 A1EI4 O27 O N N 66 A1EI4 H1 H N N 67 A1EI4 H2 H N N 68 A1EI4 H3 H N N 69 A1EI4 H4 H N N 70 A1EI4 H5 H N N 71 A1EI4 H6 H N N 72 A1EI4 H7 H N N 73 A1EI4 H8 H N N 74 A1EI4 H9 H N N 75 A1EI4 H10 H N N 76 A1EI4 H11 H N N 77 A1EI4 H12 H N N 78 A1EI4 H13 H N N 79 A1EI4 H14 H N N 80 A1EI4 H15 H N N 81 A1EI4 H16 H N N 82 A1EI4 H17 H N N 83 A1EI4 H18 H N N 84 A1EI4 H19 H N N 85 A1EI4 H20 H N N 86 A1EI4 H21 H N N 87 A1EI4 H22 H N N 88 A1EI4 H23 H N N 89 C OP3 O N N 90 C P P N N 91 C OP1 O N N 92 C OP2 O N N 93 C "O5'" O N N 94 C "C5'" C N N 95 C "C4'" C N R 96 C "O4'" O N N 97 C "C3'" C N S 98 C "O3'" O N N 99 C "C2'" C N R 100 C "O2'" O N N 101 C "C1'" C N R 102 C N1 N N N 103 C C2 C N N 104 C O2 O N N 105 C N3 N N N 106 C C4 C N N 107 C N4 N N N 108 C C5 C N N 109 C C6 C N N 110 C HOP3 H N N 111 C HOP2 H N N 112 C "H5'" H N N 113 C "H5''" H N N 114 C "H4'" H N N 115 C "H3'" H N N 116 C "HO3'" H N N 117 C "H2'" H N N 118 C "HO2'" H N N 119 C "H1'" H N N 120 C H41 H N N 121 C H42 H N N 122 C H5 H N N 123 C H6 H N N 124 G OP3 O N N 125 G P P N N 126 G OP1 O N N 127 G OP2 O N N 128 G "O5'" O N N 129 G "C5'" C N N 130 G "C4'" C N R 131 G "O4'" O N N 132 G "C3'" C N S 133 G "O3'" O N N 134 G "C2'" C N R 135 G "O2'" O N N 136 G "C1'" C N R 137 G N9 N Y N 138 G C8 C Y N 139 G N7 N Y N 140 G C5 C Y N 141 G C6 C N N 142 G O6 O N N 143 G N1 N N N 144 G C2 C N N 145 G N2 N N N 146 G N3 N N N 147 G C4 C Y N 148 G HOP3 H N N 149 G HOP2 H N N 150 G "H5'" H N N 151 G "H5''" H N N 152 G "H4'" H N N 153 G "H3'" H N N 154 G "HO3'" H N N 155 G "H2'" H N N 156 G "HO2'" H N N 157 G "H1'" H N N 158 G H8 H N N 159 G H1 H N N 160 G H21 H N N 161 G H22 H N N 162 GDP PB P N N 163 GDP O1B O N N 164 GDP O2B O N N 165 GDP O3B O N N 166 GDP O3A O N N 167 GDP PA P N N 168 GDP O1A O N N 169 GDP O2A O N N 170 GDP "O5'" O N N 171 GDP "C5'" C N N 172 GDP "C4'" C N R 173 GDP "O4'" O N N 174 GDP "C3'" C N S 175 GDP "O3'" O N N 176 GDP "C2'" C N R 177 GDP "O2'" O N N 178 GDP "C1'" C N R 179 GDP N9 N Y N 180 GDP C8 C Y N 181 GDP N7 N Y N 182 GDP C5 C Y N 183 GDP C6 C N N 184 GDP O6 O N N 185 GDP N1 N N N 186 GDP C2 C N N 187 GDP N2 N N N 188 GDP N3 N N N 189 GDP C4 C Y N 190 GDP HOB2 H N N 191 GDP HOB3 H N N 192 GDP HOA2 H N N 193 GDP "H5'" H N N 194 GDP "H5''" H N N 195 GDP "H4'" H N N 196 GDP "H3'" H N N 197 GDP "HO3'" H N N 198 GDP "H2'" H N N 199 GDP "HO2'" H N N 200 GDP "H1'" H N N 201 GDP H8 H N N 202 GDP HN1 H N N 203 GDP HN21 H N N 204 GDP HN22 H N N 205 HOH O O N N 206 HOH H1 H N N 207 HOH H2 H N N 208 MG MG MG N N 209 SE SE SE N N 210 U OP3 O N N 211 U P P N N 212 U OP1 O N N 213 U OP2 O N N 214 U "O5'" O N N 215 U "C5'" C N N 216 U "C4'" C N R 217 U "O4'" O N N 218 U "C3'" C N S 219 U "O3'" O N N 220 U "C2'" C N R 221 U "O2'" O N N 222 U "C1'" C N R 223 U N1 N N N 224 U C2 C N N 225 U O2 O N N 226 U N3 N N N 227 U C4 C N N 228 U O4 O N N 229 U C5 C N N 230 U C6 C N N 231 U HOP3 H N N 232 U HOP2 H N N 233 U "H5'" H N N 234 U "H5''" H N N 235 U "H4'" H N N 236 U "H3'" H N N 237 U "HO3'" H N N 238 U "H2'" H N N 239 U "HO2'" H N N 240 U "H1'" H N N 241 U H3 H N N 242 U H5 H N N 243 U H6 H N N 244 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 A1EI4 C11 C12 doub Y N 40 A1EI4 C11 C10 sing Y N 41 A1EI4 C12 C13 sing Y N 42 A1EI4 C10 C9 doub Y N 43 A1EI4 C13 C14 doub Y N 44 A1EI4 C6 C5 doub N N 45 A1EI4 C6 C7 sing N N 46 A1EI4 C9 C14 sing Y N 47 A1EI4 C9 C8 sing N N 48 A1EI4 C5 C4 sing N N 49 A1EI4 C1 N2 sing N N 50 A1EI4 C14 C15 sing N N 51 A1EI4 C7 C8 doub N N 52 A1EI4 C7 C28 sing N N 53 A1EI4 C8 C18 sing N N 54 A1EI4 C4 N2 doub N N 55 A1EI4 C4 C29 sing N N 56 A1EI4 N2 C3 sing N N 57 A1EI4 C28 C29 doub N N 58 A1EI4 C28 O27 sing N N 59 A1EI4 C15 O17 doub N N 60 A1EI4 C15 O16 sing N N 61 A1EI4 C18 C19 doub Y N 62 A1EI4 C18 C26 sing Y N 63 A1EI4 C19 C20 sing Y N 64 A1EI4 O27 C26 sing N N 65 A1EI4 C26 C25 doub Y N 66 A1EI4 C20 C21 doub Y N 67 A1EI4 C25 C21 sing Y N 68 A1EI4 C21 N22 sing N N 69 A1EI4 N22 C24 sing N N 70 A1EI4 N22 C23 sing N N 71 A1EI4 C1 H1 sing N N 72 A1EI4 C1 H2 sing N N 73 A1EI4 C1 H3 sing N N 74 A1EI4 C3 H4 sing N N 75 A1EI4 C3 H5 sing N N 76 A1EI4 C3 H6 sing N N 77 A1EI4 C5 H7 sing N N 78 A1EI4 C6 H8 sing N N 79 A1EI4 C10 H9 sing N N 80 A1EI4 C11 H10 sing N N 81 A1EI4 C12 H11 sing N N 82 A1EI4 C13 H12 sing N N 83 A1EI4 C19 H13 sing N N 84 A1EI4 C20 H14 sing N N 85 A1EI4 C23 H15 sing N N 86 A1EI4 C23 H16 sing N N 87 A1EI4 C23 H17 sing N N 88 A1EI4 C24 H18 sing N N 89 A1EI4 C24 H19 sing N N 90 A1EI4 C24 H20 sing N N 91 A1EI4 C25 H21 sing N N 92 A1EI4 C29 H22 sing N N 93 A1EI4 O16 H23 sing N N 94 C OP3 P sing N N 95 C OP3 HOP3 sing N N 96 C P OP1 doub N N 97 C P OP2 sing N N 98 C P "O5'" sing N N 99 C OP2 HOP2 sing N N 100 C "O5'" "C5'" sing N N 101 C "C5'" "C4'" sing N N 102 C "C5'" "H5'" sing N N 103 C "C5'" "H5''" sing N N 104 C "C4'" "O4'" sing N N 105 C "C4'" "C3'" sing N N 106 C "C4'" "H4'" sing N N 107 C "O4'" "C1'" sing N N 108 C "C3'" "O3'" sing N N 109 C "C3'" "C2'" sing N N 110 C "C3'" "H3'" sing N N 111 C "O3'" "HO3'" sing N N 112 C "C2'" "O2'" sing N N 113 C "C2'" "C1'" sing N N 114 C "C2'" "H2'" sing N N 115 C "O2'" "HO2'" sing N N 116 C "C1'" N1 sing N N 117 C "C1'" "H1'" sing N N 118 C N1 C2 sing N N 119 C N1 C6 sing N N 120 C C2 O2 doub N N 121 C C2 N3 sing N N 122 C N3 C4 doub N N 123 C C4 N4 sing N N 124 C C4 C5 sing N N 125 C N4 H41 sing N N 126 C N4 H42 sing N N 127 C C5 C6 doub N N 128 C C5 H5 sing N N 129 C C6 H6 sing N N 130 G OP3 P sing N N 131 G OP3 HOP3 sing N N 132 G P OP1 doub N N 133 G P OP2 sing N N 134 G P "O5'" sing N N 135 G OP2 HOP2 sing N N 136 G "O5'" "C5'" sing N N 137 G "C5'" "C4'" sing N N 138 G "C5'" "H5'" sing N N 139 G "C5'" "H5''" sing N N 140 G "C4'" "O4'" sing N N 141 G "C4'" "C3'" sing N N 142 G "C4'" "H4'" sing N N 143 G "O4'" "C1'" sing N N 144 G "C3'" "O3'" sing N N 145 G "C3'" "C2'" sing N N 146 G "C3'" "H3'" sing N N 147 G "O3'" "HO3'" sing N N 148 G "C2'" "O2'" sing N N 149 G "C2'" "C1'" sing N N 150 G "C2'" "H2'" sing N N 151 G "O2'" "HO2'" sing N N 152 G "C1'" N9 sing N N 153 G "C1'" "H1'" sing N N 154 G N9 C8 sing Y N 155 G N9 C4 sing Y N 156 G C8 N7 doub Y N 157 G C8 H8 sing N N 158 G N7 C5 sing Y N 159 G C5 C6 sing N N 160 G C5 C4 doub Y N 161 G C6 O6 doub N N 162 G C6 N1 sing N N 163 G N1 C2 sing N N 164 G N1 H1 sing N N 165 G C2 N2 sing N N 166 G C2 N3 doub N N 167 G N2 H21 sing N N 168 G N2 H22 sing N N 169 G N3 C4 sing N N 170 GDP PB O1B doub N N 171 GDP PB O2B sing N N 172 GDP PB O3B sing N N 173 GDP PB O3A sing N N 174 GDP O2B HOB2 sing N N 175 GDP O3B HOB3 sing N N 176 GDP O3A PA sing N N 177 GDP PA O1A doub N N 178 GDP PA O2A sing N N 179 GDP PA "O5'" sing N N 180 GDP O2A HOA2 sing N N 181 GDP "O5'" "C5'" sing N N 182 GDP "C5'" "C4'" sing N N 183 GDP "C5'" "H5'" sing N N 184 GDP "C5'" "H5''" sing N N 185 GDP "C4'" "O4'" sing N N 186 GDP "C4'" "C3'" sing N N 187 GDP "C4'" "H4'" sing N N 188 GDP "O4'" "C1'" sing N N 189 GDP "C3'" "O3'" sing N N 190 GDP "C3'" "C2'" sing N N 191 GDP "C3'" "H3'" sing N N 192 GDP "O3'" "HO3'" sing N N 193 GDP "C2'" "O2'" sing N N 194 GDP "C2'" "C1'" sing N N 195 GDP "C2'" "H2'" sing N N 196 GDP "O2'" "HO2'" sing N N 197 GDP "C1'" N9 sing N N 198 GDP "C1'" "H1'" sing N N 199 GDP N9 C8 sing Y N 200 GDP N9 C4 sing Y N 201 GDP C8 N7 doub Y N 202 GDP C8 H8 sing N N 203 GDP N7 C5 sing Y N 204 GDP C5 C6 sing N N 205 GDP C5 C4 doub Y N 206 GDP C6 O6 doub N N 207 GDP C6 N1 sing N N 208 GDP N1 C2 sing N N 209 GDP N1 HN1 sing N N 210 GDP C2 N2 sing N N 211 GDP C2 N3 doub N N 212 GDP N2 HN21 sing N N 213 GDP N2 HN22 sing N N 214 GDP N3 C4 sing N N 215 HOH O H1 sing N N 216 HOH O H2 sing N N 217 U OP3 P sing N N 218 U OP3 HOP3 sing N N 219 U P OP1 doub N N 220 U P OP2 sing N N 221 U P "O5'" sing N N 222 U OP2 HOP2 sing N N 223 U "O5'" "C5'" sing N N 224 U "C5'" "C4'" sing N N 225 U "C5'" "H5'" sing N N 226 U "C5'" "H5''" sing N N 227 U "C4'" "O4'" sing N N 228 U "C4'" "C3'" sing N N 229 U "C4'" "H4'" sing N N 230 U "O4'" "C1'" sing N N 231 U "C3'" "O3'" sing N N 232 U "C3'" "C2'" sing N N 233 U "C3'" "H3'" sing N N 234 U "O3'" "HO3'" sing N N 235 U "C2'" "O2'" sing N N 236 U "C2'" "C1'" sing N N 237 U "C2'" "H2'" sing N N 238 U "O2'" "HO2'" sing N N 239 U "C1'" N1 sing N N 240 U "C1'" "H1'" sing N N 241 U N1 C2 sing N N 242 U N1 C6 sing N N 243 U C2 O2 doub N N 244 U C2 N3 sing N N 245 U N3 C4 sing N N 246 U N3 H3 sing N N 247 U C4 O4 doub N N 248 U C4 C5 sing N N 249 U C5 C6 doub N N 250 U C5 H5 sing N N 251 U C6 H6 sing N N 252 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9L8F 'double helix' 9L8F 'a-form double helix' 9L8F 'hairpin loop' 9L8F tetraloop 9L8F 'bulge loop' 9L8F 'mismatched base pair' 9L8F 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GDP 1 1_555 A C 57 1_555 0.145 0.127 0.027 -2.639 -18.556 -13.718 1 U_GDP1:C57_U U 1 ? U 57 ? 19 1 1 A G 2 1_555 A C 56 1_555 0.265 -0.150 0.306 -12.143 -16.989 -3.902 2 U_G2:C56_U U 2 ? U 56 ? 19 1 1 A A 3 1_555 A U 55 1_555 -1.041 -0.492 0.547 -1.007 -19.402 0.799 3 U_A3:U55_U U 3 ? U 55 ? 20 1 1 A A 4 1_555 A U 54 1_555 0.898 -0.114 -0.055 -5.983 -19.893 -15.937 4 U_A4:U54_U U 4 ? U 54 ? 20 1 1 A C 5 1_555 A G 53 1_555 0.543 0.028 -0.101 4.132 -19.588 6.278 5 U_C5:G53_U U 5 ? U 53 ? 19 1 1 A C 6 1_555 A G 52 1_555 0.668 -0.099 0.250 -2.792 -19.186 4.138 6 U_C6:G52_U U 6 ? U 52 ? 19 1 1 A U 7 1_555 A A 51 1_555 -0.050 0.030 0.086 -0.939 -5.671 -8.403 7 U_U7:A51_U U 7 ? U 51 ? 20 1 1 A G 29 1_555 A C 50 1_555 -0.094 -0.393 -0.307 -1.039 -8.532 -1.518 8 U_G29:C50_U U 29 ? U 50 ? 19 1 1 A A 30 1_555 A U 49 1_555 -0.361 0.071 0.195 -10.571 -12.339 12.811 9 U_A30:U49_U U 30 ? U 49 ? 20 1 1 A G 31 1_555 A C 48 1_555 0.183 -0.236 0.116 -9.362 -12.181 -2.696 10 U_G31:C48_U U 31 ? U 48 ? 19 1 1 A G 32 1_555 A C 47 1_555 0.297 4.670 0.320 -14.529 -6.935 -81.750 11 U_G32:C47_U U 32 ? U 47 ? ? ? 1 A C 33 1_555 A G 46 1_555 -0.222 -0.223 0.226 1.298 -16.467 -2.095 12 U_C33:G46_U U 33 ? U 46 ? 19 1 1 A G 34 1_555 A C 45 1_555 0.028 -0.288 0.104 0.118 -14.787 2.562 13 U_G34:C45_U U 34 ? U 45 ? 19 1 1 A C 35 1_555 A G 27 1_555 0.629 -0.490 0.159 -8.911 -1.372 2.576 14 U_C35:G27_U U 35 ? U 27 ? 19 1 1 A A 16 1_555 A G 13 1_555 -6.819 -4.641 0.593 -12.930 0.578 -13.564 15 U_A16:G13_U U 16 ? U 13 ? 11 10 1 A G 17 1_555 A C 12 1_555 0.250 0.001 -0.005 -1.102 -3.632 1.360 16 U_G17:C12_U U 17 ? U 12 ? 19 1 1 A G 18 1_555 A C 11 1_555 -0.239 -0.251 0.008 -0.005 -12.818 -1.007 17 U_G18:C11_U U 18 ? U 11 ? 19 1 1 A C 19 1_555 A G 10 1_555 0.345 -0.181 0.163 0.642 -14.352 -0.980 18 U_C19:G10_U U 19 ? U 10 ? 19 1 1 A G 20 1_555 A C 9 1_555 0.384 -0.075 0.229 -4.062 -14.239 0.838 19 U_G20:C9_U U 20 ? U 9 ? 19 1 1 A G 21 1_555 A C 8 1_555 -0.416 0.084 0.254 -9.158 -18.509 0.074 20 U_G21:C8_U U 21 ? U 8 ? 19 1 1 A U 22 1_555 A A 28 1_555 0.386 -0.229 0.592 -15.164 -8.148 -3.091 21 U_U22:A28_U U 22 ? U 28 ? 20 1 1 A G 23 1_555 A C 44 1_555 -0.196 -0.032 -0.453 -20.388 6.626 -5.265 22 U_G23:C44_U U 23 ? U 44 ? 19 1 1 A G 26 1_555 A A 43 1_555 6.500 -3.733 0.453 -23.628 -21.630 2.493 23 U_G26:A43_U U 26 ? U 43 ? 11 9 1 A A 24 1_555 A A 42 1_555 4.149 1.135 0.464 -4.857 0.023 -108.716 24 U_A24:A42_U U 24 ? U 42 ? 5 4 1 A G 39 1_555 A U 41 1_555 3.326 1.816 -1.318 18.903 56.036 119.782 25 U_G39:U41_U U 39 ? U 41 ? ? 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GDP 1 1_555 A C 57 1_555 A G 2 1_555 A C 56 1_555 -0.189 -2.383 3.343 -6.601 13.206 34.871 -5.219 -0.476 2.319 20.915 10.454 37.778 1 UU_GDP1G2:C56C57_UU U 1 ? U 57 ? U 2 ? U 56 ? 1 A G 2 1_555 A C 56 1_555 A A 3 1_555 A U 55 1_555 0.221 -1.363 3.008 -1.819 2.497 24.504 -3.869 -1.014 2.833 5.853 4.264 24.695 2 UU_G2A3:U55C56_UU U 2 ? U 56 ? U 3 ? U 55 ? 1 A A 3 1_555 A U 55 1_555 A A 4 1_555 A U 54 1_555 -1.288 -1.310 3.350 -1.327 7.684 42.631 -2.522 1.616 3.116 10.465 1.807 43.305 3 UU_A3A4:U54U55_UU U 3 ? U 55 ? U 4 ? U 54 ? 1 A A 4 1_555 A U 54 1_555 A C 5 1_555 A G 53 1_555 1.236 -1.170 3.041 2.249 3.085 27.914 -3.071 -2.052 2.986 6.358 -4.635 28.168 4 UU_A4C5:G53U54_UU U 4 ? U 54 ? U 5 ? U 53 ? 1 A C 5 1_555 A G 53 1_555 A C 6 1_555 A G 52 1_555 0.493 -1.353 3.348 0.271 9.348 37.213 -3.203 -0.718 2.939 14.372 -0.416 38.330 5 UU_C5C6:G52G53_UU U 5 ? U 53 ? U 6 ? U 52 ? 1 A C 6 1_555 A G 52 1_555 A U 7 1_555 A A 51 1_555 -0.688 -1.728 3.151 1.244 8.463 27.850 -5.075 1.610 2.496 17.080 -2.511 29.109 6 UU_C6U7:A51G52_UU U 6 ? U 52 ? U 7 ? U 51 ? 1 A U 7 1_555 A A 51 1_555 A G 29 1_555 A C 50 1_555 -1.436 -1.961 3.183 4.672 13.896 43.708 -3.549 2.187 2.331 18.070 -6.075 45.987 7 UU_U7G29:C50A51_UU U 7 ? U 51 ? U 29 ? U 50 ? 1 A G 29 1_555 A C 50 1_555 A A 30 1_555 A U 49 1_555 0.649 -2.224 3.287 -3.114 8.619 34.657 -4.753 -1.466 2.611 14.163 5.118 35.812 8 UU_G29A30:U49C50_UU U 29 ? U 50 ? U 30 ? U 49 ? 1 A A 30 1_555 A U 49 1_555 A G 31 1_555 A C 48 1_555 -1.216 -1.763 3.192 0.586 6.682 33.431 -3.988 2.162 2.777 11.473 -1.007 34.078 9 UU_A30G31:C48U49_UU U 30 ? U 49 ? U 31 ? U 48 ? 1 A G 31 1_555 A C 48 1_555 A G 32 1_555 A C 47 1_555 0.947 -3.087 2.724 5.969 7.767 72.912 -2.779 -0.639 2.491 6.507 -5.000 73.476 10 UU_G31G32:C47C48_UU U 31 ? U 48 ? U 32 ? U 47 ? 1 A G 32 1_555 A C 47 1_555 A C 33 1_555 A G 46 1_555 -0.492 1.039 3.336 -0.886 6.422 -12.341 -10.086 -2.830 2.448 -27.523 -3.799 -13.934 11 UU_G32C33:G46C47_UU U 32 ? U 47 ? U 33 ? U 46 ? 1 A C 33 1_555 A G 46 1_555 A G 34 1_555 A C 45 1_555 0.937 -1.643 3.229 3.722 11.140 30.979 -4.619 -1.066 2.592 19.979 -6.675 33.080 12 UU_C33G34:C45G46_UU U 33 ? U 46 ? U 34 ? U 45 ? 1 A G 34 1_555 A C 45 1_555 A C 35 1_555 A G 27 1_555 2.198 -1.037 3.449 5.444 -6.005 53.330 -0.733 -2.052 3.728 -6.647 -6.026 53.898 13 UU_G34C35:G27C45_UU U 34 ? U 45 ? U 35 ? U 27 ? 1 A A 16 1_555 A G 13 1_555 A G 17 1_555 A C 12 1_555 1.926 -1.082 3.064 2.393 4.425 49.897 -1.575 -2.112 3.047 5.229 -2.828 50.134 14 UU_A16G17:C12G13_UU U 16 ? U 13 ? U 17 ? U 12 ? 1 A G 17 1_555 A C 12 1_555 A G 18 1_555 A C 11 1_555 -0.609 -1.792 3.267 -0.516 3.933 28.151 -4.520 1.125 3.005 8.035 1.055 28.424 15 UU_G17G18:C11C12_UU U 17 ? U 12 ? U 18 ? U 11 ? 1 A G 18 1_555 A C 11 1_555 A C 19 1_555 A G 10 1_555 0.205 -1.566 3.302 0.842 5.394 33.935 -3.472 -0.220 3.028 9.168 -1.431 34.359 16 UU_G18C19:G10C11_UU U 18 ? U 11 ? U 19 ? U 10 ? 1 A C 19 1_555 A G 10 1_555 A G 20 1_555 A C 9 1_555 0.234 -1.862 3.262 0.576 7.405 27.981 -5.247 -0.351 2.694 14.982 -1.166 28.931 17 UU_C19G20:C9G10_UU U 19 ? U 10 ? U 20 ? U 9 ? 1 A G 20 1_555 A C 9 1_555 A G 21 1_555 A C 8 1_555 0.528 -1.900 3.233 4.214 5.792 29.004 -4.826 -0.197 2.855 11.347 -8.256 29.857 18 UU_G20G21:C8C9_UU U 20 ? U 9 ? U 21 ? U 8 ? 1 A G 21 1_555 A C 8 1_555 A U 22 1_555 A A 28 1_555 -0.638 -1.085 3.477 -0.873 -2.311 36.218 -1.394 0.893 3.551 -3.713 1.402 36.299 19 UU_G21U22:A28C8_UU U 21 ? U 8 ? U 22 ? U 28 ? 1 A U 22 1_555 A A 28 1_555 A G 23 1_555 A C 44 1_555 2.034 0.229 3.220 17.479 1.987 46.725 0.112 -1.010 3.719 2.408 -21.180 49.753 20 UU_U22G23:C44A28_UU U 22 ? U 28 ? U 23 ? U 44 ? 1 A G 23 1_555 A C 44 1_555 A G 26 1_555 A A 43 1_555 0.094 -0.281 3.852 6.553 28.978 64.164 -1.468 0.194 3.470 25.883 -5.853 70.036 21 UU_G23G26:A43C44_UU U 23 ? U 44 ? U 26 ? U 43 ? 1 A G 26 1_555 A A 43 1_555 A A 24 1_555 A A 42 1_555 -2.100 0.144 2.987 -0.215 1.678 -11.685 -2.737 -10.472 2.898 -8.184 -1.049 -11.807 22 UU_G26A24:A42A43_UU U 26 ? U 43 ? U 24 ? U 42 ? 1 A A 24 1_555 A A 42 1_555 A G 39 1_555 A U 41 1_555 0.986 0.196 6.654 19.879 -21.488 127.276 0.446 -0.233 6.668 -11.928 -11.035 129.112 23 UU_A24G39:U41A42_UU U 24 ? U 42 ? U 39 ? U 41 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9L8F _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.011840 _atom_sites.fract_transf_matrix[1][2] 0.006836 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013671 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009318 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P SE # loop_ #