data_9PDE # _entry.id 9PDE # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.410 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9PDE pdb_00009pde 10.2210/pdb9pde/pdb WWPDB D_1000294385 ? ? BMRB 31257 ? 10.13018/BMR31257 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-02-04 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9PDE _pdbx_database_status.recvd_initial_deposition_date 2025-06-30 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Three-dimensional structure of kinase inhibitor Palbociclib-HIV TAR complex' _pdbx_database_related.db_id 31257 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email varani@uw.edu _pdbx_contact_author.name_first Gabriele _pdbx_contact_author.name_last Varani _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-6642-7144 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Ramireddy, R.R.' 1 0000-0002-1259-0082 'Vidadala, V.N.' 2 0000-0002-1273-2829 'Chaubey, B.' 3 0000-0002-6655-0641 'Olsen, G.' 4 0000-0001-6039-8434 'Varani, G.' 5 0000-0001-6642-7144 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Three-dimensional structure of kinase inhibitor Palbociclib-HIV TAR complex' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Ramireddy, R.R.' 1 0000-0002-1259-0082 primary 'Vidadala, V.N.' 2 0000-0002-1273-2829 primary 'Chaubey, B.' 3 0000-0002-6655-0641 primary 'Olsen, G.' 4 0000-0001-6039-8434 primary 'Varani, G.' 5 0000-0001-6642-7144 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (29-MER)' 9340.562 1 ? ? ? ? 2 non-polymer syn '6-ACETYL-8-CYCLOPENTYL-5-METHYL-2-[(5-PIPERAZIN-1-YLPYRIDIN-2-YL)AMINO]PYRIDO[2,3-D]PYRIMIDIN-7(8H)-ONE' 447.533 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'GGCAGGU(CH)UGAGCCUGGGGGCUCUCUGCC' _entity_poly.pdbx_seq_one_letter_code_can GGCAGGUCUGAGCCUGGGGGCUCUCUGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name '6-ACETYL-8-CYCLOPENTYL-5-METHYL-2-[(5-PIPERAZIN-1-YLPYRIDIN-2-YL)AMINO]PYRIDO[2,3-D]PYRIMIDIN-7(8H)-ONE' _pdbx_entity_nonpoly.comp_id LQQ # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 A n 1 5 G n 1 6 G n 1 7 U n 1 8 CH n 1 9 U n 1 10 G n 1 11 A n 1 12 G n 1 13 C n 1 14 C n 1 15 U n 1 16 G n 1 17 G n 1 18 G n 1 19 G n 1 20 G n 1 21 C n 1 22 U n 1 23 C n 1 24 U n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 29 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CH 'RNA linking' n ;N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE ; ? 'C9 H15 N3 O8 P 1' 324.204 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 LQQ non-polymer . '6-ACETYL-8-CYCLOPENTYL-5-METHYL-2-[(5-PIPERAZIN-1-YLPYRIDIN-2-YL)AMINO]PYRIDO[2,3-D]PYRIMIDIN-7(8H)-ONE' Palbociclib 'C24 H29 N7 O2' 447.533 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 17 17 G G A . n A 1 2 G 2 18 18 G G A . n A 1 3 C 3 19 19 C C A . n A 1 4 A 4 20 20 A A A . n A 1 5 G 5 21 21 G G A . n A 1 6 G 6 22 22 G G A . n A 1 7 U 7 23 23 U U A . n A 1 8 CH 8 24 24 CH CH A . n A 1 9 U 9 25 25 U U A . n A 1 10 G 10 26 26 G G A . n A 1 11 A 11 27 27 A A A . n A 1 12 G 12 28 28 G G A . n A 1 13 C 13 29 29 C C A . n A 1 14 C 14 30 30 C C A . n A 1 15 U 15 31 31 U U A . n A 1 16 G 16 32 32 G G A . n A 1 17 G 17 33 33 G G A . n A 1 18 G 18 34 34 G G A . n A 1 19 G 19 35 35 G G A . n A 1 20 G 20 36 36 G G A . n A 1 21 C 21 37 37 C C A . n A 1 22 U 22 38 38 U U A . n A 1 23 C 23 39 39 C C A . n A 1 24 U 24 40 40 U U A . n A 1 25 C 25 41 41 C C A . n A 1 26 U 26 42 42 U U A . n A 1 27 G 27 43 43 G G A . n A 1 28 C 28 44 44 C C A . n A 1 29 C 29 45 45 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id LQQ _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id LQQ _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # _pdbx_nonpoly_scheme.asym_id B _pdbx_nonpoly_scheme.entity_id 2 _pdbx_nonpoly_scheme.mon_id LQQ _pdbx_nonpoly_scheme.ndb_seq_num 1 _pdbx_nonpoly_scheme.pdb_seq_num 101 _pdbx_nonpoly_scheme.auth_seq_num 117 _pdbx_nonpoly_scheme.pdb_mon_id LQQ _pdbx_nonpoly_scheme.auth_mon_id LQQ _pdbx_nonpoly_scheme.pdb_strand_id A _pdbx_nonpoly_scheme.pdb_ins_code . # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9PDE _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9PDE _struct.title 'Three-dimensional structure of kinase inhibitor Palbociclib-HIV TAR complex' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9PDE _struct_keywords.text 'Palbociclib, complex, HIV-1 TAR, RNA, small molecule-RNA complex' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9PDE _struct_ref.pdbx_db_accession 9PDE _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9PDE _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 29 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9PDE _struct_ref_seq.db_align_beg 17 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 45 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 17 _struct_ref_seq.pdbx_auth_seq_align_end 45 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0 _pdbx_struct_oper_list.matrix[1][2] 0.0 _pdbx_struct_oper_list.matrix[1][3] 0.0 _pdbx_struct_oper_list.vector[1] 0.0 _pdbx_struct_oper_list.matrix[2][1] 0.0 _pdbx_struct_oper_list.matrix[2][2] 1.0 _pdbx_struct_oper_list.matrix[2][3] 0.0 _pdbx_struct_oper_list.vector[2] 0.0 _pdbx_struct_oper_list.matrix[3][1] 0.0 _pdbx_struct_oper_list.matrix[3][2] 0.0 _pdbx_struct_oper_list.matrix[3][3] 1.0 _pdbx_struct_oper_list.vector[3] 0.0 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A U 7 "O3'" ? ? ? 1_555 A CH 8 P ? ? A U 23 A CH 24 1_555 ? ? ? ? ? ? ? 1.632 ? ? covale2 covale both ? A CH 8 "O3'" ? ? ? 1_555 A U 9 P ? ? A CH 24 A U 25 1_555 ? ? ? ? ? ? ? 1.608 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 29 N3 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 29 O2 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 29 N4 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 28 N3 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 28 O2 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 28 N4 ? ? A G 18 A C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 N3 ? ? ? 1_555 A G 27 N1 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 3 N4 ? ? ? 1_555 A G 27 O6 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 3 O2 ? ? ? 1_555 A G 27 N2 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 26 N3 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 26 O4 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N1 ? ? ? 1_555 A C 25 N3 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 N2 ? ? ? 1_555 A C 25 O2 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 5 O6 ? ? ? 1_555 A C 25 N4 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A G 6 N1 ? ? ? 1_555 A G 10 O6 ? ? A G 22 A G 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A G 6 N2 ? ? ? 1_555 A G 10 N7 ? ? A G 22 A G 26 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog17 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 22 A C 39 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog18 hydrog ? ? A U 7 N3 ? ? ? 1_555 A U 9 O2 ? ? A U 23 A U 25 1_555 ? ? ? ? ? ? TYPE_13_PAIR ? ? ? hydrog19 hydrog ? ? A U 7 O2 ? ? ? 1_555 A U 9 N3 ? ? A U 23 A U 25 1_555 ? ? ? ? ? ? TYPE_13_PAIR ? ? ? hydrog20 hydrog ? ? A U 7 O4 ? ? ? 1_555 A C 21 N4 ? ? A U 23 A C 37 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog21 hydrog ? ? A CH 8 N4 ? ? ? 1_555 A G 20 N7 ? ? A CH 24 A G 36 1_555 ? ? ? ? ? ? 'CH-G MISPAIR' ? ? ? hydrog22 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 23 N3 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 23 O2 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 23 N4 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 11 N1 ? ? ? 1_555 A U 22 N3 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A A 11 N6 ? ? ? 1_555 A U 22 O4 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 21 N3 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 21 O2 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 21 N4 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 20 N1 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 20 O6 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 20 N2 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 14 N3 ? ? ? 1_555 A G 19 N1 ? ? A C 30 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 14 N4 ? ? ? 1_555 A G 19 O6 ? ? A C 30 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 14 O2 ? ? ? 1_555 A G 19 N2 ? ? A C 30 A G 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9PDE _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_nmr_ensemble.entry_id 9PDE _pdbx_nmr_ensemble.conformers_calculated_total_number 200 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9PDE _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '0.9 mM HIV TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' 'HIV TAR RNA_Palbociclib_H2O complex' solution '1.8 mM Palbociclib (LQQ), 0.9 mM RNA (29-MER), 0.01 mM EDTA, 20 mM bis tris D19 buffer, 50 mM sodium chloride, 90%H2O/10%D2O' 2 '0.9 nM HIV TAR RNA (29-MER), 100% D2O' '100% D2O' 'HIV TAR RNA_Palbociclib_D2O complex' solution '1.8 mM Palbociclib (LQQ), 0.9 mM RNA (29-MER), 0.01 mM EDTA, 20 mM bis tris D19 buffer, 50 mM sodium chloride, 100%D2O' 3 '0.9 mM HIV TAR RNA (29-MER), 100% D2O' '100% D2O' 'HIV TAR RNA_Palbociclib_D2O complex2' solution '1.8 mM Palbociclib (LQQ), 0.9 mM RNA (29-MER), 0.01 mM EDTA, 20 mM sodium acetate buffer, 100% D2O' 4 '0.25 mM [U-99% 13C; U-99% 15N] HIV TAR RNA (29-MER), 100% D2O' '100% D2O' '13C/15N_labeled_HIV TAR RNA_Palbociclib_D2O complex' solution '0.5 mM Palbociclib (LQQ), 0.25 mM RNA (29-MER), 0.01 mM EDTA, 20 mM sodium acetate buffer, 100% D2O' 5 '0.25 mM [U-99% 13C; U-99% 15N] HIV TAR RNA (29-MER), 95% H2O/5% D2O' '95% H2O/5% D2O' '13C/15N_labeled_HIV TAR RNA_Palbociclib_H2O complex' solution '0.5 mM Palbociclib (LQQ), 0.25 mM RNA (29-MER), 0.01 mM EDTA, 20 mM bis tris D19 buffer, 50 mM sodium chloride, 95%H2O/5%D2O' 6 '0.9 mM [U-99% 2H] HIV TAR RNA (29-MER), 100% D2O' '100% D2O' 'Site specific 2H_labeled_HIV TAR RNA_Palbociclib_D2O complex' solution '1.8 mM Palbociclib (LQQ), 0.9 mM RNA (29-MER), 0.01 mM EDTA, 20 mM sodium acetate buffer, 100% D2O' 7 '0.9 mM [U-99% 2H] HIV TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' 'Site specific 2H_labeled_HIV TAR RNA_Palbociclib_H2O complex' solution '1.8 mM Palbociclib (LQQ), 0.9 mM RNA (29-MER), 0.01 mM EDTA, 20 mM bis tris D19 buffer, 50 mM sodium chloride, 90%H2O/10%D2O' 8 '0.35 mM [U-99% 2H] HIV TAR RNA (29-MER), 90% H2O/10% D2O' '90% H2O/10% D2O' 'Uniformly_2H_labeled_HIV TAR RNA_Palbociclib_D2O complex' solution '0.7 mM Palbociclib (LQQ), 0.35 mM RNA (29-MER), 0.01 mM EDTA, 20 mM bis tris D19 buffer, 50 mM sodium chloride, 90%H2O/10%D2O' 9 '0.35 mM [U-99% 2H] HIV TAR RNA (29-MER), 100% D2O' '100% D2O' 'Uniformly_2H_labeled_HIV TAR RNA_Palbociclib_H2O complex' solution '0.7 mM Palbociclib (LQQ), 0.35 mM RNA (29-MER), 00.01 mM EDTA, 20 mM sodium acetate buffer, 100% D2O' # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'HIV TAR RNA (29-MER)' 0.9 ? mM 'natural abundance' 2 'HIV TAR RNA (29-MER)' 0.9 ? nM 'natural abundance' 3 'HIV TAR RNA (29-MER)' 0.9 ? mM 'natural abundance' 4 'HIV TAR RNA (29-MER)' 0.25 ? mM '[U-99% 13C; U-99% 15N]' 5 'HIV TAR RNA (29-MER)' 0.25 ? mM '[U-99% 13C; U-99% 15N]' 6 'HIV TAR RNA (29-MER)' 0.9 ? mM '[U-99% 2H]' 7 'HIV TAR RNA (29-MER)' 0.9 ? mM '[U-99% 2H]' 8 'HIV TAR RNA (29-MER)' 0.35 ? mM '[U-99% 2H]' 9 'HIV TAR RNA (29-MER)' 0.35 ? mM '[U-99% 2H]' # loop_ _pdbx_nmr_exptl_sample_conditions.conditions_id _pdbx_nmr_exptl_sample_conditions.temperature _pdbx_nmr_exptl_sample_conditions.pressure_units _pdbx_nmr_exptl_sample_conditions.pressure _pdbx_nmr_exptl_sample_conditions.pH _pdbx_nmr_exptl_sample_conditions.ionic_strength _pdbx_nmr_exptl_sample_conditions.details _pdbx_nmr_exptl_sample_conditions.ionic_strength_err _pdbx_nmr_exptl_sample_conditions.ionic_strength_units _pdbx_nmr_exptl_sample_conditions.label _pdbx_nmr_exptl_sample_conditions.pH_err _pdbx_nmr_exptl_sample_conditions.pH_units _pdbx_nmr_exptl_sample_conditions.pressure_err _pdbx_nmr_exptl_sample_conditions.temperature_err _pdbx_nmr_exptl_sample_conditions.temperature_units 1 278 atm 1 5.8 '20 mM bis tris d19, 50 mM sodium chloride' 'Sample conditions to record exchangeable proton distance information (imino, amino)' ? mM 'low temperature' ? pH ? ? K 2 298 atm 1 5.8 '20 mM bis tris d19, 50 mM sodium chloride' ;Sample conditions to record non-exchangeable proton distance information. Same sample as id#1 buffer exchanged with 100% D2O containing d19 buffer ; ? mM 'high temperature' ? pH ? ? K 3 298 atm 1 5.0 '20 mM sodium acetate' ;Sample conditions to record non-exchangeable proton distance information. Same sample as id#1 buffer exchanged with 100% D2O containing sodium acetate buffer ; ? mM 'high temperature' ? pH ? ? K 4 298 atm 1 5.0 '20 mM sodium acetate' 'Sample conditions to record for identification of 13C of A, C, G and U.' ? mM 'high temperature' ? pH ? ? K 5 278 atm 1 5.8 '20 mM bis tris d19, 50 mM sodium chloride' ;Sample conditions to record exchangeable proton distance information. Same sample as id#4 buffer exchanged with 95% H2O containing d19 buffer ; ? mM 'low temperature' ? pH ? ? K 7 278 atm 1 5.8 '20 mM bis tris d19, 50 mM sodium chloride' 'Sample conditions to record exchangeable proton distance information and simplify the spectra by deuteration of ribose.' ? mM 'low temperature' ? pH ? ? K 8 298 atm 1 5.0 '20 sodium acetate' ;Sample conditions to record non-exchangeable small molecule proton distance information and removal of RNA signals by complete deuteration ; ? mM 'high temperature' ? pH ? ? K 9 278 atm 1 5.8 '20 mM bis tris d19, 50 mM sodium chloride' 'Sample conditions to record exchangeable small molecule as well as RNA signals' ? mM 'low temperature' ? pH ? ? K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H TOCSY' 3 isotropic 2 1 1 '2D 1H-1H NOESY' 3 isotropic 3 2 2 '2D 1H-1H TOCSY' 3 isotropic 4 2 2 '2D 1H-1H NOESY' 3 isotropic 5 3 3 '2D 1H-1H TOCSY' 3 isotropic 28 3 3 '2D 1H-1H NOESY' 3 isotropic 27 4 4 '2D 1H-13C HMQC' 3 isotropic 26 4 4 '2D 1H-13C CT-HSQC aliphatic' 3 isotropic 25 4 4 '2D 1H-13C CT-HSQC aromatic' 3 isotropic 24 4 4 '2D 1H-1H filtered NOESY' 3 isotropic 23 5 5 '2D 1H-15N HSQC' 3 isotropic 22 7 5 '2D 1H-15N HSQC NH2 only' 3 isotropic 21 7 5 '2D 1H-15N HNNCOSY' 2 isotropic 20 2 6 '2D 1H-1H TOCSY' 3 isotropic 19 2 6 '2D 1H-1H NOESY' 3 isotropic 18 7 7 '2D 1H-1H NOESY' 3 isotropic 17 8 8 '2D 1H-1H TOCSY' 3 isotropic 16 8 8 '2D 1H-1H NOESY' 3 isotropic 15 9 9 '2D 1H-1H NOESY' 3 isotropic # _pdbx_nmr_refine.entry_id 9PDE _pdbx_nmr_refine.method 'simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 5 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 collection TopSpin ? 'Bruker Biospin' 2 processing TopSpin ? 'Bruker Biospin' 3 'chemical shift assignment' Sparky ? Goddard 4 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 5 refinement 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CH OP3 O N N 73 CH P P N N 74 CH OP1 O N N 75 CH OP2 O N N 76 CH "O5'" O N N 77 CH "C5'" C N N 78 CH "C4'" C N R 79 CH "O4'" O N N 80 CH "C3'" C N S 81 CH "O3'" O N N 82 CH "C2'" C N R 83 CH "O2'" O N N 84 CH "C1'" C N R 85 CH N1 N N N 86 CH C2 C N N 87 CH O2 O N N 88 CH N3 N N N 89 CH C4 C N N 90 CH N4 N N N 91 CH C5 C N N 92 CH C6 C N N 93 CH HOP3 H N N 94 CH HOP2 H N N 95 CH "H5'" H N N 96 CH "H5''" H N N 97 CH "H4'" H N N 98 CH "H3'" H N N 99 CH "HO3'" H N N 100 CH "H2'" H N N 101 CH "HO2'" H N N 102 CH "H1'" H N N 103 CH HN3 H N N 104 CH H41 H N N 105 CH H42 H N N 106 CH H5 H N N 107 CH H6 H N N 108 G OP3 O N N 109 G P P N N 110 G OP1 O N N 111 G OP2 O N N 112 G "O5'" O N N 113 G "C5'" C N N 114 G "C4'" C N R 115 G "O4'" O N N 116 G "C3'" C N S 117 G "O3'" O N N 118 G "C2'" C N R 119 G "O2'" O N N 120 G "C1'" C N R 121 G N9 N Y N 122 G C8 C Y N 123 G N7 N Y N 124 G C5 C Y N 125 G C6 C N N 126 G O6 O N N 127 G N1 N N N 128 G C2 C N N 129 G N2 N N N 130 G N3 N N N 131 G C4 C Y N 132 G HOP3 H N N 133 G HOP2 H N N 134 G "H5'" H N N 135 G "H5''" H N N 136 G "H4'" H N N 137 G "H3'" H N N 138 G "HO3'" H N N 139 G "H2'" H N N 140 G "HO2'" H N N 141 G "H1'" H N N 142 G H8 H N N 143 G H1 H N N 144 G H21 H N N 145 G H22 H N N 146 LQQ O01 O N N 147 LQQ C02 C N N 148 LQQ C01 C N N 149 LQQ C03 C Y N 150 LQQ C04 C Y N 151 LQQ C05 C N N 152 LQQ C06 C Y N 153 LQQ C07 C Y N 154 LQQ N01 N Y N 155 LQQ C08 C Y N 156 LQQ N02 N Y N 157 LQQ C09 C Y N 158 LQQ N03 N Y N 159 LQQ C10 C N N 160 LQQ C11 C N N 161 LQQ C12 C N N 162 LQQ C13 C N N 163 LQQ C14 C N N 164 LQQ C15 C Y N 165 LQQ O02 O N N 166 LQQ N04 N N N 167 LQQ C16 C Y N 168 LQQ N05 N Y N 169 LQQ C17 C Y N 170 LQQ C18 C Y N 171 LQQ C19 C Y N 172 LQQ C20 C Y N 173 LQQ N06 N N N 174 LQQ C21 C N N 175 LQQ C22 C N N 176 LQQ N07 N N N 177 LQQ C23 C N N 178 LQQ C24 C N N 179 LQQ H011 H N N 180 LQQ H012 H N N 181 LQQ H013 H N N 182 LQQ H051 H N N 183 LQQ H052 H N N 184 LQQ H053 H N N 185 LQQ H1 H N N 186 LQQ H10 H N N 187 LQQ H111 H N N 188 LQQ H112 H N N 189 LQQ H121 H N N 190 LQQ H122 H N N 191 LQQ H131 H N N 192 LQQ H132 H N N 193 LQQ H141 H N N 194 LQQ H142 H N N 195 LQQ H04 H N N 196 LQQ H17 H N N 197 LQQ H19 H N N 198 LQQ H20 H N N 199 LQQ H211 H N N 200 LQQ H212 H N N 201 LQQ H221 H N N 202 LQQ H222 H N N 203 LQQ H07 H N N 204 LQQ H231 H N N 205 LQQ H232 H N N 206 LQQ H241 H N N 207 LQQ H242 H N N 208 U OP3 O N N 209 U P P N N 210 U OP1 O N N 211 U OP2 O N N 212 U "O5'" O N N 213 U "C5'" C N N 214 U "C4'" C N R 215 U "O4'" O N N 216 U "C3'" C N S 217 U "O3'" O N N 218 U "C2'" C N R 219 U "O2'" O N N 220 U "C1'" C N R 221 U N1 N N N 222 U C2 C N N 223 U O2 O N N 224 U N3 N N N 225 U C4 C N N 226 U O4 O N N 227 U C5 C N N 228 U C6 C N N 229 U HOP3 H N N 230 U HOP2 H N N 231 U "H5'" H N N 232 U "H5''" H N N 233 U "H4'" H N N 234 U "H3'" H N N 235 U "HO3'" H N N 236 U "H2'" H N N 237 U "HO2'" H N N 238 U "H1'" H N N 239 U H3 H N N 240 U H5 H N N 241 U H6 H N N 242 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CH OP3 P sing N N 76 CH OP3 HOP3 sing N N 77 CH P OP1 doub N N 78 CH P OP2 sing N N 79 CH P "O5'" sing N N 80 CH OP2 HOP2 sing N N 81 CH "O5'" "C5'" sing N N 82 CH "C5'" "C4'" sing N N 83 CH "C5'" "H5'" sing N N 84 CH "C5'" "H5''" sing N N 85 CH "C4'" "O4'" sing N N 86 CH "C4'" "C3'" sing N N 87 CH "C4'" "H4'" sing N N 88 CH "O4'" "C1'" sing N N 89 CH "C3'" "O3'" sing N N 90 CH "C3'" "C2'" sing N N 91 CH "C3'" "H3'" sing N N 92 CH "O3'" "HO3'" sing N N 93 CH "C2'" "O2'" sing N N 94 CH "C2'" "C1'" sing N N 95 CH "C2'" "H2'" sing N N 96 CH "O2'" "HO2'" sing N N 97 CH "C1'" N1 sing N N 98 CH "C1'" "H1'" sing N N 99 CH N1 C2 sing N N 100 CH N1 C6 doub N N 101 CH C2 O2 doub N N 102 CH C2 N3 sing N N 103 CH N3 C4 sing N N 104 CH N3 HN3 sing N N 105 CH C4 N4 sing N N 106 CH C4 C5 doub N N 107 CH N4 H41 sing N N 108 CH N4 H42 sing N N 109 CH C5 C6 sing N N 110 CH C5 H5 sing N N 111 CH C6 H6 sing N N 112 G OP3 P sing N N 113 G OP3 HOP3 sing N N 114 G P OP1 doub N N 115 G P OP2 sing N N 116 G P "O5'" sing N N 117 G OP2 HOP2 sing N N 118 G "O5'" "C5'" sing N N 119 G "C5'" "C4'" sing N N 120 G "C5'" "H5'" sing N N 121 G "C5'" "H5''" sing N N 122 G "C4'" "O4'" sing N N 123 G "C4'" "C3'" sing N N 124 G "C4'" "H4'" sing N N 125 G "O4'" "C1'" sing N N 126 G "C3'" "O3'" sing N N 127 G "C3'" "C2'" sing N N 128 G "C3'" "H3'" sing N N 129 G "O3'" "HO3'" sing N N 130 G "C2'" "O2'" sing N N 131 G "C2'" "C1'" sing N N 132 G "C2'" "H2'" sing N N 133 G "O2'" "HO2'" sing N N 134 G "C1'" N9 sing N N 135 G "C1'" "H1'" sing N N 136 G N9 C8 sing Y N 137 G N9 C4 sing Y N 138 G C8 N7 doub Y N 139 G C8 H8 sing N N 140 G N7 C5 sing Y N 141 G C5 C6 sing N N 142 G C5 C4 doub Y N 143 G C6 O6 doub N N 144 G C6 N1 sing N N 145 G N1 C2 sing N N 146 G N1 H1 sing N N 147 G C2 N2 sing N N 148 G C2 N3 doub N N 149 G N2 H21 sing N N 150 G N2 H22 sing N N 151 G N3 C4 sing N N 152 LQQ O01 C02 doub N N 153 LQQ C02 C01 sing N N 154 LQQ C02 C03 sing N N 155 LQQ C01 H011 sing N N 156 LQQ C01 H012 sing N N 157 LQQ C01 H013 sing N N 158 LQQ C03 C04 doub Y N 159 LQQ C03 C15 sing Y N 160 LQQ C04 C05 sing N N 161 LQQ C04 C06 sing Y N 162 LQQ C05 H051 sing N N 163 LQQ C05 H052 sing N N 164 LQQ C05 H053 sing N N 165 LQQ C06 C07 sing Y N 166 LQQ C06 C09 doub Y N 167 LQQ C07 N01 doub Y N 168 LQQ C07 H1 sing N N 169 LQQ N01 C08 sing Y N 170 LQQ C08 N02 doub Y N 171 LQQ C08 N04 sing N N 172 LQQ N02 C09 sing Y N 173 LQQ C09 N03 sing Y N 174 LQQ N03 C10 sing N N 175 LQQ N03 C15 sing Y N 176 LQQ C10 C11 sing N N 177 LQQ C10 C14 sing N N 178 LQQ C10 H10 sing N N 179 LQQ C11 C12 sing N N 180 LQQ C11 H111 sing N N 181 LQQ C11 H112 sing N N 182 LQQ C12 C13 sing N N 183 LQQ C12 H121 sing N N 184 LQQ C12 H122 sing N N 185 LQQ C13 C14 sing N N 186 LQQ C13 H131 sing N N 187 LQQ C13 H132 sing N N 188 LQQ C14 H141 sing N N 189 LQQ C14 H142 sing N N 190 LQQ C15 O02 doub N N 191 LQQ N04 C16 sing N N 192 LQQ N04 H04 sing N N 193 LQQ C16 N05 doub Y N 194 LQQ C16 C20 sing Y N 195 LQQ N05 C17 sing Y N 196 LQQ C17 C18 doub Y N 197 LQQ C17 H17 sing N N 198 LQQ C18 C19 sing Y N 199 LQQ C18 N06 sing N N 200 LQQ C19 C20 doub Y N 201 LQQ C19 H19 sing N N 202 LQQ C20 H20 sing N N 203 LQQ N06 C21 sing N N 204 LQQ N06 C24 sing N N 205 LQQ C21 C22 sing N N 206 LQQ C21 H211 sing N N 207 LQQ C21 H212 sing N N 208 LQQ C22 N07 sing N N 209 LQQ C22 H221 sing N N 210 LQQ C22 H222 sing N N 211 LQQ N07 C23 sing N N 212 LQQ N07 H07 sing N N 213 LQQ C23 C24 sing N N 214 LQQ C23 H231 sing N N 215 LQQ C23 H232 sing N N 216 LQQ C24 H241 sing N N 217 LQQ C24 H242 sing N N 218 U OP3 P sing N N 219 U OP3 HOP3 sing N N 220 U P OP1 doub N N 221 U P OP2 sing N N 222 U P "O5'" sing N N 223 U OP2 HOP2 sing N N 224 U "O5'" "C5'" sing N N 225 U "C5'" "C4'" sing N N 226 U "C5'" "H5'" sing N N 227 U "C5'" "H5''" sing N N 228 U "C4'" "O4'" sing N N 229 U "C4'" "C3'" sing N N 230 U "C4'" "H4'" sing N N 231 U "O4'" "C1'" sing N N 232 U "C3'" "O3'" sing N N 233 U "C3'" "C2'" sing N N 234 U "C3'" "H3'" sing N N 235 U "O3'" "HO3'" sing N N 236 U "C2'" "O2'" sing N N 237 U "C2'" "C1'" sing N N 238 U "C2'" "H2'" sing N N 239 U "O2'" "HO2'" sing N N 240 U "C1'" N1 sing N N 241 U "C1'" "H1'" sing N N 242 U N1 C2 sing N N 243 U N1 C6 sing N N 244 U C2 O2 doub N N 245 U C2 N3 sing N N 246 U N3 C4 sing N N 247 U N3 H3 sing N N 248 U C4 O4 doub N N 249 U C4 C5 sing N N 250 U C5 C6 doub N N 251 U C5 H5 sing N N 252 U C6 H6 sing N N 253 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9PDE 'double helix' 9PDE 'a-form double helix' 9PDE 'bulge loop' 9PDE 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 29 1_555 -0.253 0.029 0.005 0.146 -6.221 -1.689 1 A_G17:C45_A A 17 ? A 45 ? 19 1 1 A G 2 1_555 A C 28 1_555 -0.163 -0.106 0.027 1.044 -12.011 4.340 2 A_G18:C44_A A 18 ? A 44 ? 19 1 1 A C 3 1_555 A G 27 1_555 0.179 -0.141 0.044 -0.535 -14.663 4.500 3 A_C19:G43_A A 19 ? A 43 ? 19 1 1 A A 4 1_555 A U 26 1_555 0.212 0.049 -0.058 -6.656 -9.661 -0.057 4 A_A20:U42_A A 20 ? A 42 ? 20 1 1 A G 5 1_555 A C 25 1_555 0.246 0.057 -0.141 -5.820 1.479 -4.697 5 A_G21:C41_A A 21 ? A 41 ? 19 1 1 A U 9 1_555 A U 7 1_555 0.992 -0.276 0.972 -39.652 30.093 75.378 6 A_U25:U23_A A 25 ? A 23 ? 13 1 1 A U 22 1_555 A A 11 1_555 0.663 -0.307 -0.063 3.708 -3.768 3.469 7 A_U38:A27_A A 38 ? A 27 ? 20 1 1 A C 23 1_555 A G 10 1_555 0.762 -0.232 -0.081 -0.077 -4.886 2.251 8 A_C39:G26_A A 39 ? A 26 ? 19 1 1 A G 12 1_555 A C 21 1_555 -0.264 -0.074 -0.188 -3.873 0.037 4.459 9 A_G28:C37_A A 28 ? A 37 ? 19 1 1 A C 13 1_555 A G 20 1_555 0.101 -0.081 -0.332 4.249 9.859 2.001 10 A_C29:G36_A A 29 ? A 36 ? 19 1 1 A C 14 1_555 A G 19 1_555 0.668 -0.257 -0.310 9.044 23.943 7.730 11 A_C30:G35_A A 30 ? A 35 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 29 1_555 A G 2 1_555 A C 28 1_555 0.243 -1.704 3.182 0.277 3.548 31.101 -3.790 -0.400 2.976 6.590 -0.514 31.299 1 AA_G17G18:C44C45_AA A 17 ? A 45 ? A 18 ? A 44 ? 1 A G 2 1_555 A C 28 1_555 A C 3 1_555 A G 27 1_555 0.154 -1.452 3.286 0.673 2.908 34.934 -2.842 -0.157 3.161 4.832 -1.119 35.058 2 AA_G18C19:G43C44_AA A 18 ? A 44 ? A 19 ? A 43 ? 1 A C 3 1_555 A G 27 1_555 A A 4 1_555 A U 26 1_555 -0.106 -1.576 3.235 1.708 8.791 34.090 -3.822 0.412 2.748 14.683 -2.853 35.213 3 AA_C19A20:U42G43_AA A 19 ? A 43 ? A 20 ? A 42 ? 1 A A 4 1_555 A U 26 1_555 A G 5 1_555 A C 25 1_555 -0.322 -1.628 3.353 1.322 6.295 29.260 -4.415 0.888 2.930 12.275 -2.577 29.943 4 AA_A20G21:C41U42_AA A 20 ? A 42 ? A 21 ? A 41 ? 1 A U 9 1_555 A U 7 1_555 A U 22 1_555 A A 11 1_555 1.035 3.456 3.454 21.488 17.977 -151.561 -1.847 0.614 3.264 -9.261 11.070 -152.424 5 AA_U25U38:A27U23_AA A 25 ? A 23 ? A 38 ? A 27 ? 1 A U 22 1_555 A A 11 1_555 A C 23 1_555 A G 10 1_555 -0.219 -1.799 3.274 3.484 3.463 32.290 -3.781 0.975 3.030 6.183 -6.219 32.651 6 AA_U38C39:G26A27_AA A 38 ? A 27 ? A 39 ? A 26 ? 1 A G 12 1_555 A C 21 1_555 A C 13 1_555 A G 20 1_555 -0.061 -1.756 3.175 0.290 7.269 28.655 -4.841 0.175 2.657 14.396 -0.574 29.545 7 AA_G28C29:G36C37_AA A 28 ? A 37 ? A 29 ? A 36 ? 1 A C 13 1_555 A G 20 1_555 A C 14 1_555 A G 19 1_555 0.140 -1.779 3.261 -3.829 13.408 26.488 -5.875 -0.963 2.096 27.012 7.713 29.876 8 AA_C29C30:G35G36_AA A 29 ? A 36 ? A 30 ? A 35 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number 1R35GM126942 _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE NEO' ? Bruker 500 ? 2 'AVANCE II' ? Bruker 600 ? 3 'AVANCE III' ? Bruker 800 ? # _atom_sites.entry_id 9PDE _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #