data_9XAQ # _entry.id 9XAQ # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9XAQ pdb_00009xaq 10.2210/pdb9xaq/pdb WWPDB D_1300065008 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-28 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9XAQ _pdbx_database_status.recvd_initial_deposition_date 2025-10-22 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Ren _pdbx_contact_author.name_last Aiming _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Cryatal structure of apo-state RhoBAST-G38U' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (57-MER)' 18615.027 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 3 water nat water 18.015 1 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAUGUUAACCGCCUCAGGUUCC' _entity_poly.pdbx_seq_one_letter_code_can GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAUGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id U _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 C n 1 7 U n 1 8 C n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 G n 1 18 G n 1 19 C n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 G n 1 32 G n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 U n 1 39 G n 1 40 U n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 A n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 57 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP U . n A 1 2 G 2 2 2 G G U . n A 1 3 A 3 3 3 A A U . n A 1 4 A 4 4 4 A A U . n A 1 5 C 5 5 5 C C U . n A 1 6 C 6 6 6 C C U . n A 1 7 U 7 7 7 U U U . n A 1 8 C 8 8 8 C C U . n A 1 9 C 9 9 9 C C U . n A 1 10 G 10 10 10 G G U . n A 1 11 C 11 11 11 C C U . n A 1 12 C 12 12 12 C C U . n A 1 13 G 13 13 13 G G U . n A 1 14 A 14 14 14 A A U . n A 1 15 A 15 15 15 A A U . n A 1 16 A 16 16 16 A A U . n A 1 17 G 17 17 17 G G U . n A 1 18 G 18 18 18 G G U . n A 1 19 C 19 19 19 C C U . n A 1 20 G 20 20 20 G G U . n A 1 21 G 21 21 21 G G U . n A 1 22 U 22 22 22 U U U . n A 1 23 G 23 23 23 G G U . n A 1 24 A 24 24 24 A A U . n A 1 25 A 25 25 25 A A U . n A 1 26 G 26 26 26 G G U . n A 1 27 G 27 27 27 G G U . n A 1 28 A 28 28 28 A A U . n A 1 29 G 29 29 29 G G U . n A 1 30 A 30 30 30 A A U . n A 1 31 G 31 31 31 G G U . n A 1 32 G 32 32 32 G G U . n A 1 33 C 33 33 33 C C U . n A 1 34 G 34 34 34 G G U . n A 1 35 C 35 35 35 C C U . n A 1 36 A 36 36 36 A A U . n A 1 37 A 37 37 37 A A U . n A 1 38 U 38 38 38 U U U . n A 1 39 G 39 39 39 G G U . n A 1 40 U 40 40 40 U U U . n A 1 41 U 41 41 41 U U U . n A 1 42 A 42 42 42 A A U . n A 1 43 A 43 43 43 A A U . n A 1 44 C 44 44 44 C C U . n A 1 45 C 45 45 45 C C U . n A 1 46 G 46 46 46 G G U . n A 1 47 C 47 47 47 C C U . n A 1 48 C 48 48 48 C C U . n A 1 49 U 49 49 49 U U U . n A 1 50 C 50 50 50 C C U . n A 1 51 A 51 51 51 A A U . n A 1 52 G 52 52 52 G G U . n A 1 53 G 53 53 53 G G U . n A 1 54 U 54 54 54 U U U . n A 1 55 U 55 55 55 U U U . n A 1 56 C 56 56 56 C C U . n A 1 57 C 57 57 57 C C U . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG U . C 3 HOH 1 201 1 HOH HOH U . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9XAQ _cell.details ? _cell.formula_units_Z ? _cell.length_a 81.405 _cell.length_a_esd ? _cell.length_b 81.405 _cell.length_b_esd ? _cell.length_c 98.722 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9XAQ _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9XAQ _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.54 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 51.50 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Ammonium acetate, HEPES pH 7.5, MPD' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-07-04 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97853 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL18U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97853 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL18U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9XAQ _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.50 _reflns.d_resolution_low 30.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 7142 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 35.2 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 4.4 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 2.037 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.181 _reflns.pdbx_Rpim_I_all 0.033 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half ? _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.178 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.50 2.54 ? ? ? ? ? ? 344 ? ? ? ? ? ? ? ? ? ? ? ? 0.504 ? ? ? 0.245 ? 1 1 0.764 0.931 ? 96.9 ? 1.151 ? ? ? ? ? ? ? ? ? 2.54 2.59 ? ? ? ? ? ? 332 ? ? ? ? ? ? ? ? ? ? ? ? 0.524 ? ? ? 0.221 ? 2 1 0.860 0.962 ? 100.0 ? 1.183 ? ? ? ? ? ? ? ? ? 2.59 2.64 ? ? ? ? ? ? 347 ? ? ? ? ? ? ? ? ? ? ? ? 0.494 ? ? ? 0.193 ? 3 1 0.912 0.977 ? 100.0 ? 1.131 ? ? ? ? ? ? ? ? ? 2.64 2.69 ? ? ? ? ? ? 348 ? ? ? ? ? ? ? ? ? ? ? ? 0.537 ? ? 0.980 0.162 ? 4 1 0.920 0.979 ? 100.0 ? 0.966 ? ? ? ? ? ? ? ? ? 2.69 2.75 ? ? ? ? ? ? 341 ? ? ? ? ? ? ? ? ? ? ? ? 0.560 ? ? 0.874 0.146 ? 5 1 0.947 0.986 ? 100.0 ? 0.861 ? ? ? ? ? ? ? ? ? 2.75 2.82 ? ? ? ? ? ? 359 ? ? ? ? ? ? ? ? ? ? ? ? 0.567 ? ? 0.716 0.114 ? 6 1 0.971 0.993 ? 100.0 ? 0.707 ? ? ? ? ? ? ? ? ? 2.82 2.89 ? ? ? ? ? ? 341 ? ? ? ? ? ? ? ? ? ? ? ? 0.624 ? ? 0.520 0.085 ? 7 1 0.978 0.995 ? 100.0 ? 0.513 ? ? ? ? ? ? ? ? ? 2.89 2.96 ? ? ? ? ? ? 348 ? ? ? ? ? ? ? ? ? ? ? ? 0.740 ? ? 0.412 0.068 ? 8 1 0.976 0.994 ? 100.0 ? 0.406 ? ? ? ? ? ? ? ? ? 2.96 3.05 ? ? ? ? ? ? 345 ? ? ? ? ? ? ? ? ? ? ? ? 1.181 ? ? 0.281 0.046 ? 9 1 0.990 0.998 ? 100.0 ? 0.277 ? ? ? ? ? ? ? ? ? 3.05 3.15 ? ? ? ? ? ? 355 ? ? ? ? ? ? ? ? ? ? ? ? 1.073 ? ? 0.222 0.036 ? 10 1 0.996 0.999 ? 100.0 ? 0.219 ? ? ? ? ? ? ? ? ? 3.15 3.26 ? ? ? ? ? ? 347 ? ? ? ? ? ? ? ? ? ? ? ? 1.323 ? ? 0.198 0.032 ? 11 1 0.997 0.999 ? 99.7 ? 0.196 ? ? ? ? ? ? ? ? ? 3.26 3.39 ? ? ? ? ? ? 358 ? ? ? ? ? ? ? ? ? ? ? ? 1.574 ? ? 0.175 0.029 ? 12 1 0.994 0.998 ? 100.0 ? 0.172 ? ? ? ? ? ? ? ? ? 3.39 3.55 ? ? ? ? ? ? 353 ? ? ? ? ? ? ? ? ? ? ? ? 1.529 ? ? 0.169 0.029 ? 13 1 0.992 0.998 ? 100.0 ? 0.167 ? ? ? ? ? ? ? ? ? 3.55 3.73 ? ? ? ? ? ? 356 ? ? ? ? ? ? ? ? ? ? ? ? 1.946 ? ? 0.161 0.027 ? 14 1 0.991 0.998 ? 100.0 ? 0.158 ? ? ? ? ? ? ? ? ? 3.73 3.97 ? ? ? ? ? ? 356 ? ? ? ? ? ? ? ? ? ? ? ? 1.948 ? ? 0.146 0.025 ? 15 1 0.996 0.999 ? 99.7 ? 0.144 ? ? ? ? ? ? ? ? ? 3.97 4.27 ? ? ? ? ? ? 366 ? ? ? ? ? ? ? ? ? ? ? ? 1.937 ? ? 0.135 0.022 ? 16 1 0.996 0.999 ? 100.0 ? 0.133 ? ? ? ? ? ? ? ? ? 4.27 4.70 ? ? ? ? ? ? 363 ? ? ? ? ? ? ? ? ? ? ? ? 2.482 ? ? 0.137 0.023 ? 17 1 0.987 0.997 ? 100.0 ? 0.135 ? ? ? ? ? ? ? ? ? 4.70 5.38 ? ? ? ? ? ? 374 ? ? ? ? ? ? ? ? ? ? ? ? 3.497 ? ? 0.128 0.023 ? 18 1 0.939 0.984 ? 100.0 ? 0.126 ? ? ? ? ? ? ? ? ? 5.38 6.76 ? ? ? ? ? ? 384 ? ? ? ? ? ? ? ? ? ? ? ? 3.398 ? ? 0.117 0.020 ? 19 1 0.987 0.997 ? 100.0 ? 0.115 ? ? ? ? ? ? ? ? ? 6.76 30.00 ? ? ? ? ? ? 425 ? ? ? ? ? ? ? ? ? ? ? ? 13.258 ? ? 0.195 0.039 ? 20 1 0.920 0.979 ? 99.8 ? 0.190 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9XAQ _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.50 _refine.ls_d_res_low 29.82 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 7067 _refine.ls_number_reflns_R_free 710 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.10 _refine.ls_percent_reflns_R_free 10.05 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2074 _refine.ls_R_factor_R_free 0.2474 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2028 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 30.21 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.40 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1234 _refine_hist.pdbx_number_atoms_ligand 1 _refine_hist.number_atoms_solvent 1 _refine_hist.number_atoms_total 1236 _refine_hist.d_res_high 2.50 _refine_hist.d_res_low 29.82 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1379 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.134 ? 2150 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 18.312 ? 683 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.045 ? 284 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 57 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.50 2.69 . . 136 1223 98.00 . . . . 0.3448 . . . . . . . . . . . . . . . 0.3846 'X-RAY DIFFRACTION' 2.69 2.96 . . 138 1233 99.00 . . . . 0.3355 . . . . . . . . . . . . . . . 0.4069 'X-RAY DIFFRACTION' 2.96 3.39 . . 140 1255 99.00 . . . . 0.2201 . . . . . . . . . . . . . . . 0.2628 'X-RAY DIFFRACTION' 3.39 4.27 . . 142 1279 100.00 . . . . 0.1853 . . . . . . . . . . . . . . . 0.2231 'X-RAY DIFFRACTION' 4.27 29.82 . . 154 1367 99.00 . . . . 0.1718 . . . . . . . . . . . . . . . 0.2165 # _struct.entry_id 9XAQ _struct.title 'Cryatal structure of apo-state RhoBAST-G38U' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9XAQ _struct_keywords.text 'aptamer, RhoBAST, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9XAQ _struct_ref.pdbx_db_accession 9XAQ _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9XAQ _struct_ref_seq.pdbx_strand_id U _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9XAQ _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 400 ? 1 MORE -3 ? 1 'SSA (A^2)' 9860 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? U GTP 1 U G 2 1_555 ? ? ? ? ? ? ? 1.562 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 57 N3 ? ? U GTP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 57 O2 ? ? U GTP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 57 N4 ? ? U GTP 1 U C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 55 N3 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 55 O4 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 54 N3 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 54 O4 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 53 N1 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 53 O6 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 53 N2 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 52 N1 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 52 O6 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 52 N2 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 51 N1 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 51 N6 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 20 N1 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 20 O6 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 20 N2 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 18 N1 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 18 O6 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 18 N2 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? U G 13 U A 16 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog35 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 24 N1 ? ? ? 1_555 A A 42 N6 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog41 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 42 N7 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 43 N7 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog43 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 43 N6 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog44 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 35 N3 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 35 O2 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 35 N4 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 50 N3 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 29 N2 ? ? ? 1_555 A C 50 O2 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 29 O6 ? ? ? 1_555 A C 50 N4 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 49 N3 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 49 O4 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 48 N3 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 48 O2 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 48 N4 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog56 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 46 N1 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 46 O6 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 46 N2 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9XAQ _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" U GTP 1 ? ? "O3'" U GTP 1 ? ? P U G 2 ? ? 101.50 119.70 -18.20 1.20 Y 2 1 "O3'" U GTP 1 ? ? P U G 2 ? ? OP2 U G 2 ? ? 129.00 110.50 18.50 1.10 Y 3 1 "O3'" U GTP 1 ? ? P U G 2 ? ? OP1 U G 2 ? ? 80.40 105.20 -24.80 2.20 Y 4 1 N1 U C 47 ? ? C2 U C 47 ? ? O2 U C 47 ? ? 122.72 118.90 3.82 0.60 N 5 1 N3 U C 47 ? ? C2 U C 47 ? ? O2 U C 47 ? ? 116.64 121.90 -5.26 0.70 N # _pdbx_struct_special_symmetry.id 1 _pdbx_struct_special_symmetry.PDB_model_num 1 _pdbx_struct_special_symmetry.auth_asym_id U _pdbx_struct_special_symmetry.auth_comp_id HOH _pdbx_struct_special_symmetry.auth_seq_id 201 _pdbx_struct_special_symmetry.PDB_ins_code ? _pdbx_struct_special_symmetry.label_asym_id C _pdbx_struct_special_symmetry.label_comp_id HOH _pdbx_struct_special_symmetry.label_seq_id . # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 4.6214 _pdbx_refine_tls.origin_y -29.4264 _pdbx_refine_tls.origin_z -0.4019 _pdbx_refine_tls.T[1][1] 0.5549 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0978 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0701 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.6752 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] -0.0200 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.5667 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.9357 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.6498 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.6414 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.9084 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.3842 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.7824 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.0830 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.1109 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.1135 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.0043 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.0621 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0197 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.2621 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0943 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] 0.0043 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 MG MG MG N N 162 U OP3 O N N 163 U P P N N 164 U OP1 O N N 165 U OP2 O N N 166 U "O5'" O N N 167 U "C5'" C N N 168 U "C4'" C N R 169 U "O4'" O N N 170 U "C3'" C N S 171 U "O3'" O N N 172 U "C2'" C N R 173 U "O2'" O N N 174 U "C1'" C N R 175 U N1 N N N 176 U C2 C N N 177 U O2 O N N 178 U N3 N N N 179 U C4 C N N 180 U O4 O N N 181 U C5 C N N 182 U C6 C N N 183 U HOP3 H N N 184 U HOP2 H N N 185 U "H5'" H N N 186 U "H5''" H N N 187 U "H4'" H N N 188 U "H3'" H N N 189 U "HO3'" H N N 190 U "H2'" H N N 191 U "HO2'" H N N 192 U "H1'" H N N 193 U H3 H N N 194 U H5 H N N 195 U H6 H N N 196 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 U OP3 P sing N N 168 U OP3 HOP3 sing N N 169 U P OP1 doub N N 170 U P OP2 sing N N 171 U P "O5'" sing N N 172 U OP2 HOP2 sing N N 173 U "O5'" "C5'" sing N N 174 U "C5'" "C4'" sing N N 175 U "C5'" "H5'" sing N N 176 U "C5'" "H5''" sing N N 177 U "C4'" "O4'" sing N N 178 U "C4'" "C3'" sing N N 179 U "C4'" "H4'" sing N N 180 U "O4'" "C1'" sing N N 181 U "C3'" "O3'" sing N N 182 U "C3'" "C2'" sing N N 183 U "C3'" "H3'" sing N N 184 U "O3'" "HO3'" sing N N 185 U "C2'" "O2'" sing N N 186 U "C2'" "C1'" sing N N 187 U "C2'" "H2'" sing N N 188 U "O2'" "HO2'" sing N N 189 U "C1'" N1 sing N N 190 U "C1'" "H1'" sing N N 191 U N1 C2 sing N N 192 U N1 C6 sing N N 193 U C2 O2 doub N N 194 U C2 N3 sing N N 195 U N3 C4 sing N N 196 U N3 H3 sing N N 197 U C4 O4 doub N N 198 U C4 C5 sing N N 199 U C5 C6 doub N N 200 U C5 H5 sing N N 201 U C6 H6 sing N N 202 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9XAQ 'double helix' 9XAQ 'a-form double helix' 9XAQ 'hairpin loop' 9XAQ tetraloop 9XAQ 'bulge loop' 9XAQ 'mismatched base pair' 9XAQ 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 57 1_555 -0.393 0.064 -0.446 -10.332 -15.673 -1.974 1 U_GTP1:C57_U U 1 ? U 57 ? 19 1 1 A G 2 1_555 A C 56 1_555 -0.256 -0.137 0.160 -3.156 -19.780 1.565 2 U_G2:C56_U U 2 ? U 56 ? 19 1 1 A A 3 1_555 A U 55 1_555 0.226 -0.104 0.115 -2.966 -16.427 1.812 3 U_A3:U55_U U 3 ? U 55 ? 20 1 1 A A 4 1_555 A U 54 1_555 0.475 -0.126 0.129 4.820 -14.401 -3.433 4 U_A4:U54_U U 4 ? U 54 ? 20 1 1 A C 5 1_555 A G 53 1_555 0.887 -0.174 -0.008 6.538 -22.875 9.691 5 U_C5:G53_U U 5 ? U 53 ? 19 1 1 A C 6 1_555 A G 52 1_555 0.015 -0.344 0.233 -3.971 -16.537 -3.323 6 U_C6:G52_U U 6 ? U 52 ? 19 1 1 A U 7 1_555 A A 51 1_555 -0.121 -0.117 0.098 -0.858 -8.114 -3.254 7 U_U7:A51_U U 7 ? U 51 ? 20 1 1 A G 29 1_555 A C 50 1_555 -0.345 -0.310 0.101 3.302 -7.159 2.610 8 U_G29:C50_U U 29 ? U 50 ? 19 1 1 A A 30 1_555 A U 49 1_555 0.070 0.077 0.403 -13.315 -9.780 13.888 9 U_A30:U49_U U 30 ? U 49 ? 20 1 1 A G 31 1_555 A C 48 1_555 -0.219 -0.195 0.052 -7.531 -13.555 -0.904 10 U_G31:C48_U U 31 ? U 48 ? 19 1 1 A G 32 1_555 A C 47 1_555 0.009 4.542 0.623 -17.970 -5.185 -88.339 11 U_G32:C47_U U 32 ? U 47 ? ? ? 1 A C 33 1_555 A G 46 1_555 0.277 0.059 0.266 1.028 -11.230 6.643 12 U_C33:G46_U U 33 ? U 46 ? 19 1 1 A G 34 1_555 A C 45 1_555 -0.309 0.033 0.233 -0.075 -15.608 4.718 13 U_G34:C45_U U 34 ? U 45 ? 19 1 1 A C 35 1_555 A G 27 1_555 0.059 0.068 -0.170 -9.189 0.861 6.050 14 U_C35:G27_U U 35 ? U 27 ? 19 1 1 A A 16 1_555 A G 13 1_555 -7.169 -4.870 0.809 -15.759 -2.710 -16.652 15 U_A16:G13_U U 16 ? U 13 ? ? ? 1 A G 17 1_555 A C 12 1_555 -0.117 -0.045 -0.034 -0.652 -5.149 0.139 16 U_G17:C12_U U 17 ? U 12 ? 19 1 1 A G 18 1_555 A C 11 1_555 -0.216 -0.310 0.152 5.082 -10.620 -0.488 17 U_G18:C11_U U 18 ? U 11 ? 19 1 1 A C 19 1_555 A G 10 1_555 -0.053 -0.154 0.155 2.897 -11.356 -0.257 18 U_C19:G10_U U 19 ? U 10 ? 19 1 1 A G 20 1_555 A C 9 1_555 0.055 -0.064 0.397 -0.064 -13.085 2.022 19 U_G20:C9_U U 20 ? U 9 ? 19 1 1 A G 21 1_555 A C 8 1_555 -0.230 -0.157 -0.039 -13.498 -17.422 -1.009 20 U_G21:C8_U U 21 ? U 8 ? 19 1 1 A U 22 1_555 A A 28 1_555 0.157 -0.171 0.162 -12.296 -14.061 2.130 21 U_U22:A28_U U 22 ? U 28 ? 20 1 1 A G 23 1_555 A C 44 1_555 -0.153 -0.071 -0.522 -15.335 7.306 -2.688 22 U_G23:C44_U U 23 ? U 44 ? 19 1 1 A G 26 1_555 A A 43 1_555 7.016 -4.816 0.182 -21.667 -19.433 0.888 23 U_G26:A43_U U 26 ? U 43 ? 11 10 1 A A 24 1_555 A A 42 1_555 4.407 0.875 0.047 -6.087 -3.144 -109.049 24 U_A24:A42_U U 24 ? U 42 ? 5 4 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 57 1_555 A G 2 1_555 A C 56 1_555 0.116 -1.220 3.071 -7.431 13.054 36.122 -3.208 -0.960 2.435 20.021 11.398 39.024 1 UU_GTP1G2:C56C57_UU U 1 ? U 57 ? U 2 ? U 56 ? 1 A G 2 1_555 A C 56 1_555 A A 3 1_555 A U 55 1_555 0.200 -1.337 3.175 0.963 8.897 35.711 -3.239 -0.196 2.778 14.234 -1.541 36.779 2 UU_G2A3:U55C56_UU U 2 ? U 56 ? U 3 ? U 55 ? 1 A A 3 1_555 A U 55 1_555 A A 4 1_555 A U 54 1_555 -0.323 -1.114 2.904 -0.527 7.069 33.034 -2.895 0.482 2.621 12.256 0.914 33.765 3 UU_A3A4:U54U55_UU U 3 ? U 55 ? U 4 ? U 54 ? 1 A A 4 1_555 A U 54 1_555 A C 5 1_555 A G 53 1_555 1.103 -1.224 3.132 5.572 9.247 33.853 -3.278 -1.044 2.850 15.402 -9.281 35.484 4 UU_A4C5:G53U54_UU U 4 ? U 54 ? U 5 ? U 53 ? 1 A C 5 1_555 A G 53 1_555 A C 6 1_555 A G 52 1_555 -0.503 -1.815 3.410 -1.852 9.687 29.975 -5.080 0.593 2.730 18.122 3.464 31.520 5 UU_C5C6:G52G53_UU U 5 ? U 53 ? U 6 ? U 52 ? 1 A C 6 1_555 A G 52 1_555 A U 7 1_555 A A 51 1_555 0.154 -1.539 3.093 3.559 14.370 28.731 -4.927 0.258 2.108 26.827 -6.644 32.249 6 UU_C6U7:A51G52_UU U 6 ? U 52 ? U 7 ? U 51 ? 1 A U 7 1_555 A A 51 1_555 A G 29 1_555 A C 50 1_555 -1.423 -1.867 2.989 -0.965 12.248 41.494 -3.547 1.853 2.400 16.848 1.327 43.198 7 UU_U7G29:C50A51_UU U 7 ? U 51 ? U 29 ? U 50 ? 1 A G 29 1_555 A C 50 1_555 A A 30 1_555 A U 49 1_555 0.413 -2.067 3.442 -1.735 10.746 40.002 -4.041 -0.765 2.800 15.367 2.481 41.398 8 UU_G29A30:U49C50_UU U 29 ? U 50 ? U 30 ? U 49 ? 1 A A 30 1_555 A U 49 1_555 A G 31 1_555 A C 48 1_555 -1.235 -1.570 2.959 3.043 4.821 29.010 -3.944 2.969 2.531 9.508 -6.002 29.553 9 UU_A30G31:C48U49_UU U 30 ? U 49 ? U 31 ? U 48 ? 1 A G 31 1_555 A C 48 1_555 A G 32 1_555 A C 47 1_555 0.988 -2.967 2.685 6.892 10.402 75.042 -2.654 -0.643 2.389 8.483 -5.620 75.922 10 UU_G31G32:C47C48_UU U 31 ? U 48 ? U 32 ? U 47 ? 1 A G 32 1_555 A C 47 1_555 A C 33 1_555 A G 46 1_555 0.134 0.990 3.291 1.162 4.433 -9.814 -11.891 2.453 2.565 -24.248 6.358 -10.829 11 UU_G32C33:G46C47_UU U 32 ? U 47 ? U 33 ? U 46 ? 1 A C 33 1_555 A G 46 1_555 A G 34 1_555 A C 45 1_555 0.549 -1.760 3.084 1.826 9.680 27.954 -5.206 -0.742 2.384 19.296 -3.640 29.606 12 UU_C33G34:C45G46_UU U 33 ? U 46 ? U 34 ? U 45 ? 1 A G 34 1_555 A C 45 1_555 A C 35 1_555 A G 27 1_555 2.247 -0.607 3.476 8.969 -6.288 51.235 -0.220 -1.879 3.836 -7.178 -10.238 52.316 13 UU_G34C35:G27C45_UU U 34 ? U 45 ? U 35 ? U 27 ? 1 A A 16 1_555 A G 13 1_555 A G 17 1_555 A C 12 1_555 2.058 -1.086 2.907 5.004 5.152 48.971 -1.643 -2.124 2.969 6.177 -6.000 49.463 14 UU_A16G17:C12G13_UU U 16 ? U 13 ? U 17 ? U 12 ? 1 A G 17 1_555 A C 12 1_555 A G 18 1_555 A C 11 1_555 -0.560 -1.682 3.112 -3.344 2.978 32.562 -3.452 0.453 2.992 5.279 5.928 32.860 15 UU_G17G18:C11C12_UU U 17 ? U 12 ? U 18 ? U 11 ? 1 A G 18 1_555 A C 11 1_555 A C 19 1_555 A G 10 1_555 0.114 -1.492 3.350 0.709 7.419 32.794 -3.765 -0.085 2.953 12.934 -1.236 33.607 16 UU_G18C19:G10C11_UU U 18 ? U 11 ? U 19 ? U 10 ? 1 A C 19 1_555 A G 10 1_555 A G 20 1_555 A C 9 1_555 0.289 -1.840 3.160 -0.706 9.994 30.236 -4.962 -0.640 2.436 18.531 1.309 31.816 17 UU_C19G20:C9G10_UU U 19 ? U 10 ? U 20 ? U 9 ? 1 A G 20 1_555 A C 9 1_555 A G 21 1_555 A C 8 1_555 0.358 -1.650 3.438 4.489 6.845 34.337 -3.749 0.082 3.083 11.395 -7.473 35.271 18 UU_G20G21:C8C9_UU U 20 ? U 9 ? U 21 ? U 8 ? 1 A G 21 1_555 A C 8 1_555 A U 22 1_555 A A 28 1_555 -0.286 -0.975 3.289 2.701 -1.583 32.967 -1.442 0.961 3.298 -2.782 -4.747 33.111 19 UU_G21U22:A28C8_UU U 21 ? U 8 ? U 22 ? U 28 ? 1 A U 22 1_555 A A 28 1_555 A G 23 1_555 A C 44 1_555 2.087 0.466 3.209 14.255 4.929 44.772 0.144 -1.340 3.702 6.264 -18.116 47.121 20 UU_U22G23:C44A28_UU U 22 ? U 28 ? U 23 ? U 44 ? 1 A G 23 1_555 A C 44 1_555 A G 26 1_555 A A 43 1_555 -0.117 -0.724 4.130 9.330 28.640 65.420 -1.841 0.498 3.557 25.169 -8.200 71.316 21 UU_G23G26:A43C44_UU U 23 ? U 44 ? U 26 ? U 43 ? 1 A G 26 1_555 A A 43 1_555 A A 24 1_555 A A 42 1_555 -1.450 -0.151 2.989 -1.642 -0.706 -18.180 0.828 -5.387 2.840 2.227 -5.179 -18.267 22 UU_G26A24:A42A43_UU U 26 ? U 43 ? U 24 ? U 42 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9L8F _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9XAQ _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012284 _atom_sites.fract_transf_matrix[1][2] 0.007092 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.014185 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.010129 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #