data_9UUG # _entry.id 9UUG # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.413 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9UUG pdb_00009uug 10.2210/pdb9uug/pdb WWPDB D_1300059044 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-06-10 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9UUG _pdbx_database_status.recvd_initial_deposition_date 2025-05-06 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email f.bono@exeter.ac.uk _pdbx_contact_author.name_first Bono _pdbx_contact_author.name_last Fulvia _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-0563-1840 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Hong, Z.' 1 ? 'Muehle, J.' 2 ? 'Bono, F.' 3 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title ;The structure of Egalitarian in complex with the K10 mRNA localization signal reveals a modular binding surface required for function ; _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Hong, Z.' 1 ? primary 'Jin, L.' 2 ? primary 'Muehle, J.' 3 ? primary 'Bullock, S.L.' 4 ? primary 'Bono, F.' 5 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (41-MER)' 18924.229 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 3 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGCUUGAUUGUAUUUUUAGCUAAGGAUGAAAGUCUAUGCUAAAAACUACAAAUUAAGCC _entity_poly.pdbx_seq_one_letter_code_can GGCUUGAUUGUAUUUUUAGCUAAGGAUGAAAGUCUAUGCUAAAAACUACAAAUUAAGCC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'MAGNESIUM ION' _pdbx_entity_nonpoly.comp_id MG # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 C n 1 4 U n 1 5 U n 1 6 G n 1 7 A n 1 8 U n 1 9 U n 1 10 G n 1 11 U n 1 12 A n 1 13 U n 1 14 U n 1 15 U n 1 16 U n 1 17 U n 1 18 A n 1 19 G n 1 20 C n 1 21 U n 1 22 A n 1 23 A n 1 24 G n 1 25 G n 1 26 A n 1 27 U n 1 28 G n 1 29 A n 1 30 A n 1 31 A n 1 32 G n 1 33 U n 1 34 C n 1 35 U n 1 36 A n 1 37 U n 1 38 G n 1 39 C n 1 40 U n 1 41 A n 1 42 A n 1 43 A n 1 44 A n 1 45 A n 1 46 C n 1 47 U n 1 48 A n 1 49 C n 1 50 A n 1 51 A n 1 52 A n 1 53 U n 1 54 U n 1 55 A n 1 56 A n 1 57 G n 1 58 C n 1 59 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 59 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Drosophila melanogaster' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 7227 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'Escherichia coli' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 562 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 ? ? ? A . n A 1 2 G 2 2 ? ? ? A . n A 1 3 C 3 3 ? ? ? A . n A 1 4 U 4 4 ? ? ? A . n A 1 5 U 5 5 ? ? ? A . n A 1 6 G 6 6 ? ? ? A . n A 1 7 A 7 7 7 A A A . n A 1 8 U 8 8 8 U U A . n A 1 9 U 9 9 9 U U A . n A 1 10 G 10 10 10 G G A . n A 1 11 U 11 11 11 U U A . n A 1 12 A 12 12 12 A A A . n A 1 13 U 13 13 13 U U A . n A 1 14 U 14 14 14 U U A . n A 1 15 U 15 15 15 U U A . n A 1 16 U 16 16 16 U U A . n A 1 17 U 17 17 17 U U A . n A 1 18 A 18 18 18 A A A . n A 1 19 G 19 19 19 G G A . n A 1 20 C 20 20 20 C C A . n A 1 21 U 21 21 21 U U A . n A 1 22 A 22 22 22 A A A . n A 1 23 A 23 23 23 A A A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 U 27 27 27 U U A . n A 1 28 G 28 28 28 G G A . n A 1 29 A 29 29 ? ? ? A . n A 1 30 A 30 30 ? ? ? A . n A 1 31 A 31 31 ? ? ? A . n A 1 32 G 32 32 32 G G A . n A 1 33 U 33 33 33 U U A . n A 1 34 C 34 34 34 C C A . n A 1 35 U 35 35 35 U U A . n A 1 36 A 36 36 36 A A A . n A 1 37 U 37 37 37 U U A . n A 1 38 G 38 38 38 G G A . n A 1 39 C 39 39 39 C C A . n A 1 40 U 40 40 40 U U A . n A 1 41 A 41 41 41 A A A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 A 44 44 44 A A A . n A 1 45 A 45 45 45 A A A . n A 1 46 C 46 46 ? ? ? A . n A 1 47 U 47 47 47 U U A . n A 1 48 A 48 48 48 A A A . n A 1 49 C 49 49 49 C C A . n A 1 50 A 50 50 50 A A A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 ? ? ? A . n A 1 53 U 53 53 ? ? ? A . n A 1 54 U 54 54 ? ? ? A . n A 1 55 A 55 55 ? ? ? A . n A 1 56 A 56 56 ? ? ? A . n A 1 57 G 57 57 ? ? ? A . n A 1 58 C 58 58 ? ? ? A . n A 1 59 C 59 59 ? ? ? A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG A . C 2 MG 1 102 2 MG MG A . D 2 MG 1 103 3 MG MG A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.10.1_2155: ???)' ? 1 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 2 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9UUG _cell.details ? _cell.formula_units_Z ? _cell.length_a 70.331 _cell.length_a_esd ? _cell.length_b 70.331 _cell.length_b_esd ? _cell.length_c 81.410 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9UUG _symmetry.cell_setting ? _symmetry.Int_Tables_number 92 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 41 21 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9UUG _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.66 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 53.76 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method EVAPORATION _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details '50 mM Na Cocadylate pH 6.75, 1.2 M Li2SO4, 10 mM MgAc2' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2016-03-13 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SLS BEAMLINE X10SA' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline X10SA _diffrn_source.pdbx_synchrotron_site SLS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9UUG _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.60 _reflns.d_resolution_low 50 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4519 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.7 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 6.21 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 5.29 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.31 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.992 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.60 _reflns_shell.d_res_low 3.82 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 731 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all 1.29 _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.928 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9UUG _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.601 _refine.ls_d_res_low 42.439 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4495 _refine.ls_number_reflns_R_free 215 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.25 _refine.ls_percent_reflns_R_free 4.78 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2918 _refine.ls_R_factor_R_free 0.2990 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2914 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.36 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 2JYF _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 26.43 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.30 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 871 _refine_hist.pdbx_number_atoms_ligand 3 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 874 _refine_hist.d_res_high 3.601 _refine_hist.d_res_low 42.439 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.004 ? 972 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.860 ? 1506 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 13.704 ? 483 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.034 ? 205 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.004 ? 41 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.601 4.5360 . . 107 2136 99.00 . . . . 0.2995 . . . . . . . . . . . . . . . 0.3247 'X-RAY DIFFRACTION' 4.5360 42.4 . . 108 2144 100.00 . . . . 0.2874 . . . . . . . . . . . . . . . 0.2845 # _struct.entry_id 9UUG _struct.title ;The structure of Egalitarian in complex with the K10 mRNA localization signal reveals a modular binding surface required for function ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9UUG _struct_keywords.text 'RNA, localization, Drosophila, Egalitarian, CRISPR, RNA BINDING PROTEIN' _struct_keywords.pdbx_keywords 'RNA BINDING PROTEIN' # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9UUG _struct_ref.pdbx_db_accession 9UUG _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9UUG _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 59 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9UUG _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 59 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 59 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 240 ? 1 MORE -14 ? 1 'SSA (A^2)' 7680 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A U 8 N3 ? ? ? 1_555 A A 51 N1 ? ? A U 8 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A U 8 O4 ? ? ? 1_555 A A 51 N6 ? ? A U 8 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 50 N1 ? ? A U 9 A A 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 50 N6 ? ? A U 9 A A 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 10 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 10 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 10 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 11 N3 ? ? ? 1_555 A A 48 N1 ? ? A U 11 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 11 O4 ? ? ? 1_555 A A 48 N6 ? ? A U 11 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 12 N1 ? ? ? 1_555 A U 47 N3 ? ? A A 12 A U 47 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog11 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 45 N1 ? ? A U 13 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 45 N6 ? ? A U 13 A A 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 44 N1 ? ? A U 14 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 44 N6 ? ? A U 14 A A 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 15 N3 ? ? ? 1_555 A A 43 N1 ? ? A U 15 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 15 O4 ? ? ? 1_555 A A 43 N6 ? ? A U 15 A A 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 16 N3 ? ? ? 1_555 A A 42 N1 ? ? A U 16 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 16 O4 ? ? ? 1_555 A A 42 N6 ? ? A U 16 A A 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 41 N1 ? ? A U 17 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 41 N6 ? ? A U 17 A A 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A A 18 N1 ? ? ? 1_555 A U 40 N3 ? ? A A 18 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 18 N6 ? ? ? 1_555 A U 40 O4 ? ? A A 18 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 19 N1 ? ? ? 1_555 A C 39 N3 ? ? A G 19 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 19 N2 ? ? ? 1_555 A C 39 O2 ? ? A G 19 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 19 O6 ? ? ? 1_555 A C 39 N4 ? ? A G 19 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 20 N3 ? ? ? 1_555 A G 38 N1 ? ? A C 20 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 20 N4 ? ? ? 1_555 A G 38 O6 ? ? A C 20 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 20 O2 ? ? ? 1_555 A G 38 N2 ? ? A C 20 A G 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 36 N7 ? ? A U 21 A A 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog30 hydrog ? ? A U 21 O2 ? ? ? 1_555 A A 36 N6 ? ? A U 21 A A 36 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ? ? ? hydrog31 hydrog ? ? A A 23 N1 ? ? ? 1_555 A U 37 N3 ? ? A A 23 A U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A A 23 N6 ? ? ? 1_555 A U 37 O4 ? ? A A 23 A U 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 24 N1 ? ? ? 1_555 A U 35 O2 ? ? A G 24 A U 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog34 hydrog ? ? A G 24 O6 ? ? ? 1_555 A U 35 N3 ? ? A G 24 A U 35 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 34 N3 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 34 O2 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 34 N4 ? ? A G 25 A C 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 33 N3 ? ? A A 26 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 33 O4 ? ? A A 26 A U 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 27 N3 ? ? ? 1_555 A G 32 O6 ? ? A U 27 A G 32 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A U 27 O2 ? ? ? 1_555 A G 32 N1 ? ? A U 27 A G 32 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9UUG _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 1.5489 _pdbx_refine_tls.origin_y 16.4042 _pdbx_refine_tls.origin_z 0.0802 _pdbx_refine_tls.T[1][1] 0.6994 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.0018 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0421 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.8656 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0382 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.7419 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.3318 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.9946 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.0280 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 1.9162 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.7175 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.0881 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.2909 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.4485 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.2250 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.4619 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.3339 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.1688 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.4228 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.5242 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0003 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A G 1 ? A G 1 2 1 Y 1 A G 2 ? A G 2 3 1 Y 1 A C 3 ? A C 3 4 1 Y 1 A U 4 ? A U 4 5 1 Y 1 A U 5 ? A U 5 6 1 Y 1 A G 6 ? A G 6 7 1 Y 1 A A 29 ? A A 29 8 1 Y 1 A A 30 ? A A 30 9 1 Y 1 A A 31 ? A A 31 10 1 Y 1 A C 46 ? A C 46 11 1 Y 1 A A 52 ? A A 52 12 1 Y 1 A U 53 ? A U 53 13 1 Y 1 A U 54 ? A U 54 14 1 Y 1 A A 55 ? A A 55 15 1 Y 1 A A 56 ? A A 56 16 1 Y 1 A G 57 ? A G 57 17 1 Y 1 A C 58 ? A C 58 18 1 Y 1 A C 59 ? A C 59 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 MG MG MG N N 111 U OP3 O N N 112 U P P N N 113 U OP1 O N N 114 U OP2 O N N 115 U "O5'" O N N 116 U "C5'" C N N 117 U "C4'" C N R 118 U "O4'" O N N 119 U "C3'" C N S 120 U "O3'" O N N 121 U "C2'" C N R 122 U "O2'" O N N 123 U "C1'" C N R 124 U N1 N N N 125 U C2 C N N 126 U O2 O N N 127 U N3 N N N 128 U C4 C N N 129 U O4 O N N 130 U C5 C N N 131 U C6 C N N 132 U HOP3 H N N 133 U HOP2 H N N 134 U "H5'" H N N 135 U "H5''" H N N 136 U "H4'" H N N 137 U "H3'" H N N 138 U "HO3'" H N N 139 U "H2'" H N N 140 U "HO2'" H N N 141 U "H1'" H N N 142 U H3 H N N 143 U H5 H N N 144 U H6 H N N 145 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9UUG 'double helix' 9UUG 'a-form double helix' 9UUG 'hairpin loop' 9UUG 'mismatched base pair' 9UUG 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A U 8 1_555 A A 51 1_555 0.204 -0.038 -0.403 9.267 -6.363 -10.366 1 A_U8:A51_A A 8 ? A 51 ? 20 1 1 A U 9 1_555 A A 50 1_555 -0.076 0.104 -1.019 13.081 -21.678 -6.243 2 A_U9:A50_A A 9 ? A 50 ? 20 1 1 A G 10 1_555 A C 49 1_555 -0.270 0.253 -0.181 -13.131 -2.221 -3.556 3 A_G10:C49_A A 10 ? A 49 ? 19 1 1 A U 11 1_555 A A 48 1_555 0.553 0.281 -0.198 5.240 -6.640 12.287 4 A_U11:A48_A A 11 ? A 48 ? 20 1 1 A A 12 1_555 A U 47 1_555 2.198 0.071 0.161 5.388 -24.441 17.773 5 A_A12:U47_A A 12 ? A 47 ? ? 1 1 A U 13 1_555 A A 45 1_555 0.513 0.242 0.866 -20.907 1.788 -10.656 6 A_U13:A45_A A 13 ? A 45 ? 20 1 1 A U 14 1_555 A A 44 1_555 -0.745 0.119 0.696 -6.836 -30.568 8.884 7 A_U14:A44_A A 14 ? A 44 ? 20 1 1 A U 15 1_555 A A 43 1_555 -0.264 -0.297 1.162 -8.608 -19.415 -0.726 8 A_U15:A43_A A 15 ? A 43 ? 20 1 1 A U 16 1_555 A A 42 1_555 0.603 -0.157 0.257 -2.972 -23.482 -1.170 9 A_U16:A42_A A 16 ? A 42 ? 20 1 1 A U 17 1_555 A A 41 1_555 -1.090 -0.210 0.547 0.944 -5.915 -3.124 10 A_U17:A41_A A 17 ? A 41 ? 20 1 1 A A 18 1_555 A U 40 1_555 0.884 -0.131 -0.826 -7.626 -24.600 5.172 11 A_A18:U40_A A 18 ? A 40 ? 20 1 1 A G 19 1_555 A C 39 1_555 1.053 -0.082 -0.971 -17.642 -13.095 -9.175 12 A_G19:C39_A A 19 ? A 39 ? 19 1 1 A C 20 1_555 A G 38 1_555 -0.244 0.055 -0.628 9.772 -17.400 5.735 13 A_C20:G38_A A 20 ? A 38 ? 19 1 1 A A 36 1_555 A U 21 1_555 -3.890 -2.446 -1.423 8.491 -14.195 -79.186 14 A_A36:U21_A A 36 ? A 21 ? 24 4 1 A A 23 1_555 A U 37 1_555 -0.592 -0.128 -0.016 -13.306 14.525 -4.519 15 A_A23:U37_A A 23 ? A 37 ? 20 1 1 A G 24 1_555 A U 35 1_555 -2.316 -0.593 0.571 0.178 -13.720 -5.273 16 A_G24:U35_A A 24 ? A 35 ? 28 1 1 A G 25 1_555 A C 34 1_555 -0.083 0.070 0.097 -0.647 -11.822 11.881 17 A_G25:C34_A A 25 ? A 34 ? 19 1 1 A A 26 1_555 A U 33 1_555 -0.572 -0.306 1.039 5.513 -13.746 4.066 18 A_A26:U33_A A 26 ? A 33 ? 20 1 1 A U 27 1_555 A G 32 1_555 2.022 -0.698 -0.295 -6.743 -6.996 -3.297 19 A_U27:G32_A A 27 ? A 32 ? 28 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A U 8 1_555 A A 51 1_555 A U 9 1_555 A A 50 1_555 -0.295 -1.868 3.714 0.967 0.251 30.095 -3.654 0.791 3.688 0.484 -1.862 30.111 1 AA_U8U9:A50A51_AA A 8 ? A 51 ? A 9 ? A 50 ? 1 A U 9 1_555 A A 50 1_555 A G 10 1_555 A C 49 1_555 0.428 -1.488 4.380 -8.483 12.685 29.645 -5.224 -2.503 3.254 22.974 15.365 33.263 2 AA_U9G10:C49A50_AA A 9 ? A 50 ? A 10 ? A 49 ? 1 A G 10 1_555 A C 49 1_555 A U 11 1_555 A A 48 1_555 -0.005 -1.223 3.080 0.519 1.943 28.507 -2.887 0.120 2.991 3.940 -1.052 28.577 3 AA_G10U11:A48C49_AA A 10 ? A 49 ? A 11 ? A 48 ? 1 A U 11 1_555 A A 48 1_555 A A 12 1_555 A U 47 1_555 -0.416 -1.561 3.001 0.557 24.753 33.849 -4.217 0.630 1.549 37.006 -0.833 41.722 4 AA_U11A12:U47A48_AA A 11 ? A 48 ? A 12 ? A 47 ? 1 A A 12 1_555 A U 47 1_555 A U 13 1_555 A A 45 1_555 1.034 -2.302 3.571 1.803 2.377 38.983 -3.748 -1.312 3.472 3.555 -2.697 39.093 5 AA_A12U13:A45U47_AA A 12 ? A 47 ? A 13 ? A 45 ? 1 A U 13 1_555 A A 45 1_555 A U 14 1_555 A A 44 1_555 0.980 -1.032 2.838 2.045 15.055 27.498 -4.188 -1.504 2.073 29.032 -3.943 31.345 6 AA_U13U14:A44A45_AA A 13 ? A 45 ? A 14 ? A 44 ? 1 A U 14 1_555 A A 44 1_555 A U 15 1_555 A A 43 1_555 -0.351 -0.998 3.077 -9.947 9.723 37.070 -2.530 -0.558 2.742 14.675 15.013 39.508 7 AA_U14U15:A43A44_AA A 14 ? A 44 ? A 15 ? A 43 ? 1 A U 15 1_555 A A 43 1_555 A U 16 1_555 A A 42 1_555 -0.489 -1.046 2.986 3.709 -0.845 36.869 -1.542 1.222 2.948 -1.331 -5.845 37.058 8 AA_U15U16:A42A43_AA A 15 ? A 43 ? A 16 ? A 42 ? 1 A U 16 1_555 A A 42 1_555 A U 17 1_555 A A 41 1_555 -0.212 -1.194 3.169 -6.534 8.505 23.381 -4.882 -1.211 2.551 19.711 15.142 25.692 9 AA_U16U17:A41A42_AA A 16 ? A 42 ? A 17 ? A 41 ? 1 A U 17 1_555 A A 41 1_555 A A 18 1_555 A U 40 1_555 0.059 -1.038 3.841 6.921 6.230 41.702 -2.149 0.721 3.621 8.622 -9.579 42.684 10 AA_U17A18:U40A41_AA A 17 ? A 41 ? A 18 ? A 40 ? 1 A A 18 1_555 A U 40 1_555 A G 19 1_555 A C 39 1_555 -0.667 -1.577 3.770 -5.772 9.325 28.865 -4.966 0.017 3.190 17.911 11.087 30.837 11 AA_A18G19:C39U40_AA A 18 ? A 40 ? A 19 ? A 39 ? 1 A G 19 1_555 A C 39 1_555 A C 20 1_555 A G 38 1_555 -0.461 -2.298 2.673 -6.232 -6.640 20.532 -3.580 -0.998 3.247 -17.555 16.478 22.441 12 AA_G19C20:G38C39_AA A 19 ? A 39 ? A 20 ? A 38 ? 1 A C 20 1_555 A G 38 1_555 A A 36 1_555 A U 21 1_555 0.406 -4.509 -0.524 -135.284 -101.918 48.117 -1.981 -0.578 1.965 -52.849 70.150 170.303 13 AA_C20A36:U21G38_AA A 20 ? A 38 ? A 36 ? A 21 ? 1 A A 36 1_555 A U 21 1_555 A A 23 1_555 A U 37 1_555 -2.912 4.215 2.131 -152.553 -21.971 54.300 2.377 -0.083 3.011 -11.977 83.158 157.019 14 AA_A36A23:U37U21_AA A 36 ? A 21 ? A 23 ? A 37 ? 1 A A 23 1_555 A U 37 1_555 A G 24 1_555 A U 35 1_555 4.253 -0.465 2.533 -6.789 26.935 62.378 -1.138 -3.999 1.806 24.749 6.238 67.709 15 AA_A23G24:U35U37_AA A 23 ? A 37 ? A 24 ? A 35 ? 1 A G 24 1_555 A U 35 1_555 A G 25 1_555 A C 34 1_555 0.746 -0.971 3.322 -2.638 9.082 40.779 -2.291 -1.316 2.996 12.827 3.725 41.816 16 AA_G24G25:C34U35_AA A 24 ? A 35 ? A 25 ? A 34 ? 1 A G 25 1_555 A C 34 1_555 A A 26 1_555 A U 33 1_555 -0.224 -1.994 2.874 -7.367 1.358 28.895 -4.120 -0.907 2.751 2.665 14.459 29.831 17 AA_G25A26:U33C34_AA A 25 ? A 34 ? A 26 ? A 33 ? 1 A A 26 1_555 A U 33 1_555 A U 27 1_555 A G 32 1_555 -0.849 -1.131 3.550 9.273 9.342 42.772 -2.368 1.989 3.013 12.461 -12.368 44.661 18 AA_A26U27:G32U33_AA A 26 ? A 33 ? A 27 ? A 32 ? # _pdbx_audit_support.funding_organization 'European Research Council (ERC)' _pdbx_audit_support.country 'European Union' _pdbx_audit_support.grant_number FP7/2007-2013 _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 2JYF _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9UUG _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.014218 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.014218 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.012284 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #