data_9X99 # _entry.id 9X99 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9X99 pdb_00009x99 10.2210/pdb9x99/pdb WWPDB D_1300064905 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-28 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9X99 _pdbx_database_status.recvd_initial_deposition_date 2025-10-20 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible N # _pdbx_contact_author.id 3 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of RhoBAST in comple with TMR-DN' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (58-MER)' 18574.088 1 ? ? ? ? 2 non-polymer syn ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; 727.740 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 3 ? ? ? ? 4 water nat water 18.015 8 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GDP)GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC' _entity_poly.pdbx_seq_one_letter_code_can GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id U _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; A1EZE 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GDP n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 C n 1 7 U n 1 8 C n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 G n 1 18 G n 1 19 C n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 G n 1 32 G n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 G n 1 39 G n 1 40 U n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 A n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 57 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 A1EZE non-polymer . ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; ? 'C37 H39 N6 O10 1' 727.740 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GDP 'RNA linking' n "GUANOSINE-5'-DIPHOSPHATE" ? 'C10 H15 N5 O11 P2' 443.201 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GDP 1 1 1 GDP GDP U . n A 1 2 G 2 2 2 G G U . n A 1 3 A 3 3 3 A A U . n A 1 4 A 4 4 4 A A U . n A 1 5 C 5 5 5 C C U . n A 1 6 C 6 6 6 C C U . n A 1 7 U 7 7 7 U U U . n A 1 8 C 8 8 8 C C U . n A 1 9 C 9 9 9 C C U . n A 1 10 G 10 10 10 G G U . n A 1 11 C 11 11 11 C C U . n A 1 12 C 12 12 12 C C U . n A 1 13 G 13 13 13 G G U . n A 1 14 A 14 14 14 A A U . n A 1 15 A 15 15 15 A A U . n A 1 16 A 16 16 16 A A U . n A 1 17 G 17 17 17 G G U . n A 1 18 G 18 18 18 G G U . n A 1 19 C 19 19 19 C C U . n A 1 20 G 20 20 20 G G U . n A 1 21 G 21 21 21 G G U . n A 1 22 U 22 22 22 U U U . n A 1 23 G 23 23 23 G G U . n A 1 24 A 24 24 24 A A U . n A 1 25 A 25 25 25 A A U . n A 1 26 G 26 26 26 G G U . n A 1 27 G 27 27 27 G G U . n A 1 28 A 28 28 28 A A U . n A 1 29 G 29 29 29 G G U . n A 1 30 A 30 30 30 A A U . n A 1 31 G 31 31 31 G G U . n A 1 32 G 32 32 32 G G U . n A 1 33 C 33 33 33 C C U . n A 1 34 G 34 34 34 G G U . n A 1 35 C 35 35 35 C C U . n A 1 36 A 36 36 36 A A U . n A 1 37 A 37 37 37 A A U . n A 1 38 G 38 38 38 G G U . n A 1 39 G 39 39 39 G G U . n A 1 40 U 40 40 40 U U U . n A 1 41 U 41 41 41 U U U . n A 1 42 A 42 42 42 A A U . n A 1 43 A 43 43 43 A A U . n A 1 44 C 44 44 44 C C U . n A 1 45 C 45 45 45 C C U . n A 1 46 G 46 46 46 G G U . n A 1 47 C 47 47 47 C C U . n A 1 48 C 48 48 48 C C U . n A 1 49 U 49 49 49 U U U . n A 1 50 C 50 50 50 C C U . n A 1 51 A 51 51 51 A A U . n A 1 52 G 52 52 52 G G U . n A 1 53 G 53 53 53 G G U . n A 1 54 U 54 54 54 U U U . n A 1 55 U 55 55 55 U U U . n A 1 56 C 56 56 56 C C U . n A 1 57 C 57 57 57 C C U . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id A1EZE _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id A1EZE _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 A1EZE 1 101 101 A1EZE LIG U . C 3 MG 1 102 1 MG MG U . D 3 MG 1 103 2 MG MG U . E 3 MG 1 104 3 MG MG U . F 4 HOH 1 201 25 HOH HOH U . F 4 HOH 2 202 18 HOH HOH U . F 4 HOH 3 203 17 HOH HOH U . F 4 HOH 4 204 10 HOH HOH U . F 4 HOH 5 205 24 HOH HOH U . F 4 HOH 6 206 23 HOH HOH U . F 4 HOH 7 207 11 HOH HOH U . F 4 HOH 8 208 16 HOH HOH U . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9X99 _cell.details ? _cell.formula_units_Z ? _cell.length_a 83.319 _cell.length_a_esd ? _cell.length_b 83.319 _cell.length_b_esd ? _cell.length_c 95.071 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9X99 _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9X99 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.56 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 52.03 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Magnesium acetate tetrahydrate, Sodium cacodylate trihydrate pH 6.5, MPD' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-03-29 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97946 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL18U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97946 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL18U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9X99 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.80 _reflns.d_resolution_low 50.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5195 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 100.0 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 34.5 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 3.1 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 0.566 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.142 _reflns.pdbx_Rpim_I_all 0.024 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.140 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.80 2.85 ? ? ? ? ? ? 242 ? ? ? ? ? ? ? ? ? ? ? ? 0.434 ? ? ? ? ? 1 1 0.501 0.817 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.85 2.90 ? ? ? ? ? ? 249 ? ? ? ? ? ? ? ? ? ? ? ? 0.443 ? ? ? 0.629 ? 2 1 0.725 0.917 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.90 2.96 ? ? ? ? ? ? 253 ? ? ? ? ? ? ? ? ? ? ? ? 0.432 ? ? ? 0.344 ? 3 1 0.940 0.984 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.96 3.02 ? ? ? ? ? ? 247 ? ? ? ? ? ? ? ? ? ? ? ? 0.456 ? ? ? 0.291 ? 4 1 0.971 0.993 ? 100.0 ? 1.732 ? ? ? ? ? ? ? ? ? 3.02 3.08 ? ? ? ? ? ? 260 ? ? ? ? ? ? ? ? ? ? ? ? 0.454 ? ? ? 0.216 ? 5 1 0.970 0.992 ? 100.0 ? 1.310 ? ? ? ? ? ? ? ? ? 3.08 3.15 ? ? ? ? ? ? 247 ? ? ? ? ? ? ? ? ? ? ? ? 0.474 ? ? 0.927 0.150 ? 6 1 0.993 0.998 ? 100.0 ? 0.914 ? ? ? ? ? ? ? ? ? 3.15 3.23 ? ? ? ? ? ? 253 ? ? ? ? ? ? ? ? ? ? ? ? 0.471 ? ? 0.654 0.107 ? 7 1 0.999 1.000 ? 100.0 ? 0.645 ? ? ? ? ? ? ? ? ? 3.23 3.32 ? ? ? ? ? ? 251 ? ? ? ? ? ? ? ? ? ? ? ? 0.496 ? ? 0.512 0.084 ? 8 1 0.994 0.998 ? 100.0 ? 0.505 ? ? ? ? ? ? ? ? ? 3.32 3.42 ? ? ? ? ? ? 256 ? ? ? ? ? ? ? ? ? ? ? ? 0.507 ? ? 0.428 0.072 ? 9 1 0.996 0.999 ? 100.0 ? 0.422 ? ? ? ? ? ? ? ? ? 3.42 3.53 ? ? ? ? ? ? 251 ? ? ? ? ? ? ? ? ? ? ? ? 0.511 ? ? 0.411 0.071 ? 10 1 0.996 0.999 ? 100.0 ? 0.405 ? ? ? ? ? ? ? ? ? 3.53 3.65 ? ? ? ? ? ? 250 ? ? ? ? ? ? ? ? ? ? ? ? 0.522 ? ? 0.326 0.053 ? 11 1 0.997 0.999 ? 100.0 ? 0.322 ? ? ? ? ? ? ? ? ? 3.65 3.80 ? ? ? ? ? ? 261 ? ? ? ? ? ? ? ? ? ? ? ? 0.544 ? ? 0.253 0.041 ? 12 1 0.998 1.000 ? 100.0 ? 0.249 ? ? ? ? ? ? ? ? ? 3.80 3.97 ? ? ? ? ? ? 257 ? ? ? ? ? ? ? ? ? ? ? ? 0.576 ? ? 0.221 0.037 ? 13 1 0.999 1.000 ? 100.0 ? 0.218 ? ? ? ? ? ? ? ? ? 3.97 4.18 ? ? ? ? ? ? 261 ? ? ? ? ? ? ? ? ? ? ? ? 0.601 ? ? 0.180 0.030 ? 14 1 0.998 1.000 ? 100.0 ? 0.177 ? ? ? ? ? ? ? ? ? 4.18 4.44 ? ? ? ? ? ? 255 ? ? ? ? ? ? ? ? ? ? ? ? 0.628 ? ? 0.155 0.025 ? 15 1 0.999 1.000 ? 100.0 ? 0.153 ? ? ? ? ? ? ? ? ? 4.44 4.79 ? ? ? ? ? ? 265 ? ? ? ? ? ? ? ? ? ? ? ? 0.732 ? ? 0.125 0.020 ? 16 1 0.999 1.000 ? 100.0 ? 0.123 ? ? ? ? ? ? ? ? ? 4.79 5.27 ? ? ? ? ? ? 268 ? ? ? ? ? ? ? ? ? ? ? ? 0.745 ? ? 0.106 0.018 ? 17 1 0.999 1.000 ? 100.0 ? 0.105 ? ? ? ? ? ? ? ? ? 5.27 6.03 ? ? ? ? ? ? 272 ? ? ? ? ? ? ? ? ? ? ? ? 0.793 ? ? 0.082 0.014 ? 18 1 0.999 1.000 ? 100.0 ? 0.081 ? ? ? ? ? ? ? ? ? 6.03 7.59 ? ? ? ? ? ? 277 ? ? ? ? ? ? ? ? ? ? ? ? 0.719 ? ? 0.062 0.011 ? 19 1 0.999 1.000 ? 100.0 ? 0.061 ? ? ? ? ? ? ? ? ? 7.59 50 ? ? ? ? ? ? 320 ? ? ? ? ? ? ? ? ? ? ? ? 0.736 ? ? 0.050 ? ? 20 1 0.998 1.000 ? 100.0 ? 0.048 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9X99 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.80 _refine.ls_d_res_low 25.22 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5126 _refine.ls_number_reflns_R_free 508 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.34 _refine.ls_percent_reflns_R_free 9.91 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2005 _refine.ls_R_factor_R_free 0.2420 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.1961 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.55 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.51 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1233 _refine_hist.pdbx_number_atoms_ligand 56 _refine_hist.number_atoms_solvent 8 _refine_hist.number_atoms_total 1297 _refine_hist.d_res_high 2.80 _refine_hist.d_res_low 25.22 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 ? 1436 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.393 ? 2230 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 16.020 ? 726 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.055 ? 284 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.020 ? 87 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.80 3.08 . . 118 1104 98.00 . . . . 0.3353 . . . . . . . . . . . . . . . 0.4476 'X-RAY DIFFRACTION' 3.08 3.53 . . 124 1129 100.00 . . . . 0.2164 . . . . . . . . . . . . . . . 0.2990 'X-RAY DIFFRACTION' 3.53 4.44 . . 128 1143 100.00 . . . . 0.1998 . . . . . . . . . . . . . . . 0.2477 'X-RAY DIFFRACTION' 4.44 25.22 . . 138 1242 100.00 . . . . 0.1753 . . . . . . . . . . . . . . . 0.2073 # _struct.entry_id 9X99 _struct.title 'Crystal structure of RhoBAST in complex with TMR-DN' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9X99 _struct_keywords.text 'Aptamer, RhoBAST, TMR-DN, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9X99 _struct_ref.pdbx_db_accession 9X99 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9X99 _struct_ref_seq.pdbx_strand_id U _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9X99 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 430 ? 1 MORE -9 ? 1 'SSA (A^2)' 10090 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GDP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? U GDP 1 U G 2 1_555 ? ? ? ? ? ? ? 1.560 ? ? metalc1 metalc ? ? A GDP 1 O1B ? ? ? 1_555 E MG . MG ? ? U GDP 1 U MG 104 1_555 ? ? ? ? ? ? ? 2.315 ? ? metalc2 metalc ? ? C MG . MG ? ? ? 1_555 F HOH . O ? ? U MG 102 U HOH 208 1_555 ? ? ? ? ? ? ? 2.546 ? ? metalc3 metalc ? ? E MG . MG ? ? ? 1_555 F HOH . O ? ? U MG 104 U HOH 204 1_555 ? ? ? ? ? ? ? 2.165 ? ? hydrog1 hydrog ? ? A GDP 1 N1 ? ? ? 1_555 A C 57 N3 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GDP 1 N2 ? ? ? 1_555 A C 57 O2 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GDP 1 O6 ? ? ? 1_555 A C 57 N4 ? ? U GDP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 55 N3 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 55 O4 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 54 N3 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 54 O4 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 53 N1 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 53 O6 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 53 N2 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 52 N1 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 52 O6 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 52 N2 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 51 N1 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 51 N6 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 20 N1 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 20 O6 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 20 N2 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 18 N1 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 18 O6 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 18 N2 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? U G 13 U A 16 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 24 N1 ? ? ? 1_555 A A 42 N6 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog41 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 42 N7 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 43 N7 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog43 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 43 N6 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog44 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 35 N3 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 35 O2 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 35 N4 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 50 N3 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 29 N2 ? ? ? 1_555 A C 50 O2 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 29 O6 ? ? ? 1_555 A C 50 N4 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 49 N3 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 49 O4 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 48 N3 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 48 O2 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 48 N4 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 47 N3 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 47 O2 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 46 N1 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 46 O6 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 46 N2 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 39 N3 ? ? ? 1_555 A U 41 N3 ? ? U G 39 U U 41 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id O1B _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id GDP _pdbx_struct_conn_angle.ptnr1_label_seq_id 1 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id U _pdbx_struct_conn_angle.ptnr1_auth_comp_id GDP _pdbx_struct_conn_angle.ptnr1_auth_seq_id 1 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id E _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id U _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 104 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 1_555 _pdbx_struct_conn_angle.ptnr3_label_atom_id O _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id F _pdbx_struct_conn_angle.ptnr3_label_comp_id HOH _pdbx_struct_conn_angle.ptnr3_label_seq_id . _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id U _pdbx_struct_conn_angle.ptnr3_auth_comp_id HOH _pdbx_struct_conn_angle.ptnr3_auth_seq_id 204 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 80.4 _pdbx_struct_conn_angle.value_esd ? # _pdbx_entry_details.entry_id 9X99 _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP2 U U 22 ? ? O U HOH 201 ? ? 2.05 2 1 OP1 U G 27 ? ? O U HOH 202 ? ? 2.10 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 "O2'" _pdbx_validate_symm_contact.auth_asym_id_1 U _pdbx_validate_symm_contact.auth_comp_id_1 G _pdbx_validate_symm_contact.auth_seq_id_1 20 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 "O2'" _pdbx_validate_symm_contact.auth_asym_id_2 U _pdbx_validate_symm_contact.auth_comp_id_2 G _pdbx_validate_symm_contact.auth_seq_id_2 20 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 10_665 _pdbx_validate_symm_contact.dist 2.09 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" U GDP 1 ? ? "O3'" U GDP 1 ? ? P U G 2 ? ? 109.75 119.70 -9.95 1.20 Y 2 1 "O3'" U GDP 1 ? ? P U G 2 ? ? "O5'" U G 2 ? ? 92.45 104.00 -11.55 1.90 Y 3 1 "O3'" U GDP 1 ? ? P U G 2 ? ? OP1 U G 2 ? ? 117.69 110.50 7.19 1.10 Y 4 1 "O4'" U A 28 ? ? "C1'" U A 28 ? ? N9 U A 28 ? ? 113.29 108.50 4.79 0.70 N # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -4.2623 _pdbx_refine_tls.origin_y 30.8220 _pdbx_refine_tls.origin_z 0.2446 _pdbx_refine_tls.T[1][1] 0.8880 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0885 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] 0.0272 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 1.1708 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0038 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.8407 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 2.9524 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.3300 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.2375 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 1.5438 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.4198 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.2417 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.0170 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.3975 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.0962 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.2130 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.2272 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0661 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.2338 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.2371 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.2413 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 A1EZE C4 C N N 38 A1EZE C5 C N N 39 A1EZE C6 C N N 40 A1EZE C7 C N N 41 A1EZE C8 C N N 42 A1EZE C10 C Y N 43 A1EZE C13 C Y N 44 A1EZE C17 C N N 45 A1EZE C20 C N N 46 A1EZE C22 C N N 47 A1EZE C26 C Y N 48 A1EZE C28 C Y N 49 A1EZE C1 C N N 50 A1EZE C11 C Y N 51 A1EZE C12 C Y N 52 A1EZE C14 C N N 53 A1EZE C16 C N N 54 A1EZE C19 C N N 55 A1EZE C23 C N N 56 A1EZE C25 C Y N 57 A1EZE C27 C Y N 58 A1EZE C3 C N N 59 A1EZE C32 C Y N 60 A1EZE C33 C Y N 61 A1EZE C38 C Y N 62 A1EZE C39 C Y N 63 A1EZE C40 C N N 64 A1EZE C43 C Y N 65 A1EZE C44 C Y N 66 A1EZE C45 C Y N 67 A1EZE C46 C Y N 68 A1EZE C47 C Y N 69 A1EZE C48 C Y N 70 A1EZE C51 C N N 71 A1EZE C52 C N N 72 A1EZE C53 C N N 73 A1EZE C9 C N N 74 A1EZE N15 N N N 75 A1EZE N2 N N N 76 A1EZE N24 N N N 77 A1EZE N29 N N N 78 A1EZE N34 N N N 79 A1EZE N50 N N N 80 A1EZE O18 O N N 81 A1EZE O21 O N N 82 A1EZE O30 O N N 83 A1EZE O31 O N N 84 A1EZE O35 O N N 85 A1EZE O36 O N N 86 A1EZE O37 O N N 87 A1EZE O41 O N N 88 A1EZE O42 O N N 89 A1EZE O49 O N N 90 A1EZE H1 H N N 91 A1EZE H2 H N N 92 A1EZE H3 H N N 93 A1EZE H4 H N N 94 A1EZE H5 H N N 95 A1EZE H6 H N N 96 A1EZE H7 H N N 97 A1EZE H8 H N N 98 A1EZE H9 H N N 99 A1EZE H10 H N N 100 A1EZE H11 H N N 101 A1EZE H12 H N N 102 A1EZE H13 H N N 103 A1EZE H14 H N N 104 A1EZE H15 H N N 105 A1EZE H16 H N N 106 A1EZE H17 H N N 107 A1EZE H18 H N N 108 A1EZE H19 H N N 109 A1EZE H20 H N N 110 A1EZE H21 H N N 111 A1EZE H22 H N N 112 A1EZE H23 H N N 113 A1EZE H24 H N N 114 A1EZE H25 H N N 115 A1EZE H26 H N N 116 A1EZE H27 H N N 117 A1EZE H28 H N N 118 A1EZE H29 H N N 119 A1EZE H30 H N N 120 A1EZE H31 H N N 121 A1EZE H32 H N N 122 A1EZE H33 H N N 123 A1EZE H34 H N N 124 A1EZE H35 H N N 125 A1EZE H36 H N N 126 A1EZE H37 H N N 127 A1EZE H38 H N N 128 A1EZE H39 H N N 129 C OP3 O N N 130 C P P N N 131 C OP1 O N N 132 C OP2 O N N 133 C "O5'" O N N 134 C "C5'" C N N 135 C "C4'" C N R 136 C "O4'" O N N 137 C "C3'" C N S 138 C "O3'" O N N 139 C "C2'" C N R 140 C "O2'" O N N 141 C "C1'" C N R 142 C N1 N N N 143 C C2 C N N 144 C O2 O N N 145 C N3 N N N 146 C C4 C N N 147 C N4 N N N 148 C C5 C N N 149 C C6 C N N 150 C HOP3 H N N 151 C HOP2 H N N 152 C "H5'" H N N 153 C "H5''" H N N 154 C "H4'" H N N 155 C "H3'" H N N 156 C "HO3'" H N N 157 C "H2'" H N N 158 C "HO2'" H N N 159 C "H1'" H N N 160 C H41 H N N 161 C H42 H N N 162 C H5 H N N 163 C H6 H N N 164 G OP3 O N N 165 G P P N N 166 G OP1 O N N 167 G OP2 O N N 168 G "O5'" O N N 169 G "C5'" C N N 170 G "C4'" C N R 171 G "O4'" O N N 172 G "C3'" C N S 173 G "O3'" O N N 174 G "C2'" C N R 175 G "O2'" O N N 176 G "C1'" C N R 177 G N9 N Y N 178 G C8 C Y N 179 G N7 N Y N 180 G C5 C Y N 181 G C6 C N N 182 G O6 O N N 183 G N1 N N N 184 G C2 C N N 185 G N2 N N N 186 G N3 N N N 187 G C4 C Y N 188 G HOP3 H N N 189 G HOP2 H N N 190 G "H5'" H N N 191 G "H5''" H N N 192 G "H4'" H N N 193 G "H3'" H N N 194 G "HO3'" H N N 195 G "H2'" H N N 196 G "HO2'" H N N 197 G "H1'" H N N 198 G H8 H N N 199 G H1 H N N 200 G H21 H N N 201 G H22 H N N 202 GDP PB P N N 203 GDP O1B O N N 204 GDP O2B O N N 205 GDP O3B O N N 206 GDP O3A O N N 207 GDP PA P N N 208 GDP O1A O N N 209 GDP O2A O N N 210 GDP "O5'" O N N 211 GDP "C5'" C N N 212 GDP "C4'" C N R 213 GDP "O4'" O N N 214 GDP "C3'" C N S 215 GDP "O3'" O N N 216 GDP "C2'" C N R 217 GDP "O2'" O N N 218 GDP "C1'" C N R 219 GDP N9 N Y N 220 GDP C8 C Y N 221 GDP N7 N Y N 222 GDP C5 C Y N 223 GDP C6 C N N 224 GDP O6 O N N 225 GDP N1 N N N 226 GDP C2 C N N 227 GDP N2 N N N 228 GDP N3 N N N 229 GDP C4 C Y N 230 GDP HOB2 H N N 231 GDP HOB3 H N N 232 GDP HOA2 H N N 233 GDP "H5'" H N N 234 GDP "H5''" H N N 235 GDP "H4'" H N N 236 GDP "H3'" H N N 237 GDP "HO3'" H N N 238 GDP "H2'" H N N 239 GDP "HO2'" H N N 240 GDP "H1'" H N N 241 GDP H8 H N N 242 GDP HN1 H N N 243 GDP HN21 H N N 244 GDP HN22 H N N 245 HOH O O N N 246 HOH H1 H N N 247 HOH H2 H N N 248 MG MG MG N N 249 U OP3 O N N 250 U P P N N 251 U OP1 O N N 252 U OP2 O N N 253 U "O5'" O N N 254 U "C5'" C N N 255 U "C4'" C N R 256 U "O4'" O N N 257 U "C3'" C N S 258 U "O3'" O N N 259 U "C2'" C N R 260 U "O2'" O N N 261 U "C1'" C N R 262 U N1 N N N 263 U C2 C N N 264 U O2 O N N 265 U N3 N N N 266 U C4 C N N 267 U O4 O N N 268 U C5 C N N 269 U C6 C N N 270 U HOP3 H N N 271 U HOP2 H N N 272 U "H5'" H N N 273 U "H5''" H N N 274 U "H4'" H N N 275 U "H3'" H N N 276 U "HO3'" H N N 277 U "H2'" H N N 278 U "HO2'" H N N 279 U "H1'" H N N 280 U H3 H N N 281 U H5 H N N 282 U H6 H N N 283 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 A1EZE C17 C16 sing N N 40 A1EZE C17 O18 sing N N 41 A1EZE C16 N15 sing N N 42 A1EZE O37 C14 doub N N 43 A1EZE O18 C19 sing N N 44 A1EZE C14 N15 sing N N 45 A1EZE C14 C13 sing N N 46 A1EZE C12 C13 doub Y N 47 A1EZE C12 C11 sing Y N 48 A1EZE C13 C38 sing Y N 49 A1EZE C19 C20 sing N N 50 A1EZE C20 O21 sing N N 51 A1EZE O21 C22 sing N N 52 A1EZE C11 C10 doub Y N 53 A1EZE O30 N29 doub N N 54 A1EZE C38 C39 doub Y N 55 A1EZE C27 C26 doub Y N 56 A1EZE C27 C28 sing Y N 57 A1EZE C23 C22 sing N N 58 A1EZE C23 N24 sing N N 59 A1EZE C26 C25 sing Y N 60 A1EZE C8 C7 doub N N 61 A1EZE C8 C3 sing N N 62 A1EZE C53 N2 sing N N 63 A1EZE C7 C6 sing N N 64 A1EZE C10 C39 sing Y N 65 A1EZE C10 C9 sing N N 66 A1EZE N29 C28 sing N N 67 A1EZE N29 O31 doub N N 68 A1EZE C39 C40 sing N N 69 A1EZE C28 C32 doub Y N 70 A1EZE N2 C3 doub N N 71 A1EZE N2 C1 sing N N 72 A1EZE C3 C4 sing N N 73 A1EZE C6 C9 doub N N 74 A1EZE C6 C5 sing N N 75 A1EZE C25 N24 sing N N 76 A1EZE C25 C33 doub Y N 77 A1EZE C9 C43 sing N N 78 A1EZE O41 C40 doub N N 79 A1EZE C4 C5 doub N N 80 A1EZE C5 O49 sing N N 81 A1EZE C40 O42 sing N N 82 A1EZE C32 C33 sing Y N 83 A1EZE C43 C44 doub Y N 84 A1EZE C43 C48 sing Y N 85 A1EZE C33 N34 sing N N 86 A1EZE C44 C45 sing Y N 87 A1EZE O49 C48 sing N N 88 A1EZE C48 C47 doub Y N 89 A1EZE N34 O36 doub N N 90 A1EZE N34 O35 doub N N 91 A1EZE C45 C46 doub Y N 92 A1EZE C47 C46 sing Y N 93 A1EZE C46 N50 sing N N 94 A1EZE N50 C51 sing N N 95 A1EZE N50 C52 sing N N 96 A1EZE C4 H1 sing N N 97 A1EZE C7 H2 sing N N 98 A1EZE C8 H3 sing N N 99 A1EZE C17 H4 sing N N 100 A1EZE C17 H5 sing N N 101 A1EZE C20 H6 sing N N 102 A1EZE C20 H7 sing N N 103 A1EZE C22 H8 sing N N 104 A1EZE C22 H9 sing N N 105 A1EZE C26 H10 sing N N 106 A1EZE C1 H11 sing N N 107 A1EZE C1 H12 sing N N 108 A1EZE C1 H13 sing N N 109 A1EZE C11 H14 sing N N 110 A1EZE C12 H15 sing N N 111 A1EZE C16 H16 sing N N 112 A1EZE C16 H17 sing N N 113 A1EZE C19 H18 sing N N 114 A1EZE C19 H19 sing N N 115 A1EZE C23 H20 sing N N 116 A1EZE C23 H21 sing N N 117 A1EZE C27 H22 sing N N 118 A1EZE C32 H23 sing N N 119 A1EZE C38 H24 sing N N 120 A1EZE C44 H25 sing N N 121 A1EZE C45 H26 sing N N 122 A1EZE C47 H27 sing N N 123 A1EZE C51 H28 sing N N 124 A1EZE C51 H29 sing N N 125 A1EZE C51 H30 sing N N 126 A1EZE C52 H31 sing N N 127 A1EZE C52 H32 sing N N 128 A1EZE C52 H33 sing N N 129 A1EZE C53 H34 sing N N 130 A1EZE C53 H35 sing N N 131 A1EZE C53 H36 sing N N 132 A1EZE N15 H37 sing N N 133 A1EZE N24 H38 sing N N 134 A1EZE O42 H39 sing N N 135 C OP3 P sing N N 136 C OP3 HOP3 sing N N 137 C P OP1 doub N N 138 C P OP2 sing N N 139 C P "O5'" sing N N 140 C OP2 HOP2 sing N N 141 C "O5'" "C5'" sing N N 142 C "C5'" "C4'" sing N N 143 C "C5'" "H5'" sing N N 144 C "C5'" "H5''" sing N N 145 C "C4'" "O4'" sing N N 146 C "C4'" "C3'" sing N N 147 C "C4'" "H4'" sing N N 148 C "O4'" "C1'" sing N N 149 C "C3'" "O3'" sing N N 150 C "C3'" "C2'" sing N N 151 C "C3'" "H3'" sing N N 152 C "O3'" "HO3'" sing N N 153 C "C2'" "O2'" sing N N 154 C "C2'" "C1'" sing N N 155 C "C2'" "H2'" sing N N 156 C "O2'" "HO2'" sing N N 157 C "C1'" N1 sing N N 158 C "C1'" "H1'" sing N N 159 C N1 C2 sing N N 160 C N1 C6 sing N N 161 C C2 O2 doub N N 162 C C2 N3 sing N N 163 C N3 C4 doub N N 164 C C4 N4 sing N N 165 C C4 C5 sing N N 166 C N4 H41 sing N N 167 C N4 H42 sing N N 168 C C5 C6 doub N N 169 C C5 H5 sing N N 170 C C6 H6 sing N N 171 G OP3 P sing N N 172 G OP3 HOP3 sing N N 173 G P OP1 doub N N 174 G P OP2 sing N N 175 G P "O5'" sing N N 176 G OP2 HOP2 sing N N 177 G "O5'" "C5'" sing N N 178 G "C5'" "C4'" sing N N 179 G "C5'" "H5'" sing N N 180 G "C5'" "H5''" sing N N 181 G "C4'" "O4'" sing N N 182 G "C4'" "C3'" sing N N 183 G "C4'" "H4'" sing N N 184 G "O4'" "C1'" sing N N 185 G "C3'" "O3'" sing N N 186 G "C3'" "C2'" sing N N 187 G "C3'" "H3'" sing N N 188 G "O3'" "HO3'" sing N N 189 G "C2'" "O2'" sing N N 190 G "C2'" "C1'" sing N N 191 G "C2'" "H2'" sing N N 192 G "O2'" "HO2'" sing N N 193 G "C1'" N9 sing N N 194 G "C1'" "H1'" sing N N 195 G N9 C8 sing Y N 196 G N9 C4 sing Y N 197 G C8 N7 doub Y N 198 G C8 H8 sing N N 199 G N7 C5 sing Y N 200 G C5 C6 sing N N 201 G C5 C4 doub Y N 202 G C6 O6 doub N N 203 G C6 N1 sing N N 204 G N1 C2 sing N N 205 G N1 H1 sing N N 206 G C2 N2 sing N N 207 G C2 N3 doub N N 208 G N2 H21 sing N N 209 G N2 H22 sing N N 210 G N3 C4 sing N N 211 GDP PB O1B doub N N 212 GDP PB O2B sing N N 213 GDP PB O3B sing N N 214 GDP PB O3A sing N N 215 GDP O2B HOB2 sing N N 216 GDP O3B HOB3 sing N N 217 GDP O3A PA sing N N 218 GDP PA O1A doub N N 219 GDP PA O2A sing N N 220 GDP PA "O5'" sing N N 221 GDP O2A HOA2 sing N N 222 GDP "O5'" "C5'" sing N N 223 GDP "C5'" "C4'" sing N N 224 GDP "C5'" "H5'" sing N N 225 GDP "C5'" "H5''" sing N N 226 GDP "C4'" "O4'" sing N N 227 GDP "C4'" "C3'" sing N N 228 GDP "C4'" "H4'" sing N N 229 GDP "O4'" "C1'" sing N N 230 GDP "C3'" "O3'" sing N N 231 GDP "C3'" "C2'" sing N N 232 GDP "C3'" "H3'" sing N N 233 GDP "O3'" "HO3'" sing N N 234 GDP "C2'" "O2'" sing N N 235 GDP "C2'" "C1'" sing N N 236 GDP "C2'" "H2'" sing N N 237 GDP "O2'" "HO2'" sing N N 238 GDP "C1'" N9 sing N N 239 GDP "C1'" "H1'" sing N N 240 GDP N9 C8 sing Y N 241 GDP N9 C4 sing Y N 242 GDP C8 N7 doub Y N 243 GDP C8 H8 sing N N 244 GDP N7 C5 sing Y N 245 GDP C5 C6 sing N N 246 GDP C5 C4 doub Y N 247 GDP C6 O6 doub N N 248 GDP C6 N1 sing N N 249 GDP N1 C2 sing N N 250 GDP N1 HN1 sing N N 251 GDP C2 N2 sing N N 252 GDP C2 N3 doub N N 253 GDP N2 HN21 sing N N 254 GDP N2 HN22 sing N N 255 GDP N3 C4 sing N N 256 HOH O H1 sing N N 257 HOH O H2 sing N N 258 U OP3 P sing N N 259 U OP3 HOP3 sing N N 260 U P OP1 doub N N 261 U P OP2 sing N N 262 U P "O5'" sing N N 263 U OP2 HOP2 sing N N 264 U "O5'" "C5'" sing N N 265 U "C5'" "C4'" sing N N 266 U "C5'" "H5'" sing N N 267 U "C5'" "H5''" sing N N 268 U "C4'" "O4'" sing N N 269 U "C4'" "C3'" sing N N 270 U "C4'" "H4'" sing N N 271 U "O4'" "C1'" sing N N 272 U "C3'" "O3'" sing N N 273 U "C3'" "C2'" sing N N 274 U "C3'" "H3'" sing N N 275 U "O3'" "HO3'" sing N N 276 U "C2'" "O2'" sing N N 277 U "C2'" "C1'" sing N N 278 U "C2'" "H2'" sing N N 279 U "O2'" "HO2'" sing N N 280 U "C1'" N1 sing N N 281 U "C1'" "H1'" sing N N 282 U N1 C2 sing N N 283 U N1 C6 sing N N 284 U C2 O2 doub N N 285 U C2 N3 sing N N 286 U N3 C4 sing N N 287 U N3 H3 sing N N 288 U C4 O4 doub N N 289 U C4 C5 sing N N 290 U C5 C6 doub N N 291 U C5 H5 sing N N 292 U C6 H6 sing N N 293 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9X99 'double helix' 9X99 'a-form double helix' 9X99 'hairpin loop' 9X99 tetraloop 9X99 'bulge loop' 9X99 'mismatched base pair' 9X99 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GDP 1 1_555 A C 57 1_555 -0.165 0.287 -0.004 -6.712 -10.664 5.391 1 U_GDP1:C57_U U 1 ? U 57 ? 19 1 1 A G 2 1_555 A C 56 1_555 -0.802 0.022 0.369 -0.412 -16.961 4.303 2 U_G2:C56_U U 2 ? U 56 ? 19 1 1 A A 3 1_555 A U 55 1_555 0.178 -0.149 0.285 -0.680 -8.852 -4.975 3 U_A3:U55_U U 3 ? U 55 ? 20 1 1 A A 4 1_555 A U 54 1_555 0.179 -0.034 0.328 6.372 -9.187 3.566 4 U_A4:U54_U U 4 ? U 54 ? 20 1 1 A C 5 1_555 A G 53 1_555 0.901 0.023 0.058 -0.342 -12.748 6.936 5 U_C5:G53_U U 5 ? U 53 ? 19 1 1 A C 6 1_555 A G 52 1_555 -0.484 0.027 0.626 -7.564 -16.860 1.887 6 U_C6:G52_U U 6 ? U 52 ? 19 1 1 A U 7 1_555 A A 51 1_555 -0.125 -0.098 0.523 -4.511 -10.472 -3.727 7 U_U7:A51_U U 7 ? U 51 ? 20 1 1 A G 29 1_555 A C 50 1_555 -0.265 0.102 -0.043 -1.543 -3.285 3.672 8 U_G29:C50_U U 29 ? U 50 ? 19 1 1 A A 30 1_555 A U 49 1_555 -0.337 -0.006 -0.237 -15.821 -10.605 3.408 9 U_A30:U49_U U 30 ? U 49 ? 20 1 1 A G 31 1_555 A C 48 1_555 0.160 0.012 0.224 -7.563 -3.700 -0.173 10 U_G31:C48_U U 31 ? U 48 ? 19 1 1 A G 32 1_555 A C 47 1_555 0.301 -0.200 -0.134 -1.966 -9.241 -2.590 11 U_G32:C47_U U 32 ? U 47 ? 19 1 1 A C 33 1_555 A G 46 1_555 0.481 -0.455 0.171 -4.707 -10.057 -2.670 12 U_C33:G46_U U 33 ? U 46 ? 19 1 1 A G 34 1_555 A C 45 1_555 0.604 0.185 0.119 -5.764 -12.016 4.605 13 U_G34:C45_U U 34 ? U 45 ? 19 1 1 A C 35 1_555 A G 27 1_555 0.086 0.105 0.046 -10.004 4.753 -2.206 14 U_C35:G27_U U 35 ? U 27 ? 19 1 1 A A 16 1_555 A G 13 1_555 -7.096 -4.865 1.462 -12.637 -7.586 -17.078 15 U_A16:G13_U U 16 ? U 13 ? ? ? 1 A G 17 1_555 A C 12 1_555 0.478 0.017 0.049 -1.483 -0.061 2.585 16 U_G17:C12_U U 17 ? U 12 ? 19 1 1 A G 18 1_555 A C 11 1_555 -0.050 -0.140 0.342 0.099 -6.609 4.738 17 U_G18:C11_U U 18 ? U 11 ? 19 1 1 A C 19 1_555 A G 10 1_555 1.156 -0.131 0.204 0.095 -6.814 -3.220 18 U_C19:G10_U U 19 ? U 10 ? 19 1 1 A G 20 1_555 A C 9 1_555 0.552 -0.469 0.474 -2.737 -10.356 0.006 19 U_G20:C9_U U 20 ? U 9 ? 19 1 1 A G 21 1_555 A C 8 1_555 -0.460 -0.237 0.546 -5.002 -14.418 2.241 20 U_G21:C8_U U 21 ? U 8 ? 19 1 1 A U 22 1_555 A A 28 1_555 0.464 -0.165 0.510 -8.443 -9.216 0.644 21 U_U22:A28_U U 22 ? U 28 ? 20 1 1 A G 23 1_555 A C 44 1_555 0.046 -0.366 -0.472 -12.514 12.226 -1.652 22 U_G23:C44_U U 23 ? U 44 ? 19 1 1 A G 26 1_555 A A 43 1_555 7.016 -4.307 0.027 -20.065 -30.220 1.821 23 U_G26:A43_U U 26 ? U 43 ? 11 10 1 A A 24 1_555 A A 42 1_555 4.565 1.021 0.052 0.814 -2.839 -110.596 24 U_A24:A42_U U 24 ? U 42 ? 5 4 1 A G 39 1_555 A U 41 1_555 2.584 1.851 -1.955 7.705 58.878 112.448 25 U_G39:U41_U U 39 ? U 41 ? ? 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GDP 1 1_555 A C 57 1_555 A G 2 1_555 A C 56 1_555 0.042 -1.234 2.873 -6.763 15.149 32.877 -3.620 -0.808 2.079 24.891 11.111 36.722 1 UU_GDP1G2:C56C57_UU U 1 ? U 57 ? U 2 ? U 56 ? 1 A G 2 1_555 A C 56 1_555 A A 3 1_555 A U 55 1_555 -0.074 -1.514 3.090 -0.576 5.730 35.159 -3.233 0.045 2.817 9.407 0.945 35.613 2 UU_G2A3:U55C56_UU U 2 ? U 56 ? U 3 ? U 55 ? 1 A A 3 1_555 A U 55 1_555 A A 4 1_555 A U 54 1_555 0.130 -1.293 2.981 1.917 6.144 33.998 -3.008 0.042 2.716 10.392 -3.242 34.584 3 UU_A3A4:U54U55_UU U 3 ? U 55 ? U 4 ? U 54 ? 1 A A 4 1_555 A U 54 1_555 A C 5 1_555 A G 53 1_555 0.809 -1.296 3.308 5.731 6.829 37.086 -2.846 -0.517 3.116 10.550 -8.855 38.106 4 UU_A4C5:G53U54_UU U 4 ? U 54 ? U 5 ? U 53 ? 1 A C 5 1_555 A G 53 1_555 A C 6 1_555 A G 52 1_555 -0.169 -2.112 3.096 -1.120 11.455 26.622 -6.298 0.135 2.037 23.528 2.301 28.962 5 UU_C5C6:G52G53_UU U 5 ? U 53 ? U 6 ? U 52 ? 1 A C 6 1_555 A G 52 1_555 A U 7 1_555 A A 51 1_555 -0.050 -1.158 3.095 1.712 7.834 32.075 -3.238 0.350 2.738 13.907 -3.039 33.037 6 UU_C6U7:A51G52_UU U 6 ? U 52 ? U 7 ? U 51 ? 1 A U 7 1_555 A A 51 1_555 A G 29 1_555 A C 50 1_555 -0.913 -2.172 2.829 3.950 15.793 42.169 -3.888 1.455 1.853 21.034 -5.260 45.068 7 UU_U7G29:C50A51_UU U 7 ? U 51 ? U 29 ? U 50 ? 1 A G 29 1_555 A C 50 1_555 A A 30 1_555 A U 49 1_555 -0.229 -2.117 3.399 -1.054 12.699 35.370 -4.841 0.228 2.523 20.113 1.669 37.526 8 UU_G29A30:U49C50_UU U 29 ? U 50 ? U 30 ? U 49 ? 1 A A 30 1_555 A U 49 1_555 A G 31 1_555 A C 48 1_555 -0.753 -1.602 2.961 -3.085 3.558 32.908 -3.331 0.858 2.834 6.241 5.411 33.234 9 UU_A30G31:C48U49_UU U 30 ? U 49 ? U 31 ? U 48 ? 1 A G 31 1_555 A C 48 1_555 A G 32 1_555 A C 47 1_555 -0.056 -1.069 3.215 4.512 7.056 33.136 -2.882 0.773 2.901 12.133 -7.758 34.149 10 UU_G31G32:C47C48_UU U 31 ? U 48 ? U 32 ? U 47 ? 1 A G 32 1_555 A C 47 1_555 A C 33 1_555 A G 46 1_555 0.531 -1.147 3.203 -0.018 9.633 36.338 -2.960 -0.828 2.819 15.121 0.029 37.551 11 UU_G32C33:G46C47_UU U 32 ? U 47 ? U 33 ? U 46 ? 1 A C 33 1_555 A G 46 1_555 A G 34 1_555 A C 45 1_555 0.353 -2.136 3.102 3.043 8.139 30.308 -5.257 -0.155 2.482 15.179 -5.675 31.501 12 UU_C33G34:C45G46_UU U 33 ? U 46 ? U 34 ? U 45 ? 1 A G 34 1_555 A C 45 1_555 A C 35 1_555 A G 27 1_555 1.754 -1.361 3.314 3.036 -5.702 45.284 -1.227 -1.978 3.556 -7.362 -3.920 45.719 13 UU_G34C35:G27C45_UU U 34 ? U 45 ? U 35 ? U 27 ? 1 A A 16 1_555 A G 13 1_555 A G 17 1_555 A C 12 1_555 2.495 -1.105 2.885 4.355 7.220 52.756 -1.637 -2.532 2.904 8.067 -4.866 53.378 14 UU_A16G17:C12G13_UU U 16 ? U 13 ? U 17 ? U 12 ? 1 A G 17 1_555 A C 12 1_555 A G 18 1_555 A C 11 1_555 -0.352 -1.854 3.057 -2.513 5.832 30.090 -4.511 0.228 2.678 11.078 4.773 30.738 15 UU_G17G18:C11C12_UU U 17 ? U 12 ? U 18 ? U 11 ? 1 A G 18 1_555 A C 11 1_555 A C 19 1_555 A G 10 1_555 -0.782 -1.467 3.158 2.969 8.375 37.875 -3.133 1.503 2.718 12.690 -4.498 38.866 16 UU_G18C19:G10C11_UU U 18 ? U 11 ? U 19 ? U 10 ? 1 A C 19 1_555 A G 10 1_555 A G 20 1_555 A C 9 1_555 -0.072 -2.096 3.086 -3.804 5.672 24.620 -6.156 -0.784 2.529 12.985 8.710 25.535 17 UU_C19G20:C9G10_UU U 19 ? U 10 ? U 20 ? U 9 ? 1 A G 20 1_555 A C 9 1_555 A G 21 1_555 A C 8 1_555 0.387 -1.676 2.973 2.241 4.412 31.339 -3.779 -0.346 2.738 8.104 -4.116 31.718 18 UU_G20G21:C8C9_UU U 20 ? U 9 ? U 21 ? U 8 ? 1 A G 21 1_555 A C 8 1_555 A U 22 1_555 A A 28 1_555 -0.541 -1.084 3.287 1.823 1.170 35.808 -1.927 1.139 3.220 1.900 -2.962 35.871 19 UU_G21U22:A28C8_UU U 21 ? U 8 ? U 22 ? U 28 ? 1 A U 22 1_555 A A 28 1_555 A G 23 1_555 A C 44 1_555 1.973 0.658 3.318 16.397 -1.447 45.639 0.928 -0.985 3.756 -1.797 -20.374 48.367 20 UU_U22G23:C44A28_UU U 22 ? U 28 ? U 23 ? U 44 ? 1 A G 23 1_555 A C 44 1_555 A G 26 1_555 A A 43 1_555 0.042 0.104 4.077 11.343 27.335 65.522 -1.110 0.461 3.831 24.033 -9.973 71.211 21 UU_G23G26:A43C44_UU U 23 ? U 44 ? U 26 ? U 43 ? 1 A G 26 1_555 A A 43 1_555 A A 24 1_555 A A 42 1_555 -1.680 0.100 2.920 1.792 4.822 -12.464 -5.006 -5.455 2.887 -21.071 7.829 -13.480 22 UU_G26A24:A42A43_UU U 26 ? U 43 ? U 24 ? U 42 ? 1 A A 24 1_555 A A 42 1_555 A G 39 1_555 A U 41 1_555 1.635 0.063 6.743 22.618 -14.019 115.292 0.341 -0.467 6.868 -8.239 -13.293 117.230 23 UU_A24G39:U41A42_UU U 24 ? U 42 ? U 39 ? U 41 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code pdb_00009l8f _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9X99 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012002 _atom_sites.fract_transf_matrix[1][2] 0.006929 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013859 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010518 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #