data_9URS # _entry.id 9URS # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9URS pdb_00009urs 10.2210/pdb9urs/pdb WWPDB D_1300058986 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-11-04 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9URS _pdbx_database_status.recvd_initial_deposition_date 2025-04-30 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 5 _pdbx_contact_author.email huanglin36@mail.sysu.edu.cn _pdbx_contact_author.name_first Lin _pdbx_contact_author.name_last Huang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-2121-365X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Luo, Y.' 1 ? 'Chen, X.' 2 ? 'Ren, Y.' 3 ? 'Huang, L.' 4 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of adenosine and ATP-binding DNA aptamer' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chen, X.' 1 ? primary 'Luo, Y.' 2 ? primary 'Ren, Y.' 3 ? primary 'Huang, L.' 4 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'DNA (39-MER)' 12110.766 2 ? ? ? ? 2 non-polymer syn ADENOSINE 267.241 2 ? ? ? ? 3 non-polymer syn 'SODIUM ION' 22.990 2 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DG)(DA)(DC)(DG)(DA)(DC)(DG)(DT)(DT)(DT)(DG)(DC)(DG)(DA)(DT)(DG)(DA)(DG)(DA)(DA) (DC)(DT)(DT)(DT)(DG)(DG)(DT)(DT)(DC)(DG)(DA)(DA)(DG)(DG)(DT)(DC)(DG)(DT)(DC) ; _entity_poly.pdbx_seq_one_letter_code_can GACGACGTTTGCGATGAGAACTTTGGTTCGAAGGTCGTC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ADENOSINE ADN 3 'SODIUM ION' NA # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DA n 1 3 DC n 1 4 DG n 1 5 DA n 1 6 DC n 1 7 DG n 1 8 DT n 1 9 DT n 1 10 DT n 1 11 DG n 1 12 DC n 1 13 DG n 1 14 DA n 1 15 DT n 1 16 DG n 1 17 DA n 1 18 DG n 1 19 DA n 1 20 DA n 1 21 DC n 1 22 DT n 1 23 DT n 1 24 DT n 1 25 DG n 1 26 DG n 1 27 DT n 1 28 DT n 1 29 DC n 1 30 DG n 1 31 DA n 1 32 DA n 1 33 DG n 1 34 DG n 1 35 DT n 1 36 DC n 1 37 DG n 1 38 DT n 1 39 DC n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 39 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight ADN non-polymer . ADENOSINE ? 'C10 H13 N5 O4' 267.241 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 NA non-polymer . 'SODIUM ION' ? 'Na 1' 22.990 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DA 2 2 2 DA DA A . n A 1 3 DC 3 3 3 DC DC A . n A 1 4 DG 4 4 4 DG DG A . n A 1 5 DA 5 5 5 DA DA A . n A 1 6 DC 6 6 6 DC DC A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DT 8 8 8 DT DT A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DT 10 10 10 DT DT A . n A 1 11 DG 11 11 11 DG DG A . n A 1 12 DC 12 12 12 DC DC A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DA 14 14 14 DA DA A . n A 1 15 DT 15 15 15 DT DT A . n A 1 16 DG 16 16 16 DG DG A . n A 1 17 DA 17 17 17 DA DA A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DA 19 19 19 DA DA A . n A 1 20 DA 20 20 20 DA DA A . n A 1 21 DC 21 21 21 DC DC A . n A 1 22 DT 22 22 22 DT DT A . n A 1 23 DT 23 23 23 DT DT A . n A 1 24 DT 24 24 24 DT DT A . n A 1 25 DG 25 25 25 DG DG A . n A 1 26 DG 26 26 26 DG DG A . n A 1 27 DT 27 27 27 DT DT A . n A 1 28 DT 28 28 28 DT DT A . n A 1 29 DC 29 29 29 DC DC A . n A 1 30 DG 30 30 30 DG DG A . n A 1 31 DA 31 31 31 DA DA A . n A 1 32 DA 32 32 32 DA DA A . n A 1 33 DG 33 33 33 DG DG A . n A 1 34 DG 34 34 34 DG DG A . n A 1 35 DT 35 35 35 DT DT A . n A 1 36 DC 36 36 36 DC DC A . n A 1 37 DG 37 37 37 DG DG A . n A 1 38 DT 38 38 38 DT DT A . n A 1 39 DC 39 39 39 DC DC A . n B 1 1 DG 1 1 1 DG DG B . n B 1 2 DA 2 2 2 DA DA B . n B 1 3 DC 3 3 3 DC DC B . n B 1 4 DG 4 4 4 DG DG B . n B 1 5 DA 5 5 5 DA DA B . n B 1 6 DC 6 6 6 DC DC B . n B 1 7 DG 7 7 7 DG DG B . n B 1 8 DT 8 8 8 DT DT B . n B 1 9 DT 9 9 9 DT DT B . n B 1 10 DT 10 10 10 DT DT B . n B 1 11 DG 11 11 11 DG DG B . n B 1 12 DC 12 12 12 DC DC B . n B 1 13 DG 13 13 13 DG DG B . n B 1 14 DA 14 14 14 DA DA B . n B 1 15 DT 15 15 15 DT DT B . n B 1 16 DG 16 16 16 DG DG B . n B 1 17 DA 17 17 17 DA DA B . n B 1 18 DG 18 18 18 DG DG B . n B 1 19 DA 19 19 19 DA DA B . n B 1 20 DA 20 20 20 DA DA B . n B 1 21 DC 21 21 21 DC DC B . n B 1 22 DT 22 22 22 DT DT B . n B 1 23 DT 23 23 23 DT DT B . n B 1 24 DT 24 24 24 DT DT B . n B 1 25 DG 25 25 25 DG DG B . n B 1 26 DG 26 26 26 DG DG B . n B 1 27 DT 27 27 27 DT DT B . n B 1 28 DT 28 28 28 DT DT B . n B 1 29 DC 29 29 29 DC DC B . n B 1 30 DG 30 30 30 DG DG B . n B 1 31 DA 31 31 31 DA DA B . n B 1 32 DA 32 32 32 DA DA B . n B 1 33 DG 33 33 33 DG DG B . n B 1 34 DG 34 34 34 DG DG B . n B 1 35 DT 35 35 35 DT DT B . n B 1 36 DC 36 36 36 DC DC B . n B 1 37 DG 37 37 37 DG DG B . n B 1 38 DT 38 38 38 DT DT B . n B 1 39 DC 39 39 39 DC DC B . n # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 ADN ? ? ADN ? ? 'SUBJECT OF INVESTIGATION' ? 2 NA ? ? NA ? ? 'SUBJECT OF INVESTIGATION' ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 ADN 1 101 101 ADN ADN A . D 2 ADN 1 101 101 ADN ADN B . E 3 NA 1 102 1 NA NA B . F 3 NA 1 103 2 NA NA B . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A DG 13 ? "C2'" ? A DG 13 "C2'" 2 1 Y 1 B DG 13 ? "C2'" ? B DG 13 "C2'" # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 ? 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 4 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 9URS _cell.details ? _cell.formula_units_Z ? _cell.length_a 50.310 _cell.length_a_esd ? _cell.length_b 63.050 _cell.length_b_esd ? _cell.length_c 76.250 _cell.length_c_esd ? _cell.volume 241868.469 _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9URS _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall 'P 2ac 2ab' _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9URS _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.50 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 50.73 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 6.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.05 M Calcium Chloride dihydrate 0.1 M Bis-Tris pH 6.5 30% w/v Polyethylene Glycol Monomethyl ether 550 20% w/v Benzamidine HCl ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 291 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-10-21 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.979183 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL10U2' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.979183 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL10U2 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 93.10 _reflns.entry_id 9URS _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.93 _reflns.d_resolution_low 50.31 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5480 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.0 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 11.2 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 12.000 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.040 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.997 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.127 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.93 _reflns_shell.d_res_low 3.01 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 398 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.552 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.690 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 1.583 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 90.77 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9URS _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.93 _refine.ls_d_res_low 26.71 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5424 _refine.ls_number_reflns_R_free 279 _refine.ls_number_reflns_R_work 5145 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 97.84 _refine.ls_percent_reflns_R_free 5.14 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2379 _refine.ls_R_factor_R_free 0.2550 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2368 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 26.4445 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2979 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.93 _refine_hist.d_res_low 26.71 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 1646 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1606 _refine_hist.pdbx_number_atoms_ligand 40 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0060 ? 1842 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.8437 ? 2838 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.0461 ? 314 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.0058 ? 80 ? f_plane_restr ? ? ? 'X-RAY DIFFRACTION' ? 35.3786 ? 768 ? f_dihedral_angle_d ? ? ? # _refine_ls_restr_ncs.pdbx_ordinal 1 _refine_ls_restr_ncs.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_ls_restr_ncs.dom_id d_2 _refine_ls_restr_ncs.pdbx_ens_id ens_1 _refine_ls_restr_ncs.rms_dev_position 0.732810584932 _refine_ls_restr_ncs.weight_position ? _refine_ls_restr_ncs.rms_dev_B_iso ? _refine_ls_restr_ncs.weight_B_iso ? _refine_ls_restr_ncs.pdbx_type 'Torsion NCS' _refine_ls_restr_ncs.pdbx_asym_id A _refine_ls_restr_ncs.pdbx_auth_asym_id A _refine_ls_restr_ncs.pdbx_number ? _refine_ls_restr_ncs.pdbx_rms ? _refine_ls_restr_ncs.pdbx_weight ? _refine_ls_restr_ncs.ncs_model_details ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.93 3.69 . . 133 2481 96.56 . . . . 0.3017 . . . . . . . . . . . . . . . 0.3283 'X-RAY DIFFRACTION' 3.69 26.71 . . 146 2664 99.05 . . . . 0.2189 . . . . . . . . . . . . . . . 0.2348 # _struct_ncs_oper.id 1 _struct_ncs_oper.code given _struct_ncs_oper.matrix[1][1] -0.135738766706 _struct_ncs_oper.matrix[1][2] 0.118645206397 _struct_ncs_oper.matrix[1][3] 0.983614915611 _struct_ncs_oper.matrix[2][1] -0.0876950351721 _struct_ncs_oper.matrix[2][2] -0.990345620819 _struct_ncs_oper.matrix[2][3] 0.107355168156 _struct_ncs_oper.matrix[3][1] 0.986855900332 _struct_ncs_oper.matrix[3][2] -0.0716858864953 _struct_ncs_oper.matrix[3][3] 0.144832888731 _struct_ncs_oper.vector[1] 23.5093035517 _struct_ncs_oper.vector[2] -61.5926035737 _struct_ncs_oper.vector[3] -21.1474643857 _struct_ncs_oper.details ? # loop_ _struct_ncs_dom.pdbx_ens_id _struct_ncs_dom.id _struct_ncs_dom.details ens_1 d_1 ;chain "A" ; ens_1 d_2 ;chain "B" ; # loop_ _struct_ncs_dom_lim.pdbx_ens_id _struct_ncs_dom_lim.dom_id _struct_ncs_dom_lim.pdbx_component_id _struct_ncs_dom_lim.beg_label_asym_id _struct_ncs_dom_lim.beg_label_comp_id _struct_ncs_dom_lim.beg_label_seq_id _struct_ncs_dom_lim.beg_label_alt_id _struct_ncs_dom_lim.end_label_asym_id _struct_ncs_dom_lim.end_label_comp_id _struct_ncs_dom_lim.end_label_seq_id _struct_ncs_dom_lim.end_label_alt_id _struct_ncs_dom_lim.beg_auth_asym_id _struct_ncs_dom_lim.beg_auth_comp_id _struct_ncs_dom_lim.beg_auth_seq_id _struct_ncs_dom_lim.end_auth_asym_id _struct_ncs_dom_lim.end_auth_comp_id _struct_ncs_dom_lim.end_auth_seq_id _struct_ncs_dom_lim.pdbx_refine_code _struct_ncs_dom_lim.selection_details ens_1 d_1 1 A DG 1 . A DC 3 . A DG 1 A DC 3 ? ? ens_1 d_1 2 C ADN . . C ADN . . A ADN 101 A ADN 101 ? ? ens_1 d_2 1 B DG 1 . B DC 3 . B DG 1 B DC 3 ? ? ens_1 d_2 2 D ADN . . D ADN . . B ADN 101 B ADN 101 ? ? # _struct_ncs_ens.id ens_1 _struct_ncs_ens.details ? # _struct_ncs_ens_gen.ens_id ens_1 _struct_ncs_ens_gen.dom_id_1 d_2 _struct_ncs_ens_gen.dom_id_2 d_1 _struct_ncs_ens_gen.oper_id 1 # _struct.entry_id 9URS _struct.title 'Crystal structure of Ade1301 DNA aptamer (one strand) bound to adenosine' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9URS _struct_keywords.text 'Adenosine/ATP DNA aptamer, ADO, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9URS _struct_ref.pdbx_db_accession 9URS _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 9URS A 1 ? 39 ? 9URS 1 ? 39 ? 1 39 2 1 9URS B 1 ? 39 ? 9URS 1 ? 39 ? 1 39 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 390 ? 1 MORE -16 ? 1 'SSA (A^2)' 13650 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? B DT 8 O4 ? ? ? 1_555 E NA . NA ? ? B DT 8 B NA 102 1_555 ? ? ? ? ? ? ? 2.289 ? ? hydrog1 hydrog ? ? A DG 1 N1 ? ? ? 1_555 A DC 39 N3 ? ? A DG 1 A DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 1 N2 ? ? ? 1_555 A DC 39 O2 ? ? A DG 1 A DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 1 O6 ? ? ? 1_555 A DC 39 N4 ? ? A DG 1 A DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DA 2 N1 ? ? ? 1_555 A DT 38 N3 ? ? A DA 2 A DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DA 2 N6 ? ? ? 1_555 A DT 38 O4 ? ? A DA 2 A DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DC 3 N3 ? ? ? 1_555 A DG 37 N1 ? ? A DC 3 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DC 3 N4 ? ? ? 1_555 A DG 37 O6 ? ? A DC 3 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DC 3 O2 ? ? ? 1_555 A DG 37 N2 ? ? A DC 3 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DG 4 N1 ? ? ? 1_555 A DC 36 N3 ? ? A DG 4 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DG 4 N2 ? ? ? 1_555 A DC 36 O2 ? ? A DG 4 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 4 O6 ? ? ? 1_555 A DC 36 N4 ? ? A DG 4 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DA 5 N1 ? ? ? 1_555 A DT 35 N3 ? ? A DA 5 A DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DA 5 N6 ? ? ? 1_555 A DT 35 O4 ? ? A DA 5 A DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DC 6 N3 ? ? ? 1_555 A DG 34 N1 ? ? A DC 6 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DC 6 N4 ? ? ? 1_555 A DG 34 O6 ? ? A DC 6 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 6 O2 ? ? ? 1_555 A DG 34 N2 ? ? A DC 6 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DG 7 N1 ? ? ? 1_555 A DG 11 N7 ? ? A DG 7 A DG 11 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog18 hydrog ? ? A DG 7 N2 ? ? ? 1_555 A DG 11 O6 ? ? A DG 7 A DG 11 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog19 hydrog ? ? A DT 9 N3 ? ? ? 1_555 A DA 31 N1 ? ? A DT 9 A DA 31 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog20 hydrog ? ? A DT 9 O2 ? ? ? 1_555 A DA 31 N6 ? ? A DT 9 A DA 31 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog21 hydrog ? ? A DT 10 N3 ? ? ? 1_555 A DA 32 N1 ? ? A DT 10 A DA 32 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog22 hydrog ? ? A DT 10 O2 ? ? ? 1_555 A DA 32 N6 ? ? A DT 10 A DA 32 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog23 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 33 N3 ? ? A DG 11 A DG 33 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog24 hydrog ? ? A DG 11 N3 ? ? ? 1_555 A DG 33 N2 ? ? A DG 11 A DG 33 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog25 hydrog ? ? A DC 12 N4 ? ? ? 1_555 A DG 34 N7 ? ? A DC 12 A DG 34 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? hydrog26 hydrog ? ? A DG 13 N7 ? ? ? 1_555 A DG 33 N1 ? ? A DG 13 A DG 33 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog27 hydrog ? ? A DG 13 O6 ? ? ? 1_555 A DG 33 N2 ? ? A DG 13 A DG 33 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog28 hydrog ? ? A DA 14 N1 ? ? ? 1_555 A DA 32 N6 ? ? A DA 14 A DA 32 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog29 hydrog ? ? A DA 14 N6 ? ? ? 1_555 A DA 32 N7 ? ? A DA 14 A DA 32 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog30 hydrog ? ? A DT 15 N3 ? ? ? 1_555 A DA 31 N7 ? ? A DT 15 A DA 31 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog31 hydrog ? ? A DT 15 O2 ? ? ? 1_555 A DA 31 N6 ? ? A DT 15 A DA 31 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog32 hydrog ? ? A DA 17 N6 ? ? ? 1_555 A DG 30 N3 ? ? A DA 17 A DG 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog33 hydrog ? ? A DA 17 N7 ? ? ? 1_555 A DG 30 N2 ? ? A DA 17 A DG 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog34 hydrog ? ? A DG 18 N1 ? ? ? 1_555 A DC 29 N3 ? ? A DG 18 A DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DG 18 N2 ? ? ? 1_555 A DC 29 O2 ? ? A DG 18 A DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DG 18 O6 ? ? ? 1_555 A DC 29 N4 ? ? A DG 18 A DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 19 N1 ? ? ? 1_555 A DT 28 N3 ? ? A DA 19 A DT 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DA 19 N6 ? ? ? 1_555 A DT 28 O4 ? ? A DA 19 A DT 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DA 20 N1 ? ? ? 1_555 A DT 27 N3 ? ? A DA 20 A DT 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DA 20 N6 ? ? ? 1_555 A DT 27 O4 ? ? A DA 20 A DT 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DC 21 N3 ? ? ? 1_555 A DG 26 N1 ? ? A DC 21 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A DC 21 N4 ? ? ? 1_555 A DG 26 O6 ? ? A DC 21 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A DC 21 O2 ? ? ? 1_555 A DG 26 N2 ? ? A DC 21 A DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A DT 22 N3 ? ? ? 1_555 A DG 25 O6 ? ? A DT 22 A DG 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A DT 22 O2 ? ? ? 1_555 A DG 25 N1 ? ? A DT 22 A DG 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog46 hydrog ? ? B DG 1 N1 ? ? ? 1_555 B DC 39 N3 ? ? B DG 1 B DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? B DG 1 N2 ? ? ? 1_555 B DC 39 O2 ? ? B DG 1 B DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? B DG 1 O6 ? ? ? 1_555 B DC 39 N4 ? ? B DG 1 B DC 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? B DA 2 N1 ? ? ? 1_555 B DT 38 N3 ? ? B DA 2 B DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? B DA 2 N6 ? ? ? 1_555 B DT 38 O4 ? ? B DA 2 B DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? B DC 3 N3 ? ? ? 1_555 B DG 37 N1 ? ? B DC 3 B DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? B DC 3 N4 ? ? ? 1_555 B DG 37 O6 ? ? B DC 3 B DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? B DC 3 O2 ? ? ? 1_555 B DG 37 N2 ? ? B DC 3 B DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? B DG 4 N1 ? ? ? 1_555 B DC 36 N3 ? ? B DG 4 B DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? B DG 4 N2 ? ? ? 1_555 B DC 36 O2 ? ? B DG 4 B DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? B DG 4 O6 ? ? ? 1_555 B DC 36 N4 ? ? B DG 4 B DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? B DA 5 N1 ? ? ? 1_555 B DT 35 N3 ? ? B DA 5 B DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? B DA 5 N6 ? ? ? 1_555 B DT 35 O4 ? ? B DA 5 B DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? B DC 6 N3 ? ? ? 1_555 B DG 34 N1 ? ? B DC 6 B DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? B DC 6 N4 ? ? ? 1_555 B DG 34 O6 ? ? B DC 6 B DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? B DC 6 O2 ? ? ? 1_555 B DG 34 N2 ? ? B DC 6 B DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? B DG 7 N1 ? ? ? 1_555 B DG 11 N7 ? ? B DG 7 B DG 11 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog63 hydrog ? ? B DG 7 N2 ? ? ? 1_555 B DG 11 O6 ? ? B DG 7 B DG 11 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog64 hydrog ? ? B DT 9 N3 ? ? ? 1_555 B DA 31 N1 ? ? B DT 9 B DA 31 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog65 hydrog ? ? B DT 9 O2 ? ? ? 1_555 B DA 31 N6 ? ? B DT 9 B DA 31 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog66 hydrog ? ? B DT 10 N3 ? ? ? 1_555 B DA 32 N1 ? ? B DT 10 B DA 32 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog67 hydrog ? ? B DT 10 O2 ? ? ? 1_555 B DA 32 N6 ? ? B DT 10 B DA 32 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog68 hydrog ? ? B DG 11 N2 ? ? ? 1_555 B DG 33 N3 ? ? B DG 11 B DG 33 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog69 hydrog ? ? B DG 11 N3 ? ? ? 1_555 B DG 33 N2 ? ? B DG 11 B DG 33 1_555 ? ? ? ? ? ? TYPE_4_PAIR ? ? ? hydrog70 hydrog ? ? B DC 12 N4 ? ? ? 1_555 B DG 34 N7 ? ? B DC 12 B DG 34 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? hydrog71 hydrog ? ? B DG 13 N7 ? ? ? 1_555 B DG 33 N1 ? ? B DG 13 B DG 33 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog72 hydrog ? ? B DG 13 O6 ? ? ? 1_555 B DG 33 N2 ? ? B DG 13 B DG 33 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog73 hydrog ? ? B DA 14 N1 ? ? ? 1_555 B DA 32 N6 ? ? B DA 14 B DA 32 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog74 hydrog ? ? B DA 14 N6 ? ? ? 1_555 B DA 32 N7 ? ? B DA 14 B DA 32 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog75 hydrog ? ? B DT 15 N3 ? ? ? 1_555 B DA 31 N7 ? ? B DT 15 B DA 31 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog76 hydrog ? ? B DT 15 O2 ? ? ? 1_555 B DA 31 N6 ? ? B DT 15 B DA 31 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog77 hydrog ? ? B DA 17 N6 ? ? ? 1_555 B DG 30 N3 ? ? B DA 17 B DG 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog78 hydrog ? ? B DA 17 N7 ? ? ? 1_555 B DG 30 N2 ? ? B DA 17 B DG 30 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog79 hydrog ? ? B DG 18 N1 ? ? ? 1_555 B DC 29 N3 ? ? B DG 18 B DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? B DG 18 N2 ? ? ? 1_555 B DC 29 O2 ? ? B DG 18 B DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? B DG 18 O6 ? ? ? 1_555 B DC 29 N4 ? ? B DG 18 B DC 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? B DA 19 N1 ? ? ? 1_555 B DT 28 N3 ? ? B DA 19 B DT 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? B DA 19 N6 ? ? ? 1_555 B DT 28 O4 ? ? B DA 19 B DT 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? B DA 20 N1 ? ? ? 1_555 B DT 27 N3 ? ? B DA 20 B DT 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? B DA 20 N6 ? ? ? 1_555 B DT 27 O4 ? ? B DA 20 B DT 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? B DC 21 N3 ? ? ? 1_555 B DG 26 N1 ? ? B DC 21 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? B DC 21 N4 ? ? ? 1_555 B DG 26 O6 ? ? B DC 21 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? B DC 21 O2 ? ? ? 1_555 B DG 26 N2 ? ? B DC 21 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? B DT 22 N3 ? ? ? 1_555 B DG 25 O6 ? ? B DT 22 B DG 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog90 hydrog ? ? B DT 22 O2 ? ? ? 1_555 B DG 25 N1 ? ? B DT 22 B DG 25 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9URS _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O2 A DT 22 ? ? N2 A DG 25 ? ? 2.03 2 1 O2 B DT 22 ? ? N2 B DG 25 ? ? 2.10 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DG 16 ? ? "C1'" A DG 16 ? ? N9 A DG 16 ? ? 110.44 108.30 2.14 0.30 N 2 1 "O4'" A DG 18 ? ? "C1'" A DG 18 ? ? N9 A DG 18 ? ? 110.13 108.30 1.83 0.30 N 3 1 "O4'" A DT 24 ? ? "C1'" A DT 24 ? ? N1 A DT 24 ? ? 111.31 108.30 3.01 0.30 N 4 1 "C3'" A DG 25 ? ? "C2'" A DG 25 ? ? "C1'" A DG 25 ? ? 97.46 102.40 -4.94 0.80 N 5 1 "O4'" A DG 25 ? ? "C1'" A DG 25 ? ? N9 A DG 25 ? ? 111.26 108.30 2.96 0.30 N 6 1 "O4'" A DG 30 ? ? "C1'" A DG 30 ? ? N9 A DG 30 ? ? 110.28 108.30 1.98 0.30 N 7 1 "O4'" B DT 8 ? ? "C1'" B DT 8 ? ? N1 B DT 8 ? ? 110.85 108.30 2.55 0.30 N 8 1 "O4'" B DT 24 ? ? "C1'" B DT 24 ? ? N1 B DT 24 ? ? 110.90 108.30 2.60 0.30 N 9 1 "O4'" B DG 25 ? ? "C1'" B DG 25 ? ? N9 B DG 25 ? ? 111.75 108.30 3.45 0.30 N # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x+1/2,-y+1/2,-z 3 -x,y+1/2,-z+1/2 4 -x+1/2,-y,z+1/2 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 7.94027122013 _pdbx_refine_tls.origin_y -31.2282745362 _pdbx_refine_tls.origin_z -12.3440321507 _pdbx_refine_tls.T[1][1] 0.764134515536 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.115321650293 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.113873952522 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.697157203394 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.075772152529 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.774264382297 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 0.770923458574 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.182036829403 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.263055062613 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 3.47966584752 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.345090271265 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.695015535317 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.196539661405 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.0319746453126 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.162445957449 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.549541962265 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.210616722952 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.296356413328 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.168066485537 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.112031779837 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] 0.0482399232972 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id A _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id A _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id F _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id C _pdbx_refine_tls_group.end_auth_seq_id 2 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal ADN "O5'" O N N 1 ADN "C5'" C N N 2 ADN "C4'" C N R 3 ADN "O4'" O N N 4 ADN "C3'" C N S 5 ADN "O3'" O N N 6 ADN "C2'" C N R 7 ADN "O2'" O N N 8 ADN "C1'" C N R 9 ADN N9 N Y N 10 ADN C8 C Y N 11 ADN N7 N Y N 12 ADN C5 C Y N 13 ADN C6 C Y N 14 ADN N6 N N N 15 ADN N1 N Y N 16 ADN C2 C Y N 17 ADN N3 N Y N 18 ADN C4 C Y N 19 ADN "HO5'" H N N 20 ADN "H5'1" H N N 21 ADN "H5'2" H N N 22 ADN "H4'" H N N 23 ADN "H3'" H N N 24 ADN "HO3'" H N N 25 ADN "H2'" H N N 26 ADN "HO2'" H N N 27 ADN "H1'" H N N 28 ADN H8 H N N 29 ADN HN61 H N N 30 ADN HN62 H N N 31 ADN H2 H N N 32 DA OP3 O N N 33 DA P P N N 34 DA OP1 O N N 35 DA OP2 O N N 36 DA "O5'" O N N 37 DA "C5'" C N N 38 DA "C4'" C N R 39 DA "O4'" O N N 40 DA "C3'" C N S 41 DA "O3'" O N N 42 DA "C2'" C N N 43 DA "C1'" C N R 44 DA N9 N Y N 45 DA C8 C Y N 46 DA N7 N Y N 47 DA C5 C Y N 48 DA C6 C Y N 49 DA N6 N N N 50 DA N1 N Y N 51 DA C2 C Y N 52 DA N3 N Y N 53 DA C4 C Y N 54 DA HOP3 H N N 55 DA HOP2 H N N 56 DA "H5'" H N N 57 DA "H5''" H N N 58 DA "H4'" H N N 59 DA "H3'" H N N 60 DA "HO3'" H N N 61 DA "H2'" H N N 62 DA "H2''" H N N 63 DA "H1'" H N N 64 DA H8 H N N 65 DA H61 H N N 66 DA H62 H N N 67 DA H2 H N N 68 DC OP3 O N N 69 DC P P N N 70 DC OP1 O N N 71 DC OP2 O N N 72 DC "O5'" O N N 73 DC "C5'" C N N 74 DC "C4'" C N R 75 DC "O4'" O N N 76 DC "C3'" C N S 77 DC "O3'" O N N 78 DC "C2'" C N N 79 DC "C1'" C N R 80 DC N1 N N N 81 DC C2 C N N 82 DC O2 O N N 83 DC N3 N N N 84 DC C4 C N N 85 DC N4 N N N 86 DC C5 C N N 87 DC C6 C N N 88 DC HOP3 H N N 89 DC HOP2 H N N 90 DC "H5'" H N N 91 DC "H5''" H N N 92 DC "H4'" H N N 93 DC "H3'" H N N 94 DC "HO3'" H N N 95 DC "H2'" H N N 96 DC "H2''" H N N 97 DC "H1'" H N N 98 DC H41 H N N 99 DC H42 H N N 100 DC H5 H N N 101 DC H6 H N N 102 DG OP3 O N N 103 DG P P N N 104 DG OP1 O N N 105 DG OP2 O N N 106 DG "O5'" O N N 107 DG "C5'" C N N 108 DG "C4'" C N R 109 DG "O4'" O N N 110 DG "C3'" C N S 111 DG "O3'" O N N 112 DG "C2'" C N N 113 DG "C1'" C N R 114 DG N9 N Y N 115 DG C8 C Y N 116 DG N7 N Y N 117 DG C5 C Y N 118 DG C6 C N N 119 DG O6 O N N 120 DG N1 N N N 121 DG C2 C N N 122 DG N2 N N N 123 DG N3 N N N 124 DG C4 C Y N 125 DG HOP3 H N N 126 DG HOP2 H N N 127 DG "H5'" H N N 128 DG "H5''" H N N 129 DG "H4'" H N N 130 DG "H3'" H N N 131 DG "HO3'" H N N 132 DG "H2'" H N N 133 DG "H2''" H N N 134 DG "H1'" H N N 135 DG H8 H N N 136 DG H1 H N N 137 DG H21 H N N 138 DG H22 H N N 139 DT OP3 O N N 140 DT P P N N 141 DT OP1 O N N 142 DT OP2 O N N 143 DT "O5'" O N N 144 DT "C5'" C N N 145 DT "C4'" C N R 146 DT "O4'" O N N 147 DT "C3'" C N S 148 DT "O3'" O N N 149 DT "C2'" C N N 150 DT "C1'" C N R 151 DT N1 N N N 152 DT C2 C N N 153 DT O2 O N N 154 DT N3 N N N 155 DT C4 C N N 156 DT O4 O N N 157 DT C5 C N N 158 DT C7 C N N 159 DT C6 C N N 160 DT HOP3 H N N 161 DT HOP2 H N N 162 DT "H5'" H N N 163 DT "H5''" H N N 164 DT "H4'" H N N 165 DT "H3'" H N N 166 DT "HO3'" H N N 167 DT "H2'" H N N 168 DT "H2''" H N N 169 DT "H1'" H N N 170 DT H3 H N N 171 DT H71 H N N 172 DT H72 H N N 173 DT H73 H N N 174 DT H6 H N N 175 NA NA NA N N 176 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal ADN "O5'" "C5'" sing N N 1 ADN "O5'" "HO5'" sing N N 2 ADN "C5'" "C4'" sing N N 3 ADN "C5'" "H5'1" sing N N 4 ADN "C5'" "H5'2" sing N N 5 ADN "C4'" "O4'" sing N N 6 ADN "C4'" "C3'" sing N N 7 ADN "C4'" "H4'" sing N N 8 ADN "O4'" "C1'" sing N N 9 ADN "C3'" "O3'" sing N N 10 ADN "C3'" "C2'" sing N N 11 ADN "C3'" "H3'" sing N N 12 ADN "O3'" "HO3'" sing N N 13 ADN "C2'" "O2'" sing N N 14 ADN "C2'" "C1'" sing N N 15 ADN "C2'" "H2'" sing N N 16 ADN "O2'" "HO2'" sing N N 17 ADN "C1'" N9 sing N N 18 ADN "C1'" "H1'" sing N N 19 ADN N9 C8 sing Y N 20 ADN N9 C4 sing Y N 21 ADN C8 N7 doub Y N 22 ADN C8 H8 sing N N 23 ADN N7 C5 sing Y N 24 ADN C5 C6 sing Y N 25 ADN C5 C4 doub Y N 26 ADN C6 N6 sing N N 27 ADN C6 N1 doub Y N 28 ADN N6 HN61 sing N N 29 ADN N6 HN62 sing N N 30 ADN N1 C2 sing Y N 31 ADN C2 N3 doub Y N 32 ADN C2 H2 sing N N 33 ADN N3 C4 sing Y N 34 DA OP3 P sing N N 35 DA OP3 HOP3 sing N N 36 DA P OP1 doub N N 37 DA P OP2 sing N N 38 DA P "O5'" sing N N 39 DA OP2 HOP2 sing N N 40 DA "O5'" "C5'" sing N N 41 DA "C5'" "C4'" sing N N 42 DA "C5'" "H5'" sing N N 43 DA "C5'" "H5''" sing N N 44 DA "C4'" "O4'" sing N N 45 DA "C4'" "C3'" sing N N 46 DA "C4'" "H4'" sing N N 47 DA "O4'" "C1'" sing N N 48 DA "C3'" "O3'" sing N N 49 DA "C3'" "C2'" sing N N 50 DA "C3'" "H3'" sing N N 51 DA "O3'" "HO3'" sing N N 52 DA "C2'" "C1'" sing N N 53 DA "C2'" "H2'" sing N N 54 DA "C2'" "H2''" sing N N 55 DA "C1'" N9 sing N N 56 DA "C1'" "H1'" sing N N 57 DA N9 C8 sing Y N 58 DA N9 C4 sing Y N 59 DA C8 N7 doub Y N 60 DA C8 H8 sing N N 61 DA N7 C5 sing Y N 62 DA C5 C6 sing Y N 63 DA C5 C4 doub Y N 64 DA C6 N6 sing N N 65 DA C6 N1 doub Y N 66 DA N6 H61 sing N N 67 DA N6 H62 sing N N 68 DA N1 C2 sing Y N 69 DA C2 N3 doub Y N 70 DA C2 H2 sing N N 71 DA N3 C4 sing Y N 72 DC OP3 P sing N N 73 DC OP3 HOP3 sing N N 74 DC P OP1 doub N N 75 DC P OP2 sing N N 76 DC P "O5'" sing N N 77 DC OP2 HOP2 sing N N 78 DC "O5'" "C5'" sing N N 79 DC "C5'" "C4'" sing N N 80 DC "C5'" "H5'" sing N N 81 DC "C5'" "H5''" sing N N 82 DC "C4'" "O4'" sing N N 83 DC "C4'" "C3'" sing N N 84 DC "C4'" "H4'" sing N N 85 DC "O4'" "C1'" sing N N 86 DC "C3'" "O3'" sing N N 87 DC "C3'" "C2'" sing N N 88 DC "C3'" "H3'" sing N N 89 DC "O3'" "HO3'" sing N N 90 DC "C2'" "C1'" sing N N 91 DC "C2'" "H2'" sing N N 92 DC "C2'" "H2''" sing N N 93 DC "C1'" N1 sing N N 94 DC "C1'" "H1'" sing N N 95 DC N1 C2 sing N N 96 DC N1 C6 sing N N 97 DC C2 O2 doub N N 98 DC C2 N3 sing N N 99 DC N3 C4 doub N N 100 DC C4 N4 sing N N 101 DC C4 C5 sing N N 102 DC N4 H41 sing N N 103 DC N4 H42 sing N N 104 DC C5 C6 doub N N 105 DC C5 H5 sing N N 106 DC C6 H6 sing N N 107 DG OP3 P sing N N 108 DG OP3 HOP3 sing N N 109 DG P OP1 doub N N 110 DG P OP2 sing N N 111 DG P "O5'" sing N N 112 DG OP2 HOP2 sing N N 113 DG "O5'" "C5'" sing N N 114 DG "C5'" "C4'" sing N N 115 DG "C5'" "H5'" sing N N 116 DG "C5'" "H5''" sing N N 117 DG "C4'" "O4'" sing N N 118 DG "C4'" "C3'" sing N N 119 DG "C4'" "H4'" sing N N 120 DG "O4'" "C1'" sing N N 121 DG "C3'" "O3'" sing N N 122 DG "C3'" "C2'" sing N N 123 DG "C3'" "H3'" sing N N 124 DG "O3'" "HO3'" sing N N 125 DG "C2'" "C1'" sing N N 126 DG "C2'" "H2'" sing N N 127 DG "C2'" "H2''" sing N N 128 DG "C1'" N9 sing N N 129 DG "C1'" "H1'" sing N N 130 DG N9 C8 sing Y N 131 DG N9 C4 sing Y N 132 DG C8 N7 doub Y N 133 DG C8 H8 sing N N 134 DG N7 C5 sing Y N 135 DG C5 C6 sing N N 136 DG C5 C4 doub Y N 137 DG C6 O6 doub N N 138 DG C6 N1 sing N N 139 DG N1 C2 sing N N 140 DG N1 H1 sing N N 141 DG C2 N2 sing N N 142 DG C2 N3 doub N N 143 DG N2 H21 sing N N 144 DG N2 H22 sing N N 145 DG N3 C4 sing N N 146 DT OP3 P sing N N 147 DT OP3 HOP3 sing N N 148 DT P OP1 doub N N 149 DT P OP2 sing N N 150 DT P "O5'" sing N N 151 DT OP2 HOP2 sing N N 152 DT "O5'" "C5'" sing N N 153 DT "C5'" "C4'" sing N N 154 DT "C5'" "H5'" sing N N 155 DT "C5'" "H5''" sing N N 156 DT "C4'" "O4'" sing N N 157 DT "C4'" "C3'" sing N N 158 DT "C4'" "H4'" sing N N 159 DT "O4'" "C1'" sing N N 160 DT "C3'" "O3'" sing N N 161 DT "C3'" "C2'" sing N N 162 DT "C3'" "H3'" sing N N 163 DT "O3'" "HO3'" sing N N 164 DT "C2'" "C1'" sing N N 165 DT "C2'" "H2'" sing N N 166 DT "C2'" "H2''" sing N N 167 DT "C1'" N1 sing N N 168 DT "C1'" "H1'" sing N N 169 DT N1 C2 sing N N 170 DT N1 C6 sing N N 171 DT C2 O2 doub N N 172 DT C2 N3 sing N N 173 DT N3 C4 sing N N 174 DT N3 H3 sing N N 175 DT C4 O4 doub N N 176 DT C4 C5 sing N N 177 DT C5 C7 sing N N 178 DT C5 C6 doub N N 179 DT C7 H71 sing N N 180 DT C7 H72 sing N N 181 DT C7 H73 sing N N 182 DT C6 H6 sing N N 183 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9URS 'double helix' 9URS 'a-form double helix' 9URS 'b-form double helix' 9URS 'hairpin loop' 9URS 'bulge loop' 9URS 'mismatched base pair' 9URS 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 1 1_555 A DC 39 1_555 -0.228 -0.165 0.554 -0.934 1.137 2.217 1 A_DG1:DC39_A A 1 ? A 39 ? 19 1 1 A DA 2 1_555 A DT 38 1_555 0.071 -0.178 0.742 0.302 1.946 -1.126 2 A_DA2:DT38_A A 2 ? A 38 ? 20 1 1 A DC 3 1_555 A DG 37 1_555 0.214 -0.217 0.655 5.169 1.372 1.754 3 A_DC3:DG37_A A 3 ? A 37 ? 19 1 1 A DG 4 1_555 A DC 36 1_555 -0.148 -0.179 0.723 6.644 -7.040 -1.432 4 A_DG4:DC36_A A 4 ? A 36 ? 19 1 1 A DA 5 1_555 A DT 35 1_555 0.127 -0.080 0.244 -0.838 -8.142 -4.682 5 A_DA5:DT35_A A 5 ? A 35 ? 20 1 1 A DC 6 1_555 A DG 34 1_555 0.164 -0.180 0.239 -1.051 -6.509 -3.169 6 A_DC6:DG34_A A 6 ? A 34 ? 19 1 1 A DG 7 1_555 A DG 11 1_555 4.959 0.328 -0.801 10.808 -5.254 -119.031 7 A_DG7:DG11_A A 7 ? A 11 ? 7 4 1 A DA 32 1_555 A DT 10 1_555 0.145 1.214 -0.171 -14.027 6.844 167.316 8 A_DA32:DT10_A A 32 ? A 10 ? 21 2 1 A DT 9 1_555 A DA 31 1_555 -0.025 0.539 0.380 -1.142 -8.840 173.430 9 A_DT9:DA31_A A 9 ? A 31 ? 21 2 1 A DG 13 1_555 A DG 33 1_555 -5.491 -0.353 -0.149 -12.702 4.078 -115.341 10 A_DG13:DG33_A A 13 ? A 33 ? 7 4 1 A DA 17 1_555 A DG 30 1_555 -6.579 -4.431 0.435 -9.485 2.654 1.313 11 A_DA17:DG30_A A 17 ? A 30 ? 11 9 1 A DG 18 1_555 A DC 29 1_555 -0.195 -0.125 0.324 9.610 2.757 4.009 12 A_DG18:DC29_A A 18 ? A 29 ? 19 1 1 A DA 19 1_555 A DT 28 1_555 0.103 -0.163 0.784 7.950 -9.743 -1.977 13 A_DA19:DT28_A A 19 ? A 28 ? 20 1 1 A DA 20 1_555 A DT 27 1_555 -0.048 -0.093 0.278 2.597 -12.653 -8.217 14 A_DA20:DT27_A A 20 ? A 27 ? 20 1 1 A DC 21 1_555 A DG 26 1_555 0.205 -0.134 0.315 -0.457 -12.609 -0.606 15 A_DC21:DG26_A A 21 ? A 26 ? 19 1 1 A DT 22 1_555 A DG 25 1_555 1.039 -0.351 0.223 0.936 -3.750 15.443 16 A_DT22:DG25_A A 22 ? A 25 ? 28 1 1 B DG 1 1_555 B DC 39 1_555 -0.181 -0.155 0.327 0.994 1.662 0.666 17 B_DG1:DC39_B B 1 ? B 39 ? 19 1 1 B DA 2 1_555 B DT 38 1_555 0.049 -0.132 0.506 -1.499 -0.952 -3.365 18 B_DA2:DT38_B B 2 ? B 38 ? 20 1 1 B DC 3 1_555 B DG 37 1_555 0.228 -0.136 0.466 0.334 1.573 1.235 19 B_DC3:DG37_B B 3 ? B 37 ? 19 1 1 B DG 4 1_555 B DC 36 1_555 -0.172 -0.162 0.830 5.524 -1.719 1.413 20 B_DG4:DC36_B B 4 ? B 36 ? 19 1 1 B DA 5 1_555 B DT 35 1_555 0.130 -0.178 0.427 1.213 -4.902 -1.638 21 B_DA5:DT35_B B 5 ? B 35 ? 20 1 1 B DC 6 1_555 B DG 34 1_555 0.192 -0.159 0.341 -0.302 -5.766 -1.285 22 B_DC6:DG34_B B 6 ? B 34 ? 19 1 1 B DG 7 1_555 B DG 11 1_555 5.817 -0.704 -0.658 7.412 -4.285 -111.890 23 B_DG7:DG11_B B 7 ? B 11 ? 7 4 1 B DA 32 1_555 B DT 10 1_555 0.239 1.384 -0.208 -14.182 5.183 165.887 24 B_DA32:DT10_B B 32 ? B 10 ? 21 2 1 B DT 9 1_555 B DA 31 1_555 -0.117 -1.153 0.182 -2.324 7.920 -176.268 25 B_DT9:DA31_B B 9 ? B 31 ? 21 2 1 B DG 13 1_555 B DG 33 1_555 -5.424 -0.243 -0.271 -16.741 1.230 -116.223 26 B_DG13:DG33_B B 13 ? B 33 ? 7 4 1 B DA 17 1_555 B DG 30 1_555 -6.602 -4.454 0.270 -11.301 0.142 3.433 27 B_DA17:DG30_B B 17 ? B 30 ? 11 9 1 B DG 18 1_555 B DC 29 1_555 -0.195 -0.141 0.118 8.559 3.586 2.449 28 B_DG18:DC29_B B 18 ? B 29 ? 19 1 1 B DA 19 1_555 B DT 28 1_555 0.157 -0.147 0.597 5.525 -9.423 -0.490 29 B_DA19:DT28_B B 19 ? B 28 ? 20 1 1 B DA 20 1_555 B DT 27 1_555 -0.054 -0.120 0.187 3.367 -11.695 -7.141 30 B_DA20:DT27_B B 20 ? B 27 ? 20 1 1 B DC 21 1_555 B DG 26 1_555 -0.605 0.397 0.345 2.407 -8.873 11.615 31 B_DC21:DG26_B B 21 ? B 26 ? 19 1 1 B DT 22 1_555 B DG 25 1_555 1.168 -0.350 0.345 3.684 0.576 16.436 32 B_DT22:DG25_B B 22 ? B 25 ? 28 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 1 1_555 A DC 39 1_555 A DA 2 1_555 A DT 38 1_555 -0.595 -0.697 3.137 -3.329 2.476 33.020 -1.614 0.505 3.122 4.334 5.828 33.272 1 AA_DG1DA2:DT38DC39_AA A 1 ? A 39 ? A 2 ? A 38 ? 1 A DA 2 1_555 A DT 38 1_555 A DC 3 1_555 A DG 37 1_555 -0.009 -0.993 3.211 -0.033 2.212 29.234 -2.425 0.011 3.129 4.374 0.066 29.316 2 AA_DA2DC3:DG37DT38_AA A 2 ? A 38 ? A 3 ? A 37 ? 1 A DC 3 1_555 A DG 37 1_555 A DG 4 1_555 A DC 36 1_555 -0.106 0.061 3.237 -1.279 0.752 36.427 -0.005 -0.005 3.240 1.203 2.045 36.456 3 AA_DC3DG4:DC36DG37_AA A 3 ? A 37 ? A 4 ? A 36 ? 1 A DG 4 1_555 A DC 36 1_555 A DA 5 1_555 A DT 35 1_555 -0.170 -0.861 3.367 -0.121 -1.002 37.834 -1.194 0.246 3.389 -1.545 0.187 37.847 4 AA_DG4DA5:DT35DC36_AA A 4 ? A 36 ? A 5 ? A 35 ? 1 A DA 5 1_555 A DT 35 1_555 A DC 6 1_555 A DG 34 1_555 0.177 -0.957 3.262 -5.271 1.124 35.864 -1.693 -1.015 3.175 1.813 8.500 36.254 5 AA_DA5DC6:DG34DT35_AA A 5 ? A 35 ? A 6 ? A 34 ? 1 A DC 6 1_555 A DG 34 1_555 A DG 7 1_555 A DG 11 1_555 -1.919 -0.975 3.063 7.964 1.178 83.663 -0.754 1.607 2.894 0.881 -5.958 83.978 6 AA_DC6DG7:DG11DG34_AA A 6 ? A 34 ? A 7 ? A 11 ? 1 A DG 7 1_555 A DG 11 1_555 A DA 32 1_555 A DT 10 1_555 -4.905 3.113 1.521 156.760 33.050 31.249 1.742 1.713 -3.584 18.011 -85.432 160.945 7 AA_DG7DA32:DT10DG11_AA A 7 ? A 11 ? A 32 ? A 10 ? 1 A DT 9 1_555 A DA 31 1_555 A DG 13 1_555 A DG 33 1_555 5.545 -3.581 -1.356 -151.568 -71.343 -91.084 1.805 2.760 1.468 36.428 -77.393 -171.268 8 AA_DT9DG13:DG33DA31_AA A 9 ? A 31 ? A 13 ? A 33 ? 1 A DA 17 1_555 A DG 30 1_555 A DG 18 1_555 A DC 29 1_555 -0.080 1.815 3.089 -0.082 5.339 55.723 1.638 0.081 3.236 5.697 0.088 55.958 9 AA_DA17DG18:DC29DG30_AA A 17 ? A 30 ? A 18 ? A 29 ? 1 A DG 18 1_555 A DC 29 1_555 A DA 19 1_555 A DT 28 1_555 -1.148 0.980 3.408 -5.254 3.179 41.826 1.009 1.013 3.581 4.424 7.312 42.255 10 AA_DG18DA19:DT28DC29_AA A 18 ? A 29 ? A 19 ? A 28 ? 1 A DA 19 1_555 A DT 28 1_555 A DA 20 1_555 A DT 27 1_555 -0.333 -0.827 3.261 0.035 -1.276 35.311 -1.173 0.553 3.288 -2.103 -0.058 35.333 11 AA_DA19DA20:DT27DT28_AA A 19 ? A 28 ? A 20 ? A 27 ? 1 A DA 20 1_555 A DT 27 1_555 A DC 21 1_555 A DG 26 1_555 0.823 -0.593 3.466 0.663 -6.041 34.932 -0.019 -1.246 3.531 -9.970 -1.093 35.440 12 AA_DA20DC21:DG26DT27_AA A 20 ? A 27 ? A 21 ? A 26 ? 1 A DC 21 1_555 A DG 26 1_555 A DT 22 1_555 A DG 25 1_555 1.483 -0.553 3.702 -2.603 -6.947 38.277 0.123 -2.580 3.639 -10.475 3.924 38.963 13 AA_DC21DT22:DG25DG26_AA A 21 ? A 26 ? A 22 ? A 25 ? 1 B DG 1 1_555 B DC 39 1_555 B DA 2 1_555 B DT 38 1_555 -0.608 -0.506 3.229 -3.317 2.621 35.461 -1.200 0.516 3.227 4.284 5.422 35.704 14 BB_DG1DA2:DT38DC39_BB B 1 ? B 39 ? B 2 ? B 38 ? 1 B DA 2 1_555 B DT 38 1_555 B DC 3 1_555 B DG 37 1_555 0.235 -0.860 3.267 -0.450 3.308 28.661 -2.452 -0.569 3.145 6.654 0.905 28.851 15 BB_DA2DC3:DG37DT38_BB B 2 ? B 38 ? B 3 ? B 37 ? 1 B DC 3 1_555 B DG 37 1_555 B DG 4 1_555 B DC 36 1_555 0.110 0.201 3.193 -2.906 1.541 34.274 0.106 -0.628 3.179 2.608 4.916 34.426 16 BB_DC3DG4:DC36DG37_BB B 3 ? B 37 ? B 4 ? B 36 ? 1 B DG 4 1_555 B DC 36 1_555 B DA 5 1_555 B DT 35 1_555 -0.251 -0.805 3.359 -0.112 1.892 37.009 -1.526 0.380 3.316 2.979 0.176 37.056 17 BB_DG4DA5:DT35DC36_BB B 4 ? B 36 ? B 5 ? B 35 ? 1 B DA 5 1_555 B DT 35 1_555 B DC 6 1_555 B DG 34 1_555 0.362 -1.139 3.229 -2.257 1.597 35.121 -2.114 -0.926 3.147 2.641 3.733 35.226 18 BB_DA5DC6:DG34DT35_BB B 5 ? B 35 ? B 6 ? B 34 ? 1 B DC 6 1_555 B DG 34 1_555 B DG 7 1_555 B DG 11 1_555 -1.670 -1.013 3.129 9.133 0.536 90.343 -0.722 1.343 2.982 0.377 -6.425 90.705 19 BB_DC6DG7:DG11DG34_BB B 6 ? B 34 ? B 7 ? B 11 ? 1 B DG 7 1_555 B DG 11 1_555 B DA 32 1_555 B DT 10 1_555 -4.581 3.287 1.294 159.364 25.616 23.566 1.818 1.366 -3.647 13.979 -86.969 161.805 20 BB_DG7DA32:DT10DG11_BB B 7 ? B 11 ? B 32 ? B 10 ? 1 B DT 9 1_555 B DA 31 1_555 B DG 13 1_555 B DG 33 1_555 3.387 6.123 -0.969 71.955 -151.500 58.872 1.756 -2.328 -4.025 -78.563 -37.313 169.310 21 BB_DT9DG13:DG33DA31_BB B 9 ? B 31 ? B 13 ? B 33 ? 1 B DA 17 1_555 B DG 30 1_555 B DG 18 1_555 B DC 29 1_555 -0.210 2.144 3.120 -0.360 4.455 57.250 1.995 0.200 3.266 4.642 0.375 57.410 22 BB_DA17DG18:DC29DG30_BB B 17 ? B 30 ? B 18 ? B 29 ? 1 B DG 18 1_555 B DC 29 1_555 B DA 19 1_555 B DT 28 1_555 -0.921 1.007 3.574 -6.030 1.633 41.474 1.218 0.584 3.702 2.291 8.458 41.921 23 BB_DG18DA19:DT28DC29_BB B 18 ? B 29 ? B 19 ? B 28 ? 1 B DA 19 1_555 B DT 28 1_555 B DA 20 1_555 B DT 27 1_555 -0.358 -0.864 3.180 0.393 -0.291 35.196 -1.387 0.649 3.182 -0.482 -0.650 35.199 24 BB_DA19DA20:DT27DT28_BB B 19 ? B 28 ? B 20 ? B 27 ? 1 B DA 20 1_555 B DT 27 1_555 B DC 21 1_555 B DG 26 1_555 1.797 -0.721 3.474 1.616 -8.164 31.361 0.296 -2.905 3.628 -14.780 -2.926 32.420 25 BB_DA20DC21:DG26DT27_BB B 20 ? B 27 ? B 21 ? B 26 ? 1 B DC 21 1_555 B DG 26 1_555 B DT 22 1_555 B DG 25 1_555 1.050 -0.160 3.552 -2.250 -3.746 41.874 0.196 -1.713 3.495 -5.224 3.138 42.091 26 BB_DC21DT22:DG25DG26_BB B 21 ? B 26 ? B 22 ? B 25 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number 32171191 _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details I-SAD # _space_group.name_H-M_alt 'P 21 21 21' _space_group.name_Hall 'P 2ac 2ab' _space_group.IT_number 19 _space_group.crystal_system orthorhombic _space_group.id 1 # _atom_sites.entry_id 9URS _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.019877 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.015860 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.013115 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? NA ? ? 9.38062 1.54875 ? ? 3.38349 72.32734 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 7.96527 ? ? ? 9.05267 ? ? ? 0.0 ;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O1- ? ? 5.12366 3.84317 ? ? 3.49406 27.47979 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ # loop_ #