data_9VSN # _entry.id 9VSN # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.413 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9VSN pdb_00009vsn 10.2210/pdb9vsn/pdb WWPDB D_1300061268 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-05-20 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9VSN _pdbx_database_status.recvd_initial_deposition_date 2025-07-09 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email j.kondo@sophia.ac.jp _pdbx_contact_author.name_first Jiro _pdbx_contact_author.name_last Kondo _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5682-3685 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 ? 'Morishita, E.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country DE _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Small Sci' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2688-4046 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 6 _citation.language ? _citation.page_first e202600007 _citation.page_last e202600007 _citation.title ;AI-Augmented Iterative Screening of Libraries Against RNA Targets (AISLAR) Boosts Discovery of SAR-Tractable RNA Binders and Rational Analog Design. ; _citation.year 2026 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1002/smsc.202600007 _citation.pdbx_database_id_PubMed 42006585 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Hattori, H.' 1 0009-0002-3236-3220 primary 'Otsu, M.' 2 ? primary 'Imai, K.' 3 0009-0003-8915-6019 primary 'Narahara, M.' 4 ? primary 'Kondo, J.' 5 0000-0002-5682-3685 primary 'Shino, A.' 6 0009-0007-7913-5192 primary 'Morishita, E.C.' 7 0000-0002-6423-715X # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(*UP*UP*GP*GP*AP*AP*AP*CP*AP*UP*(5BU)P*CP*GP*AP*AP*CP*UP*AP*CP*UP*UP*CP*C)-3') ; 7348.248 2 ? ? ? ? 2 non-polymer syn 'POTASSIUM ION' 39.098 6 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code 'UUGGAAACAU(5BU)CGAACUACUUCC' _entity_poly.pdbx_seq_one_letter_code_can UUGGAAACAUUCGAACUACUUCC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # _pdbx_entity_nonpoly.entity_id 2 _pdbx_entity_nonpoly.name 'POTASSIUM ION' _pdbx_entity_nonpoly.comp_id K # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 U n 1 3 G n 1 4 G n 1 5 A n 1 6 A n 1 7 A n 1 8 C n 1 9 A n 1 10 U n 1 11 5BU n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 C n 1 17 U n 1 18 A n 1 19 C n 1 20 U n 1 21 U n 1 22 C n 1 23 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 23 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 5BU 'RNA linking' n "5-BROMO-URIDINE-5'-MONOPHOSPHATE" ? 'C9 H12 Br N2 O9 P' 403.077 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 1 1 U U A . n A 1 2 U 2 2 2 U U A . n A 1 3 G 3 3 3 G G A . n A 1 4 G 4 4 4 G G A . n A 1 5 A 5 5 5 A A A . n A 1 6 A 6 6 6 A A A . n A 1 7 A 7 7 7 A A A . n A 1 8 C 8 8 8 C C A . n A 1 9 A 9 9 9 A A A . n A 1 10 U 10 10 10 U U A . n A 1 11 5BU 11 11 11 5BU 5BU A . n A 1 12 C 12 12 12 C C A . n A 1 13 G 13 13 13 G G A . n A 1 14 A 14 14 14 A A A . n A 1 15 A 15 15 15 A A A . n A 1 16 C 16 16 16 C C A . n A 1 17 U 17 17 17 U U A . n A 1 18 A 18 18 18 A A A . n A 1 19 C 19 19 19 C C A . n A 1 20 U 20 20 20 U U A . n A 1 21 U 21 21 21 U U A . n A 1 22 C 22 22 22 C C A . n A 1 23 C 23 23 23 C C A . n B 1 1 U 1 1 1 U U B . n B 1 2 U 2 2 2 U U B . n B 1 3 G 3 3 3 G G B . n B 1 4 G 4 4 4 G G B . n B 1 5 A 5 5 5 A A B . n B 1 6 A 6 6 6 A A B . n B 1 7 A 7 7 7 A A B . n B 1 8 C 8 8 8 C C B . n B 1 9 A 9 9 9 A A B . n B 1 10 U 10 10 10 U U B . n B 1 11 5BU 11 11 11 5BU 5BU B . n B 1 12 C 12 12 12 C C B . n B 1 13 G 13 13 13 G G B . n B 1 14 A 14 14 14 A A B . n B 1 15 A 15 15 15 A A B . n B 1 16 C 16 16 16 C C B . n B 1 17 U 17 17 17 U U B . n B 1 18 A 18 18 18 A A B . n B 1 19 C 19 19 19 C C B . n B 1 20 U 20 20 20 U U B . n B 1 21 U 21 21 21 U U B . n B 1 22 C 22 22 22 C C B . n B 1 23 C 23 23 23 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 K 1 101 1 K K A . D 2 K 1 102 3 K K A . E 2 K 1 103 4 K K A . F 2 K 1 101 2 K K B . G 2 K 1 102 5 K K B . H 2 K 1 103 6 K K B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.17.1_3660: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . ? 2 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 3 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9VSN _cell.details ? _cell.formula_units_Z ? _cell.length_a 30.923 _cell.length_a_esd ? _cell.length_b 53.093 _cell.length_b_esd ? _cell.length_c 78.476 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9VSN _symmetry.cell_setting ? _symmetry.Int_Tables_number 19 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 21 21 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9VSN _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.19 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 43.88 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'MPD, MOPS, KCl, Spermine' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2021-06-05 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.91962 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.91962 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9VSN _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.1 _reflns.d_resolution_low 31.56 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4463 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 98.5 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 3.4 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 7.27 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.121 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.994 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.101 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 3.10 3.18 ? ? ? ? ? ? 314 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.461 ? ? 1 1 0.922 ? ? ? ? 0.382 ? ? ? ? ? ? ? ? ? 3.18 3.27 ? ? ? ? ? ? 316 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.371 ? ? 2 1 0.929 ? ? ? ? 0.305 ? ? ? ? ? ? ? ? ? 3.27 3.36 ? ? ? ? ? ? 325 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.34 ? ? 3 1 0.965 ? ? ? ? 0.28 ? ? ? ? ? ? ? ? ? 3.36 3.46 ? ? ? ? ? ? 310 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.351 ? ? 4 1 0.958 ? ? ? ? 0.288 ? ? ? ? ? ? ? ? ? 3.46 3.58 ? ? ? ? ? ? 286 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.224 ? ? 5 1 0.974 ? ? ? ? 0.185 ? ? ? ? ? ? ? ? ? 3.58 3.7 ? ? ? ? ? ? 279 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.261 ? ? 6 1 0.967 ? ? ? ? 0.217 ? ? ? ? ? ? ? ? ? 3.70 3.84 ? ? ? ? ? ? 294 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.207 ? ? 7 1 0.981 ? ? ? ? 0.176 ? ? ? ? ? ? ? ? ? 3.84 4.0 ? ? ? ? ? ? 254 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.176 ? ? 8 1 0.982 ? ? ? ? 0.15 ? ? ? ? ? ? ? ? ? 4.00 4.18 ? ? ? ? ? ? 245 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.137 ? ? 9 1 0.984 ? ? ? ? 0.116 ? ? ? ? ? ? ? ? ? 4.18 4.38 ? ? ? ? ? ? 265 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.125 ? ? 10 1 0.993 ? ? ? ? 0.107 ? ? ? ? ? ? ? ? ? 4.38 4.62 ? ? ? ? ? ? 218 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.11 ? ? 11 1 0.993 ? ? ? ? 0.094 ? ? ? ? ? ? ? ? ? 4.62 4.9 ? ? ? ? ? ? 223 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.103 ? ? 12 1 0.995 ? ? ? ? 0.088 ? ? ? ? ? ? ? ? ? 4.90 5.24 ? ? ? ? ? ? 218 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.088 ? ? 13 1 0.996 ? ? ? ? 0.075 ? ? ? ? ? ? ? ? ? 5.24 5.66 ? ? ? ? ? ? 187 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.088 ? ? 14 1 0.995 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ? 5.66 6.2 ? ? ? ? ? ? 185 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.092 ? ? 15 1 0.995 ? ? ? ? 0.078 ? ? ? ? ? ? ? ? ? 6.20 6.93 ? ? ? ? ? ? 147 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.089 ? ? 16 1 0.993 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ? 6.93 8.0 ? ? ? ? ? ? 144 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.088 ? ? 17 1 0.991 ? ? ? ? 0.075 ? ? ? ? ? ? ? ? ? 8.00 9.8 ? ? ? ? ? ? 117 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.094 ? ? 18 1 0.991 ? ? ? ? 0.08 ? ? ? ? ? ? ? ? ? 9.80 13.85 ? ? ? ? ? ? 90 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.084 ? ? 19 1 0.994 ? ? ? ? 0.071 ? ? ? ? ? ? ? ? ? 13.85 31.56 ? ? ? ? ? ? 46 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.09 ? ? 20 1 0.993 ? ? ? ? 0.068 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9VSN _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.10 _refine.ls_d_res_low 31.56 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4452 _refine.ls_number_reflns_R_free 441 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.23 _refine.ls_percent_reflns_R_free 9.91 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2234 _refine.ls_R_factor_R_free 0.2636 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2189 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.37 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model 'RNA duplex constructed using Coot' _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 33.57 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.32 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.10 _refine_hist.d_res_low 31.56 _refine_hist.number_atoms_solvent 0 _refine_hist.number_atoms_total 968 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 962 _refine_hist.pdbx_number_atoms_ligand 6 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.006 ? 1072 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.057 ? 1664 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 11.198 ? 528 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.044 ? 226 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 46 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.10 3.55 . . 143 1338 97.00 . . . . 0.2769 . . . . . . . . . . . . . . . 0.3692 'X-RAY DIFFRACTION' 3.55 4.46 . . 149 1334 99.00 . . . . 0.2127 . . . . . . . . . . . . . . . 0.2524 'X-RAY DIFFRACTION' 4.47 31.56 . . 149 1339 99.00 . . . . 0.2018 . . . . . . . . . . . . . . . 0.2329 # _struct.entry_id 9VSN _struct.title 'Crystal structure of RNA duplex containing an IRES internal loop' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9VSN _struct_keywords.text 'IRES, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 2 ? F N N 2 ? G N N 2 ? H N N 2 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9VSN _struct_ref.pdbx_db_accession 9VSN _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 9VSN A 1 ? 23 ? 9VSN 1 ? 23 ? 1 23 2 1 9VSN B 1 ? 23 ? 9VSN 1 ? 23 ? 1 23 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 4770 ? 1 MORE -24 ? 1 'SSA (A^2)' 7870 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F,G,H # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A U 10 "O3'" ? ? ? 1_555 A 5BU 11 P ? ? A U 10 A 5BU 11 1_555 ? ? ? ? ? ? ? 1.602 ? ? covale2 covale both ? A 5BU 11 "O3'" ? ? ? 1_555 A C 12 P ? ? A 5BU 11 A C 12 1_555 ? ? ? ? ? ? ? 1.607 ? ? covale3 covale both ? B U 10 "O3'" ? ? ? 1_555 B 5BU 11 P ? ? B U 10 B 5BU 11 1_555 ? ? ? ? ? ? ? 1.611 ? ? covale4 covale both ? B 5BU 11 "O3'" ? ? ? 1_555 B C 12 P ? ? B 5BU 11 B C 12 1_555 ? ? ? ? ? ? ? 1.609 ? ? hydrog1 hydrog ? ? A G 3 N1 ? ? ? 1_555 B C 23 N3 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 3 N2 ? ? ? 1_555 B C 23 O2 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 3 O6 ? ? ? 1_555 B C 23 N4 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 4 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 4 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 4 B C 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 5 N1 ? ? ? 1_555 B U 21 N3 ? ? A A 5 B U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 5 N6 ? ? ? 1_555 B U 21 O4 ? ? A A 5 B U 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 7 N6 ? ? ? 1_555 B U 17 O2 ? ? A A 7 B U 17 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog10 hydrog ? ? A C 8 N4 ? ? ? 1_555 B U 17 O2 ? ? A C 8 B U 17 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog11 hydrog ? ? A A 9 N6 ? ? ? 1_555 B C 16 N3 ? ? A A 9 B C 16 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog12 hydrog ? ? A U 10 N3 ? ? ? 1_555 B A 15 N1 ? ? A U 10 B A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 10 O4 ? ? ? 1_555 B A 15 N6 ? ? A U 10 B A 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A 5BU 11 N3 ? ? ? 1_555 B A 14 N1 ? ? A 5BU 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A 5BU 11 O4 ? ? ? 1_555 B A 14 N6 ? ? A 5BU 11 B A 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 12 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 12 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 12 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A A 14 N1 ? ? ? 1_555 B 5BU 11 N3 ? ? A A 14 B 5BU 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A A 14 N6 ? ? ? 1_555 B 5BU 11 O4 ? ? A A 14 B 5BU 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A A 15 N1 ? ? ? 1_555 B U 10 N3 ? ? A A 15 B U 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A A 15 N6 ? ? ? 1_555 B U 10 O4 ? ? A A 15 B U 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 16 O2 ? ? ? 1_555 B A 9 N6 ? ? A C 16 B A 9 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog27 hydrog ? ? A U 17 O2 ? ? ? 1_555 B C 8 N4 ? ? A U 17 B C 8 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog28 hydrog ? ? A A 18 N6 ? ? ? 1_555 B A 6 N7 ? ? A A 18 B A 6 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog29 hydrog ? ? A A 18 N7 ? ? ? 1_555 B A 6 N6 ? ? A A 18 B A 6 1_555 ? ? ? ? ? ? TYPE_2_PAIR ? ? ? hydrog30 hydrog ? ? A C 19 N4 ? ? ? 1_555 B A 7 N1 ? ? A C 19 B A 7 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog31 hydrog ? ? A U 20 O4 ? ? ? 1_555 B A 6 N6 ? ? A U 20 B A 6 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog32 hydrog ? ? A U 21 N3 ? ? ? 1_555 B A 5 N1 ? ? A U 21 B A 5 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog33 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 22 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 22 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 22 B G 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 23 N3 ? ? ? 1_555 B G 3 N1 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 23 N4 ? ? ? 1_555 B G 3 O6 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 23 O2 ? ? ? 1_555 B G 3 N2 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9VSN _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 5BU P P N N 1 5BU OP1 O N N 2 5BU OP2 O N N 3 5BU OP3 O N N 4 5BU "O5'" O N N 5 5BU "C5'" C N N 6 5BU "C4'" C N R 7 5BU "O4'" O N N 8 5BU "C3'" C N S 9 5BU "O3'" O N N 10 5BU "C2'" C N R 11 5BU "O2'" O N N 12 5BU "C1'" C N R 13 5BU N1 N N N 14 5BU C2 C N N 15 5BU O2 O N N 16 5BU N3 N N N 17 5BU C4 C N N 18 5BU O4 O N N 19 5BU C5 C N N 20 5BU C6 C N N 21 5BU BR BR N N 22 5BU HOP2 H N N 23 5BU HOP3 H N N 24 5BU "H5'" H N N 25 5BU "H5''" H N N 26 5BU "H4'" H N N 27 5BU "H3'" H N N 28 5BU "HO3'" H N N 29 5BU "H2'" H N N 30 5BU "HO2'" H N N 31 5BU "H1'" H N N 32 5BU H3 H N N 33 5BU H6 H N N 34 A OP3 O N N 35 A P P N N 36 A OP1 O N N 37 A OP2 O N N 38 A "O5'" O N N 39 A "C5'" C N N 40 A "C4'" C N R 41 A "O4'" O N N 42 A "C3'" C N S 43 A "O3'" O N N 44 A "C2'" C N R 45 A "O2'" O N N 46 A "C1'" C N R 47 A N9 N Y N 48 A C8 C Y N 49 A N7 N Y N 50 A C5 C Y N 51 A C6 C Y N 52 A N6 N N N 53 A N1 N Y N 54 A C2 C Y N 55 A N3 N Y N 56 A C4 C Y N 57 A HOP3 H N N 58 A HOP2 H N N 59 A "H5'" H N N 60 A "H5''" H N N 61 A "H4'" H N N 62 A "H3'" H N N 63 A "HO3'" H N N 64 A "H2'" H N N 65 A "HO2'" H N N 66 A "H1'" H N N 67 A H8 H N N 68 A H61 H N N 69 A H62 H N N 70 A H2 H N N 71 C OP3 O N N 72 C P P N N 73 C OP1 O N N 74 C OP2 O N N 75 C "O5'" O N N 76 C "C5'" C N N 77 C "C4'" C N R 78 C "O4'" O N N 79 C "C3'" C N S 80 C "O3'" O N N 81 C "C2'" C N R 82 C "O2'" O N N 83 C "C1'" C N R 84 C N1 N N N 85 C C2 C N N 86 C O2 O N N 87 C N3 N N N 88 C C4 C N N 89 C N4 N N N 90 C C5 C N N 91 C C6 C N N 92 C HOP3 H N N 93 C HOP2 H N N 94 C "H5'" H N N 95 C "H5''" H N N 96 C "H4'" H N N 97 C "H3'" H N N 98 C "HO3'" H N N 99 C "H2'" H N N 100 C "HO2'" H N N 101 C "H1'" H N N 102 C H41 H N N 103 C H42 H N N 104 C H5 H N N 105 C H6 H N N 106 G OP3 O N N 107 G P P N N 108 G OP1 O N N 109 G OP2 O N N 110 G "O5'" O N N 111 G "C5'" C N N 112 G "C4'" C N R 113 G "O4'" O N N 114 G "C3'" C N S 115 G "O3'" O N N 116 G "C2'" C N R 117 G "O2'" O N N 118 G "C1'" C N R 119 G N9 N Y N 120 G C8 C Y N 121 G N7 N Y N 122 G C5 C Y N 123 G C6 C N N 124 G O6 O N N 125 G N1 N N N 126 G C2 C N N 127 G N2 N N N 128 G N3 N N N 129 G C4 C Y N 130 G HOP3 H N N 131 G HOP2 H N N 132 G "H5'" H N N 133 G "H5''" H N N 134 G "H4'" H N N 135 G "H3'" H N N 136 G "HO3'" H N N 137 G "H2'" H N N 138 G "HO2'" H N N 139 G "H1'" H N N 140 G H8 H N N 141 G H1 H N N 142 G H21 H N N 143 G H22 H N N 144 K K K N N 145 U OP3 O N N 146 U P P N N 147 U OP1 O N N 148 U OP2 O N N 149 U "O5'" O N N 150 U "C5'" C N N 151 U "C4'" C N R 152 U "O4'" O N N 153 U "C3'" C N S 154 U "O3'" O N N 155 U "C2'" C N R 156 U "O2'" O N N 157 U "C1'" C N R 158 U N1 N N N 159 U C2 C N N 160 U O2 O N N 161 U N3 N N N 162 U C4 C N N 163 U O4 O N N 164 U C5 C N N 165 U C6 C N N 166 U HOP3 H N N 167 U HOP2 H N N 168 U "H5'" H N N 169 U "H5''" H N N 170 U "H4'" H N N 171 U "H3'" H N N 172 U "HO3'" H N N 173 U "H2'" H N N 174 U "HO2'" H N N 175 U "H1'" H N N 176 U H3 H N N 177 U H5 H N N 178 U H6 H N N 179 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 5BU P OP1 doub N N 1 5BU P OP2 sing N N 2 5BU P OP3 sing N N 3 5BU P "O5'" sing N N 4 5BU OP2 HOP2 sing N N 5 5BU OP3 HOP3 sing N N 6 5BU "O5'" "C5'" sing N N 7 5BU "C5'" "C4'" sing N N 8 5BU "C5'" "H5'" sing N N 9 5BU "C5'" "H5''" sing N N 10 5BU "C4'" "O4'" sing N N 11 5BU "C4'" "C3'" sing N N 12 5BU "C4'" "H4'" sing N N 13 5BU "O4'" "C1'" sing N N 14 5BU "C3'" "O3'" sing N N 15 5BU "C3'" "C2'" sing N N 16 5BU "C3'" "H3'" sing N N 17 5BU "O3'" "HO3'" sing N N 18 5BU "C2'" "O2'" sing N N 19 5BU "C2'" "C1'" sing N N 20 5BU "C2'" "H2'" sing N N 21 5BU "O2'" "HO2'" sing N N 22 5BU "C1'" N1 sing N N 23 5BU "C1'" "H1'" sing N N 24 5BU N1 C2 sing N N 25 5BU N1 C6 sing N N 26 5BU C2 O2 doub N N 27 5BU C2 N3 sing N N 28 5BU N3 C4 sing N N 29 5BU N3 H3 sing N N 30 5BU C4 O4 doub N N 31 5BU C4 C5 sing N N 32 5BU C5 C6 doub N N 33 5BU C5 BR sing N N 34 5BU C6 H6 sing N N 35 A OP3 P sing N N 36 A OP3 HOP3 sing N N 37 A P OP1 doub N N 38 A P OP2 sing N N 39 A P "O5'" sing N N 40 A OP2 HOP2 sing N N 41 A "O5'" "C5'" sing N N 42 A "C5'" "C4'" sing N N 43 A "C5'" "H5'" sing N N 44 A "C5'" "H5''" sing N N 45 A "C4'" "O4'" sing N N 46 A "C4'" "C3'" sing N N 47 A "C4'" "H4'" sing N N 48 A "O4'" "C1'" sing N N 49 A "C3'" "O3'" sing N N 50 A "C3'" "C2'" sing N N 51 A "C3'" "H3'" sing N N 52 A "O3'" "HO3'" sing N N 53 A "C2'" "O2'" sing N N 54 A "C2'" "C1'" sing N N 55 A "C2'" "H2'" sing N N 56 A "O2'" "HO2'" sing N N 57 A "C1'" N9 sing N N 58 A "C1'" "H1'" sing N N 59 A N9 C8 sing Y N 60 A N9 C4 sing Y N 61 A C8 N7 doub Y N 62 A C8 H8 sing N N 63 A N7 C5 sing Y N 64 A C5 C6 sing Y N 65 A C5 C4 doub Y N 66 A C6 N6 sing N N 67 A C6 N1 doub Y N 68 A N6 H61 sing N N 69 A N6 H62 sing N N 70 A N1 C2 sing Y N 71 A C2 N3 doub Y N 72 A C2 H2 sing N N 73 A N3 C4 sing Y N 74 C OP3 P sing N N 75 C OP3 HOP3 sing N N 76 C P OP1 doub N N 77 C P OP2 sing N N 78 C P "O5'" sing N N 79 C OP2 HOP2 sing N N 80 C "O5'" "C5'" sing N N 81 C "C5'" "C4'" sing N N 82 C "C5'" "H5'" sing N N 83 C "C5'" "H5''" sing N N 84 C "C4'" "O4'" sing N N 85 C "C4'" "C3'" sing N N 86 C "C4'" "H4'" sing N N 87 C "O4'" "C1'" sing N N 88 C "C3'" "O3'" sing N N 89 C "C3'" "C2'" sing N N 90 C "C3'" "H3'" sing N N 91 C "O3'" "HO3'" sing N N 92 C "C2'" "O2'" sing N N 93 C "C2'" "C1'" sing N N 94 C "C2'" "H2'" sing N N 95 C "O2'" "HO2'" sing N N 96 C "C1'" N1 sing N N 97 C "C1'" "H1'" sing N N 98 C N1 C2 sing N N 99 C N1 C6 sing N N 100 C C2 O2 doub N N 101 C C2 N3 sing N N 102 C N3 C4 doub N N 103 C C4 N4 sing N N 104 C C4 C5 sing N N 105 C N4 H41 sing N N 106 C N4 H42 sing N N 107 C C5 C6 doub N N 108 C C5 H5 sing N N 109 C C6 H6 sing N N 110 G OP3 P sing N N 111 G OP3 HOP3 sing N N 112 G P OP1 doub N N 113 G P OP2 sing N N 114 G P "O5'" sing N N 115 G OP2 HOP2 sing N N 116 G "O5'" "C5'" sing N N 117 G "C5'" "C4'" sing N N 118 G "C5'" "H5'" sing N N 119 G "C5'" "H5''" sing N N 120 G "C4'" "O4'" sing N N 121 G "C4'" "C3'" sing N N 122 G "C4'" "H4'" sing N N 123 G "O4'" "C1'" sing N N 124 G "C3'" "O3'" sing N N 125 G "C3'" "C2'" sing N N 126 G "C3'" "H3'" sing N N 127 G "O3'" "HO3'" sing N N 128 G "C2'" "O2'" sing N N 129 G "C2'" "C1'" sing N N 130 G "C2'" "H2'" sing N N 131 G "O2'" "HO2'" sing N N 132 G "C1'" N9 sing N N 133 G "C1'" "H1'" sing N N 134 G N9 C8 sing Y N 135 G N9 C4 sing Y N 136 G C8 N7 doub Y N 137 G C8 H8 sing N N 138 G N7 C5 sing Y N 139 G C5 C6 sing N N 140 G C5 C4 doub Y N 141 G C6 O6 doub N N 142 G C6 N1 sing N N 143 G N1 C2 sing N N 144 G N1 H1 sing N N 145 G C2 N2 sing N N 146 G C2 N3 doub N N 147 G N2 H21 sing N N 148 G N2 H22 sing N N 149 G N3 C4 sing N N 150 U OP3 P sing N N 151 U OP3 HOP3 sing N N 152 U P OP1 doub N N 153 U P OP2 sing N N 154 U P "O5'" sing N N 155 U OP2 HOP2 sing N N 156 U "O5'" "C5'" sing N N 157 U "C5'" "C4'" sing N N 158 U "C5'" "H5'" sing N N 159 U "C5'" "H5''" sing N N 160 U "C4'" "O4'" sing N N 161 U "C4'" "C3'" sing N N 162 U "C4'" "H4'" sing N N 163 U "O4'" "C1'" sing N N 164 U "C3'" "O3'" sing N N 165 U "C3'" "C2'" sing N N 166 U "C3'" "H3'" sing N N 167 U "O3'" "HO3'" sing N N 168 U "C2'" "O2'" sing N N 169 U "C2'" "C1'" sing N N 170 U "C2'" "H2'" sing N N 171 U "O2'" "HO2'" sing N N 172 U "C1'" N1 sing N N 173 U "C1'" "H1'" sing N N 174 U N1 C2 sing N N 175 U N1 C6 sing N N 176 U C2 O2 doub N N 177 U C2 N3 sing N N 178 U N3 C4 sing N N 179 U N3 H3 sing N N 180 U C4 O4 doub N N 181 U C4 C5 sing N N 182 U C5 C6 doub N N 183 U C5 H5 sing N N 184 U C6 H6 sing N N 185 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9VSN 'double helix' 9VSN 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 3 1_555 B C 23 1_555 -1.256 -0.213 -0.005 -1.056 -6.121 9.752 1 A_G3:C23_B A 3 ? B 23 ? 19 1 1 A G 4 1_555 B C 22 1_555 -0.472 -0.228 -0.118 -2.378 -22.640 3.395 2 A_G4:C22_B A 4 ? B 22 ? 19 1 1 A A 5 1_555 B U 21 1_555 0.196 0.128 -0.901 -24.562 -14.701 -12.027 3 A_A5:U21_B A 5 ? B 21 ? 20 1 1 A C 8 1_555 B U 17 1_555 -6.176 -2.403 0.134 17.336 -3.560 2.460 4 A_C8:U17_B A 8 ? B 17 ? ? ? 1 A A 9 1_555 B C 16 1_555 -2.171 -0.159 0.147 -1.082 -1.565 8.866 5 A_A9:C16_B A 9 ? B 16 ? ? 1 1 A U 10 1_555 B A 15 1_555 0.099 -0.218 -0.056 10.399 1.873 -5.188 6 A_U10:A15_B A 10 ? B 15 ? 20 1 1 A 5BU 11 1_555 B A 14 1_555 0.267 -0.503 -0.290 0.342 -12.267 -5.574 7 A_5BU11:A14_B A 11 ? B 14 ? 20 1 1 A C 12 1_555 B G 13 1_555 0.594 -0.590 -0.230 4.927 -9.785 -0.327 8 A_C12:G13_B A 12 ? B 13 ? 19 1 1 A G 13 1_555 B C 12 1_555 0.140 -0.394 -0.416 -5.667 -10.177 -3.876 9 A_G13:C12_B A 13 ? B 12 ? 19 1 1 A A 14 1_555 B 5BU 11 1_555 -0.299 -0.459 0.001 -10.080 -10.739 -6.397 10 A_A14:5BU11_B A 14 ? B 11 ? 20 1 1 A A 15 1_555 B U 10 1_555 -0.570 -0.138 0.027 2.444 -18.135 11.020 11 A_A15:U10_B A 15 ? B 10 ? 20 1 1 A C 16 1_555 B A 9 1_555 3.819 -0.833 0.673 -12.974 -7.107 13.021 12 A_C16:A9_B A 16 ? B 9 ? ? 1 1 A U 17 1_555 B C 8 1_555 7.127 -2.569 1.060 -19.057 -12.642 33.076 13 A_U17:C8_B A 17 ? B 8 ? ? ? 1 A C 19 1_555 B A 7 1_555 -5.142 -0.181 -0.450 13.692 -8.383 -36.115 14 A_C19:A7_B A 19 ? B 7 ? ? ? 1 A U 20 1_555 B A 6 1_555 0.895 1.724 0.278 5.120 5.627 -39.861 15 A_U20:A6_B A 20 ? B 6 ? ? ? 1 A U 21 1_555 B A 5 1_555 -0.746 0.758 -0.507 12.846 -3.840 12.672 16 A_U21:A5_B A 21 ? B 5 ? ? ? 1 A C 22 1_555 B G 4 1_555 -0.501 0.279 -0.598 17.627 -11.673 -1.087 17 A_C22:G4_B A 22 ? B 4 ? 19 1 1 A C 23 1_555 B G 3 1_555 0.220 -0.147 -0.513 0.550 -12.897 3.472 18 A_C23:G3_B A 23 ? B 3 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 3 1_555 B C 23 1_555 A G 4 1_555 B C 22 1_555 -0.055 -1.648 3.341 0.901 6.824 34.961 -3.662 0.218 2.974 11.225 -1.481 35.611 1 AA_G3G4:C22C23_BB A 3 ? B 23 ? A 4 ? B 22 ? 1 A G 4 1_555 B C 22 1_555 A A 5 1_555 B U 21 1_555 -1.063 -2.166 3.970 3.894 13.088 35.504 -5.147 2.175 2.893 20.549 -6.113 37.960 2 AA_G4A5:U21C22_BB A 4 ? B 22 ? A 5 ? B 21 ? 1 A C 8 1_555 B U 17 1_555 A A 9 1_555 B C 16 1_555 -0.081 -1.046 3.848 -14.568 13.135 49.119 -2.163 -1.000 3.382 15.121 16.772 52.665 3 AA_C8A9:C16U17_BB A 8 ? B 17 ? A 9 ? B 16 ? 1 A A 9 1_555 B C 16 1_555 A U 10 1_555 B A 15 1_555 -0.705 -1.477 3.002 -1.203 2.698 41.682 -2.328 0.874 2.923 3.786 1.689 41.782 4 AA_A9U10:A15C16_BB A 9 ? B 16 ? A 10 ? B 15 ? 1 A U 10 1_555 B A 15 1_555 A 5BU 11 1_555 B A 14 1_555 -0.300 -2.250 3.490 3.915 9.325 32.394 -5.313 1.124 2.704 16.229 -6.813 33.895 5 AA_U105BU11:A14A15_BB A 10 ? B 15 ? A 11 ? B 14 ? 1 A 5BU 11 1_555 B A 14 1_555 A C 12 1_555 B G 13 1_555 0.244 -1.216 3.109 1.082 9.592 35.422 -3.123 -0.254 2.706 15.415 -1.739 36.673 6 AA_5BU11C12:G13A14_BB A 11 ? B 14 ? A 12 ? B 13 ? 1 A C 12 1_555 B G 13 1_555 A G 13 1_555 B C 12 1_555 0.017 -1.794 3.598 1.997 10.640 26.727 -5.985 0.411 2.694 21.909 -4.111 28.799 7 AA_C12G13:C12G13_BB A 12 ? B 13 ? A 13 ? B 12 ? 1 A G 13 1_555 B C 12 1_555 A A 14 1_555 B 5BU 11 1_555 0.507 -1.707 3.427 -0.477 9.203 25.804 -5.794 -1.184 2.661 19.820 1.027 27.374 8 AA_G13A14:5BU11C12_BB A 13 ? B 12 ? A 14 ? B 11 ? 1 A A 14 1_555 B 5BU 11 1_555 A A 15 1_555 B U 10 1_555 1.055 -1.639 2.891 3.550 8.414 35.732 -3.556 -1.263 2.543 13.444 -5.672 36.844 9 AA_A14A15:U105BU11_BB A 14 ? B 11 ? A 15 ? B 10 ? 1 A A 15 1_555 B U 10 1_555 A C 16 1_555 B A 9 1_555 0.805 -1.142 3.623 -0.616 6.529 47.567 -1.962 -1.042 3.437 8.050 0.760 47.991 10 AA_A15C16:A9U10_BB A 15 ? B 10 ? A 16 ? B 9 ? 1 A C 16 1_555 B A 9 1_555 A U 17 1_555 B C 8 1_555 1.192 -0.984 3.186 11.922 4.719 43.910 -1.685 -0.485 3.269 6.156 -15.553 45.655 11 AA_C16U17:C8A9_BB A 16 ? B 9 ? A 17 ? B 8 ? 1 A C 19 1_555 B A 7 1_555 A U 20 1_555 B A 6 1_555 -2.083 -2.435 4.429 -14.076 32.074 51.461 -4.288 1.197 3.019 32.976 14.472 61.571 12 AA_C19U20:A6A7_BB A 19 ? B 7 ? A 20 ? B 6 ? 1 A U 20 1_555 B A 6 1_555 A U 21 1_555 B A 5 1_555 3.080 -0.879 3.607 -1.962 -5.602 25.542 -0.276 -7.374 3.474 -12.458 4.362 26.211 13 AA_U20U21:A5A6_BB A 20 ? B 6 ? A 21 ? B 5 ? 1 A U 21 1_555 B A 5 1_555 A C 22 1_555 B G 4 1_555 -0.743 -1.929 2.996 -5.942 14.262 34.561 -4.501 0.515 2.158 22.657 9.440 37.761 14 AA_U21C22:G4A5_BB A 21 ? B 5 ? A 22 ? B 4 ? 1 A C 22 1_555 B G 4 1_555 A C 23 1_555 B G 3 1_555 0.061 -1.973 3.880 0.438 8.619 32.699 -4.945 -0.026 3.270 14.986 -0.762 33.789 15 AA_C22C23:G3G4_BB A 22 ? B 4 ? A 23 ? B 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Japan Agency for Medical Research and Development (AMED)' Japan JP22ama121014 1 'Japan Agency for Medical Research and Development (AMED)' Japan JP23ama121014 2 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'in silico model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details 'RNA duplex constructed using Coot' # _atom_sites.entry_id 9VSN _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.032338 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.018835 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.012743 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol BR C K N O P # loop_ #