data_9YX9 # _entry.id 9YX9 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.416 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9YX9 pdb_00009yx9 10.2210/pdb9yx9/pdb WWPDB D_1000301545 ? ? EMDB EMD-73600 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2026-09-02 ? 2 'EM metadata' 1 0 2026-09-02 ? # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 2 'EM metadata' repository 'Initial release' ? ? # _database_PDB_caveat.id 1 _database_PDB_caveat.text ;G A 7 HAS WRONG CHIRALITY AT ATOM C3' ; # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9YX9 _pdbx_database_status.recvd_initial_deposition_date 2025-10-26 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'SARS-CoV-2 SL5 rotated junction' _pdbx_database_related.db_id EMD-73600 _pdbx_database_related.content_type 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email rhiju@stanford.edu _pdbx_contact_author.name_first Rhiju _pdbx_contact_author.name_last Das _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0001-7497-0972 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kretsch, R.C.' 1 0000-0002-6935-518X 'Xu, L.' 2 0000-0002-1200-8937 'Chiu, W.' 3 0000-0002-8910-3078 'Das, R.' 4 0000-0001-7497-0972 # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary Proteins PSFGEY 0867 1097-0134 ? ? 94 ? 192 217 'Assessment of Nucleic Acid Structure Prediction in CASP16.' 2026 ? 10.1002/prot.70072 41165252 ? ? ? ? ? ? ? ? ? US ? ? 1 bioRxiv ? ? 2692-8205 ? ? ? ? ? ? 'Assessment of nucleic acid structure prediction in CASP16' 2025 ? 10.1101/2025.02.14.638364 40655015 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kretsch, R.C.' 1 0000-0002-6935-518X primary 'Hummer, A.M.' 2 0000-0002-3023-2588 primary 'He, S.' 3 0000-0003-1010-536X primary 'Yuan, R.' 4 0000-0001-5917-4505 primary 'Zhang, J.' 5 0000-0003-4190-3065 primary 'Karagianes, T.' 6 ? primary 'Cong, Q.' 7 0000-0002-8909-0414 primary 'Kryshtafovych, A.' 8 0000-0001-5066-7178 primary 'Das, R.' 9 0000-0001-7497-0972 1 'Kretsch, R.C.' 10 0000-0002-6935-518X 1 'Hummer, A.M.' 11 0000-0002-3023-2588 1 'He, S.' 12 0000-0003-1010-536X 1 'Yuan, R.' 13 0000-0001-5917-4505 1 'Zhang, J.' 14 0000-0003-4190-3065 1 'Karagianes, T.' 15 ? 1 'Cong, Q.' 16 0000-0002-8909-0414 1 'Kryshtafovych, A.' 17 0000-0001-5066-7178 1 'Das, R.' 18 0000-0001-7497-0972 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (124-MER)' _entity.formula_weight 39807.484 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGACACGAGUAACUCGUCUAUCUGCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGAACAUCUAGGU UUCGUCCGGGUGUUACCGAAAGGUCAGAUGGAGAGCCUUGUCCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGACACGAGUAACUCGUCUAUCUGCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGAACAUCUAGGU UUCGUCCGGGUGUUACCGAAAGGUCAGAUGGAGAGCCUUGUCCC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 C n 1 5 A n 1 6 C n 1 7 G n 1 8 A n 1 9 G n 1 10 U n 1 11 A n 1 12 A n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 C n 1 19 U n 1 20 A n 1 21 U n 1 22 C n 1 23 U n 1 24 G n 1 25 C n 1 26 U n 1 27 G n 1 28 C n 1 29 A n 1 30 G n 1 31 G n 1 32 C n 1 33 U n 1 34 G n 1 35 C n 1 36 U n 1 37 U n 1 38 A n 1 39 C n 1 40 G n 1 41 G n 1 42 U n 1 43 U n 1 44 U n 1 45 C n 1 46 G n 1 47 U n 1 48 C n 1 49 C n 1 50 G n 1 51 U n 1 52 G n 1 53 U n 1 54 U n 1 55 G n 1 56 C n 1 57 A n 1 58 G n 1 59 C n 1 60 C n 1 61 G n 1 62 A n 1 63 U n 1 64 C n 1 65 A n 1 66 U n 1 67 C n 1 68 A n 1 69 G n 1 70 A n 1 71 A n 1 72 C n 1 73 A n 1 74 U n 1 75 C n 1 76 U n 1 77 A n 1 78 G n 1 79 G n 1 80 U n 1 81 U n 1 82 U n 1 83 C n 1 84 G n 1 85 U n 1 86 C n 1 87 C n 1 88 G n 1 89 G n 1 90 G n 1 91 U n 1 92 G n 1 93 U n 1 94 U n 1 95 A n 1 96 C n 1 97 C n 1 98 G n 1 99 A n 1 100 A n 1 101 A n 1 102 G n 1 103 G n 1 104 U n 1 105 C n 1 106 A n 1 107 G n 1 108 A n 1 109 U n 1 110 G n 1 111 G n 1 112 A n 1 113 G n 1 114 A n 1 115 G n 1 116 C n 1 117 C n 1 118 U n 1 119 U n 1 120 G n 1 121 U n 1 122 C n 1 123 C n 1 124 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 124 _pdbx_entity_src_syn.organism_scientific 'Severe acute respiratory syndrome coronavirus 2' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 2697049 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 A 3 3 3 A A A . n A 1 4 C 4 4 4 C C A . n A 1 5 A 5 5 5 A A A . n A 1 6 C 6 6 6 C C A . n A 1 7 G 7 7 7 G G A . n A 1 8 A 8 8 8 A A A . n A 1 9 G 9 9 9 G G A . n A 1 10 U 10 10 10 U U A . n A 1 11 A 11 11 11 A A A . n A 1 12 A 12 12 12 A A A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 C 18 18 18 C C A . n A 1 19 U 19 19 19 U U A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 C 22 22 22 C C A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 C 25 25 25 C C A . n A 1 26 U 26 26 26 U U A . n A 1 27 G 27 27 27 G G A . n A 1 28 C 28 28 28 C C A . n A 1 29 A 29 29 29 A A A . n A 1 30 G 30 30 30 G G A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 U 33 33 33 U U A . n A 1 34 G 34 34 34 G G A . n A 1 35 C 35 35 35 C C A . n A 1 36 U 36 36 36 U U A . n A 1 37 U 37 37 37 U U A . n A 1 38 A 38 38 38 A A A . n A 1 39 C 39 39 39 C C A . n A 1 40 G 40 40 40 G G A . n A 1 41 G 41 41 41 G G A . n A 1 42 U 42 42 42 U U A . n A 1 43 U 43 43 43 U U A . n A 1 44 U 44 44 44 U U A . n A 1 45 C 45 45 45 C C A . n A 1 46 G 46 46 46 G G A . n A 1 47 U 47 47 47 U U A . n A 1 48 C 48 48 48 C C A . n A 1 49 C 49 49 49 C C A . n A 1 50 G 50 50 50 G G A . n A 1 51 U 51 51 51 U U A . n A 1 52 G 52 52 52 G G A . n A 1 53 U 53 53 53 U U A . n A 1 54 U 54 54 54 U U A . n A 1 55 G 55 55 55 G G A . n A 1 56 C 56 56 56 C C A . n A 1 57 A 57 57 57 A A A . n A 1 58 G 58 58 58 G G A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 G 61 61 61 G G A . n A 1 62 A 62 62 62 A A A . n A 1 63 U 63 63 63 U U A . n A 1 64 C 64 64 64 C C A . n A 1 65 A 65 65 65 A A A . n A 1 66 U 66 66 66 U U A . n A 1 67 C 67 67 67 C C A . n A 1 68 A 68 68 68 A A A . n A 1 69 G 69 69 69 G G A . n A 1 70 A 70 70 70 A A A . n A 1 71 A 71 71 71 A A A . n A 1 72 C 72 72 72 C C A . n A 1 73 A 73 73 73 A A A . n A 1 74 U 74 74 74 U U A . n A 1 75 C 75 75 75 C C A . n A 1 76 U 76 76 76 U U A . n A 1 77 A 77 77 77 A A A . n A 1 78 G 78 78 78 G G A . n A 1 79 G 79 79 79 G G A . n A 1 80 U 80 80 80 U U A . n A 1 81 U 81 81 81 U U A . n A 1 82 U 82 82 82 U U A . n A 1 83 C 83 83 83 C C A . n A 1 84 G 84 84 84 G G A . n A 1 85 U 85 85 85 U U A . n A 1 86 C 86 86 86 C C A . n A 1 87 C 87 87 87 C C A . n A 1 88 G 88 88 88 G G A . n A 1 89 G 89 89 89 G G A . n A 1 90 G 90 90 90 G G A . n A 1 91 U 91 91 91 U U A . n A 1 92 G 92 92 92 G G A . n A 1 93 U 93 93 93 U U A . n A 1 94 U 94 94 94 U U A . n A 1 95 A 95 95 95 A A A . n A 1 96 C 96 96 96 C C A . n A 1 97 C 97 97 97 C C A . n A 1 98 G 98 98 98 G G A . n A 1 99 A 99 99 99 A A A . n A 1 100 A 100 100 100 A A A . n A 1 101 A 101 101 101 A A A . n A 1 102 G 102 102 102 G G A . n A 1 103 G 103 103 103 G G A . n A 1 104 U 104 104 104 U U A . n A 1 105 C 105 105 105 C C A . n A 1 106 A 106 106 106 A A A . n A 1 107 G 107 107 107 G G A . n A 1 108 A 108 108 108 A A A . n A 1 109 U 109 109 109 U U A . n A 1 110 G 110 110 110 G G A . n A 1 111 G 111 111 111 G G A . n A 1 112 A 112 112 112 A A A . n A 1 113 G 113 113 113 G G A . n A 1 114 A 114 114 114 A A A . n A 1 115 G 115 115 115 G G A . n A 1 116 C 116 116 116 C C A . n A 1 117 C 117 117 117 C C A . n A 1 118 U 118 118 118 U U A . n A 1 119 U 119 119 119 U U A . n A 1 120 G 120 120 120 G G A . n A 1 121 U 121 121 121 U U A . n A 1 122 C 122 122 122 C C A . n A 1 123 C 123 123 123 C C A . n A 1 124 C 124 124 124 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9YX9 _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 9YX9 _struct.title 'SARS-CoV-2 SL5 rotated junction' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9YX9 _struct_keywords.text 'RNA, SL5, SARS-CoV-2' _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code OL915129.1 _struct_ref.pdbx_db_accession 2168080771 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ;GGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGU UUCGUCCGGGUGUUACCGAAAGGUAAGAUGGAGAGCCUUGUCCC ; _struct_ref.pdbx_align_begin 105 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9YX9 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 124 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 2168080771 _struct_ref_seq.db_align_beg 105 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 228 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 124 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 9YX9 G A 24 ? GB 2168080771 U 128 conflict 24 1 1 9YX9 A A 70 ? GB 2168080771 C 174 conflict 70 2 1 9YX9 C A 105 ? GB 2168080771 A 209 conflict 105 3 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 123 N3 ? ? A G 1 A C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 123 O2 ? ? A G 1 A C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 123 N4 ? ? A G 1 A C 123 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 122 N3 ? ? A G 2 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 122 O2 ? ? A G 2 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 122 N4 ? ? A G 2 A C 122 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 121 N3 ? ? A A 3 A U 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 121 O4 ? ? A A 3 A U 121 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 120 N1 ? ? A C 4 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 120 O6 ? ? A C 4 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 120 N2 ? ? A C 4 A G 120 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 5 N1 ? ? ? 1_555 A U 119 N3 ? ? A A 5 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 5 N6 ? ? ? 1_555 A U 119 O4 ? ? A A 5 A U 119 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A A 8 N6 ? ? A C 6 A A 8 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A U 118 O4 ? ? A C 6 A U 118 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog16 hydrog ? ? A G 7 N2 ? ? ? 1_555 A G 113 N7 ? ? A G 7 A G 113 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A G 7 N2 ? ? ? 1_555 A A 114 N7 ? ? A G 7 A A 114 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog18 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 118 N3 ? ? A A 8 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 118 O4 ? ? A A 8 A U 118 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A G 9 N2 ? ? ? 1_555 A A 11 N7 ? ? A G 9 A A 11 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 117 N3 ? ? A G 9 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 117 O2 ? ? A G 9 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 117 N4 ? ? A G 9 A C 117 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 10 O2 ? ? ? 1_555 A A 12 N6 ? ? A U 10 A A 12 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog25 hydrog ? ? A A 11 N6 ? ? ? 1_555 A C 117 O2 ? ? A A 11 A C 117 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog26 hydrog ? ? A A 12 N6 ? ? ? 1_555 A C 116 N3 ? ? A A 12 A C 116 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 13 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 13 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 13 A G 115 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 114 N1 ? ? A U 14 A A 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 114 N6 ? ? A U 14 A A 114 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 15 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 15 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 15 A G 113 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 112 N1 ? ? A U 17 A A 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 112 N6 ? ? A U 17 A A 112 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 111 N1 ? ? A C 18 A G 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 111 O6 ? ? A C 18 A G 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 111 N2 ? ? A C 18 A G 111 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 19 N3 ? ? ? 1_555 A G 110 O6 ? ? A U 19 A G 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog41 hydrog ? ? A U 19 O2 ? ? ? 1_555 A G 110 N1 ? ? A U 19 A G 110 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A A 20 N1 ? ? ? 1_555 A U 109 N3 ? ? A A 20 A U 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 20 N6 ? ? ? 1_555 A U 109 O4 ? ? A A 20 A U 109 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 108 N1 ? ? A U 21 A A 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 108 N6 ? ? A U 21 A A 108 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A C 22 N3 ? ? ? 1_555 A G 107 N1 ? ? A C 22 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A C 22 N4 ? ? ? 1_555 A G 107 O6 ? ? A C 22 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 22 O2 ? ? ? 1_555 A G 107 N2 ? ? A C 22 A G 107 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 106 N1 ? ? A U 23 A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 106 N6 ? ? A U 23 A A 106 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 105 N3 ? ? A G 24 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 105 O2 ? ? A G 24 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 105 N4 ? ? A G 24 A C 105 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 25 N3 ? ? ? 1_555 A G 69 N1 ? ? A C 25 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 25 N4 ? ? ? 1_555 A G 69 O6 ? ? A C 25 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 25 O2 ? ? ? 1_555 A G 69 N2 ? ? A C 25 A G 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A U 26 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 26 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A U 26 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 26 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 27 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 27 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 27 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A A 29 N6 ? ? ? 1_555 A G 61 N3 ? ? A A 29 A G 61 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog63 hydrog ? ? A A 29 N7 ? ? ? 1_555 A G 61 N2 ? ? A A 29 A G 61 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog64 hydrog ? ? A A 29 N1 ? ? ? 1_555 A U 66 N3 ? ? A A 29 A U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 66 O4 ? ? A A 29 A U 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 60 N3 ? ? A G 30 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 60 O2 ? ? A G 30 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 60 N4 ? ? A G 30 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A G 30 N2 ? ? ? 1_555 A A 65 N1 ? ? A G 30 A A 65 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog70 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 31 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 31 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 31 A C 59 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 58 N1 ? ? A C 32 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 58 O6 ? ? A C 32 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 58 N2 ? ? A C 32 A G 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A U 33 N3 ? ? ? 1_555 A A 57 N1 ? ? A U 33 A A 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog77 hydrog ? ? A U 33 O4 ? ? ? 1_555 A A 57 N6 ? ? A U 33 A A 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog78 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 56 N3 ? ? A G 34 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog79 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 56 O2 ? ? A G 34 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog80 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 56 N4 ? ? A G 34 A C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A C 35 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 35 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A C 35 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 35 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog83 hydrog ? ? A C 35 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 35 A G 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog84 hydrog ? ? A U 37 N3 ? ? ? 1_555 A G 52 O6 ? ? A U 37 A G 52 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog85 hydrog ? ? A U 37 O2 ? ? ? 1_555 A G 52 N1 ? ? A U 37 A G 52 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog86 hydrog ? ? A A 38 N1 ? ? ? 1_555 A U 51 N3 ? ? A A 38 A U 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A A 38 N6 ? ? ? 1_555 A U 51 O4 ? ? A A 38 A U 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 39 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 39 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 39 A G 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog91 hydrog ? ? A G 40 N1 ? ? ? 1_555 A C 49 N3 ? ? A G 40 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 40 N2 ? ? ? 1_555 A C 49 O2 ? ? A G 40 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 40 O6 ? ? ? 1_555 A C 49 N4 ? ? A G 40 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 41 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 41 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 41 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A U 42 O4 ? ? ? 1_555 A U 47 N3 ? ? A U 42 A U 47 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog98 hydrog ? ? A U 43 N3 ? ? ? 1_555 A G 46 O6 ? ? A U 43 A G 46 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog99 hydrog ? ? A U 43 O2 ? ? ? 1_555 A G 46 N1 ? ? A U 43 A G 46 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog100 hydrog ? ? A C 60 O2 ? ? ? 1_555 A A 65 N6 ? ? A C 60 A A 65 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog101 hydrog ? ? A A 70 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 70 A U 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 70 A U 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A A 71 N1 ? ? ? 1_555 A U 93 N3 ? ? A A 71 A U 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A A 71 N6 ? ? ? 1_555 A U 93 O4 ? ? A A 71 A U 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog105 hydrog ? ? A C 72 N3 ? ? ? 1_555 A G 92 N1 ? ? A C 72 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog106 hydrog ? ? A C 72 N4 ? ? ? 1_555 A G 92 O6 ? ? A C 72 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 72 O2 ? ? ? 1_555 A G 92 N2 ? ? A C 72 A G 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A A 73 N1 ? ? ? 1_555 A U 91 N3 ? ? A A 73 A U 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A A 73 N6 ? ? ? 1_555 A U 91 O4 ? ? A A 73 A U 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A U 74 N3 ? ? ? 1_555 A G 90 O6 ? ? A U 74 A G 90 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog111 hydrog ? ? A U 74 O2 ? ? ? 1_555 A G 90 N1 ? ? A U 74 A G 90 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog112 hydrog ? ? A C 75 N3 ? ? ? 1_555 A G 89 N1 ? ? A C 75 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A C 75 N4 ? ? ? 1_555 A G 89 O6 ? ? A C 75 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A C 75 O2 ? ? ? 1_555 A G 89 N2 ? ? A C 75 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog115 hydrog ? ? A U 76 N3 ? ? ? 1_555 A G 88 O6 ? ? A U 76 A G 88 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog116 hydrog ? ? A U 76 O2 ? ? ? 1_555 A G 88 N1 ? ? A U 76 A G 88 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog117 hydrog ? ? A G 78 O6 ? ? ? 1_555 A G 84 N2 ? ? A G 78 A G 84 1_555 ? ? ? ? ? ? 'G-G MISPAIR' ? ? ? hydrog118 hydrog ? ? A G 78 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 78 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A G 78 N2 ? ? ? 1_555 A C 87 O2 ? ? A G 78 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog120 hydrog ? ? A G 78 O6 ? ? ? 1_555 A C 87 N4 ? ? A G 78 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A G 79 N1 ? ? ? 1_555 A C 86 N3 ? ? A G 79 A C 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A G 79 N2 ? ? ? 1_555 A C 86 O2 ? ? A G 79 A C 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A G 79 O6 ? ? ? 1_555 A C 86 N4 ? ? A G 79 A C 86 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A U 82 N3 ? ? ? 1_555 A C 86 N3 ? ? A U 82 A C 86 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog125 hydrog ? ? A A 95 N1 ? ? ? 1_555 A U 104 N3 ? ? A A 95 A U 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A A 95 N6 ? ? ? 1_555 A U 104 O4 ? ? A A 95 A U 104 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog127 hydrog ? ? A C 96 N3 ? ? ? 1_555 A G 103 N1 ? ? A C 96 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog128 hydrog ? ? A C 96 N4 ? ? ? 1_555 A G 103 O6 ? ? A C 96 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A C 96 O2 ? ? ? 1_555 A G 103 N2 ? ? A C 96 A G 103 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A C 97 N3 ? ? ? 1_555 A G 102 N1 ? ? A C 97 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A C 97 N4 ? ? ? 1_555 A G 102 O6 ? ? A C 97 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A C 97 O2 ? ? ? 1_555 A G 102 N2 ? ? A C 97 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A G 98 N2 ? ? ? 1_555 A A 101 N7 ? ? A G 98 A A 101 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9YX9 _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_ligand_of_interest ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A G 61 ? ? O4 A U 66 ? ? 2.13 2 2 "O2'" A A 11 ? ? O4 A U 14 ? ? 2.00 3 5 "C3'" A G 7 ? ? OP1 A A 8 ? ? 1.69 4 5 "O2'" A U 54 ? ? OP2 A C 56 ? ? 2.19 5 7 "O2'" A U 10 ? ? N4 A C 13 ? ? 2.12 6 7 "O2'" A G 61 ? ? O4 A U 66 ? ? 2.16 7 8 "O2'" A U 10 ? ? H42 A C 13 ? ? 1.38 8 9 "O2'" A C 15 ? ? OP1 A U 17 ? ? 2.18 9 9 "O2'" A U 81 ? ? O6 A G 84 ? ? 2.19 10 10 "HO2'" A G 16 ? ? OP2 A U 17 ? ? 1.46 11 10 "O2'" A G 16 ? ? OP2 A U 17 ? ? 1.77 12 10 "O2'" A G 16 ? ? OP2 A C 18 ? ? 2.06 13 10 "O2'" A C 28 ? ? O6 A G 30 ? ? 2.15 # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 3 _pdbx_validate_rmsd_bond.auth_atom_id_1 "C2'" _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 G _pdbx_validate_rmsd_bond.auth_seq_id_1 84 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 "C1'" _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 G _pdbx_validate_rmsd_bond.auth_seq_id_2 84 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.461 _pdbx_validate_rmsd_bond.bond_target_value 1.526 _pdbx_validate_rmsd_bond.bond_deviation -0.065 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.008 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 2 "O3'" A G 16 ? ? P A U 17 ? ? OP2 A U 17 ? ? 142.56 110.50 32.06 1.10 Y 2 2 "O3'" A G 16 ? ? P A U 17 ? ? OP1 A U 17 ? ? 51.35 105.20 -53.85 2.20 Y 3 2 "O3'" A U 54 ? ? P A G 55 ? ? OP2 A G 55 ? ? 142.44 110.50 31.94 1.10 Y 4 2 "O3'" A U 54 ? ? P A G 55 ? ? OP1 A G 55 ? ? 51.44 105.20 -53.76 2.20 Y 5 2 "O3'" A A 77 ? ? P A G 78 ? ? OP2 A G 78 ? ? 142.48 110.50 31.98 1.10 Y 6 2 "O3'" A A 77 ? ? P A G 78 ? ? OP1 A G 78 ? ? 51.45 105.20 -53.75 2.20 Y 7 2 "O3'" A U 85 ? ? P A C 86 ? ? OP2 A C 86 ? ? 91.17 105.20 -14.03 2.20 Y 8 2 "O3'" A U 85 ? ? P A C 86 ? ? OP1 A C 86 ? ? 119.67 110.50 9.17 1.10 Y 9 2 "O3'" A A 101 ? ? P A G 102 ? ? OP2 A G 102 ? ? 91.78 105.20 -13.42 2.20 Y 10 2 "O3'" A A 101 ? ? P A G 102 ? ? OP1 A G 102 ? ? 118.59 110.50 8.09 1.10 Y 11 2 "O3'" A C 116 ? ? P A C 117 ? ? OP2 A C 117 ? ? 89.84 105.20 -15.36 2.20 Y 12 2 "O3'" A C 116 ? ? P A C 117 ? ? OP1 A C 117 ? ? 120.91 110.50 10.41 1.10 Y 13 3 "C2'" A G 7 ? ? "C3'" A G 7 ? ? "O3'" A G 7 ? ? 139.72 113.70 26.02 1.60 N 14 3 "C3'" A G 84 ? ? "C2'" A G 84 ? ? "C1'" A G 84 ? ? 96.92 101.30 -4.38 0.70 N 15 4 "O4'" A U 10 ? ? "C1'" A U 10 ? ? N1 A U 10 ? ? 114.41 108.50 5.91 0.70 N 16 5 "O3'" A G 7 ? ? P A A 8 ? ? OP1 A A 8 ? ? 11.72 105.20 -93.48 2.20 Y 17 5 "C2'" A C 64 ? ? "C3'" A C 64 ? ? "O3'" A C 64 ? ? 134.95 113.70 21.25 1.60 N 18 5 "O3'" A A 77 ? ? P A G 78 ? ? OP2 A G 78 ? ? 142.55 110.50 32.05 1.10 Y 19 5 "O3'" A A 77 ? ? P A G 78 ? ? OP1 A G 78 ? ? 51.47 105.20 -53.73 2.20 Y 20 6 "O3'" A G 7 ? ? P A A 8 ? ? OP2 A A 8 ? ? 18.80 105.20 -86.40 2.20 Y 21 6 "O3'" A G 7 ? ? P A A 8 ? ? OP1 A A 8 ? ? 132.77 110.50 22.27 1.10 Y 22 6 "O3'" A A 12 ? ? P A C 13 ? ? OP2 A C 13 ? ? 80.68 105.20 -24.52 2.20 Y 23 6 "O3'" A A 12 ? ? P A C 13 ? ? OP1 A C 13 ? ? 128.18 110.50 17.68 1.10 Y 24 6 "O3'" A G 16 ? ? P A U 17 ? ? OP2 A U 17 ? ? 139.22 110.50 28.72 1.10 Y 25 6 "O3'" A G 16 ? ? P A U 17 ? ? OP1 A U 17 ? ? 62.49 105.20 -42.71 2.20 Y 26 6 "O3'" A A 77 ? ? P A G 78 ? ? OP2 A G 78 ? ? 84.50 105.20 -20.70 2.20 Y 27 6 "O3'" A A 77 ? ? P A G 78 ? ? OP1 A G 78 ? ? 125.24 110.50 14.74 1.10 Y 28 6 "O3'" A A 101 ? ? P A G 102 ? ? OP2 A G 102 ? ? 91.13 105.20 -14.07 2.20 Y 29 6 "O3'" A A 101 ? ? P A G 102 ? ? OP1 A G 102 ? ? 119.67 110.50 9.17 1.10 Y 30 6 "O3'" A C 116 ? ? P A C 117 ? ? OP2 A C 117 ? ? 122.15 110.50 11.65 1.10 Y 31 6 "O3'" A C 116 ? ? P A C 117 ? ? OP1 A C 117 ? ? 88.26 105.20 -16.94 2.20 Y 32 7 "O3'" A A 12 ? ? P A C 13 ? ? OP2 A C 13 ? ? 83.47 105.20 -21.73 2.20 Y 33 7 "O3'" A A 12 ? ? P A C 13 ? ? OP1 A C 13 ? ? 126.08 110.50 15.58 1.10 Y 34 7 "O3'" A G 16 ? ? P A U 17 ? ? OP1 A U 17 ? ? 117.49 110.50 6.99 1.10 Y 35 7 "O3'" A A 29 ? ? P A G 30 ? ? OP2 A G 30 ? ? 75.99 105.20 -29.21 2.20 Y 36 7 "O3'" A A 29 ? ? P A G 30 ? ? OP1 A G 30 ? ? 47.09 105.20 -58.11 2.20 Y 37 7 "O3'" A U 66 ? ? P A C 67 ? ? OP2 A C 67 ? ? 85.99 105.20 -19.21 2.20 Y 38 7 "O3'" A U 66 ? ? P A C 67 ? ? OP1 A C 67 ? ? 124.09 110.50 13.59 1.10 Y 39 7 "O3'" A C 116 ? ? P A C 117 ? ? OP2 A C 117 ? ? 72.18 105.20 -33.02 2.20 Y 40 7 "O3'" A C 116 ? ? P A C 117 ? ? OP1 A C 117 ? ? 134.14 110.50 23.64 1.10 Y 41 9 "C3'" A U 66 ? ? "C2'" A U 66 ? ? "C1'" A U 66 ? ? 96.81 101.30 -4.49 0.70 N 42 10 "C3'" A C 6 ? ? "O3'" A C 6 ? ? P A G 7 ? ? 128.50 119.70 8.80 1.20 Y 43 10 "O4'" A C 28 ? ? "C1'" A C 28 ? ? N1 A C 28 ? ? 113.53 108.50 5.03 0.70 N # _pdbx_validate_chiral.id 1 _pdbx_validate_chiral.PDB_model_num 3 _pdbx_validate_chiral.auth_atom_id "C3'" _pdbx_validate_chiral.label_alt_id ? _pdbx_validate_chiral.auth_asym_id A _pdbx_validate_chiral.auth_comp_id G _pdbx_validate_chiral.auth_seq_id 7 _pdbx_validate_chiral.PDB_ins_code ? _pdbx_validate_chiral.details PLANAR _pdbx_validate_chiral.omega . # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 9YX9 _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol ? # _em_3d_reconstruction.entry_id 9YX9 _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 6.5 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 446097 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source SYNTHETIC _em_entity_assembly.type COMPLEX _em_entity_assembly.name 'SARS-CoV-2 SL5 junction rotated' _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 9YX9 _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_min 1200 _em_imaging.nominal_defocus_max 2600 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification ? _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? _em_imaging.objective_aperture ? _em_imaging.microscope_serial_number ? _em_imaging.microscope_version ? # _em_vitrification.entry_id 9YX9 _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity ? _em_vitrification.temp ? _em_vitrification.chamber_temperature ? _em_vitrification.instrument ? _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 9YX9 _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # _em_admin.current_status REL _em_admin.deposition_date 2025-10-26 _em_admin.deposition_site RCSB _em_admin.entry_id 9YX9 _em_admin.last_update 2026-09-02 _em_admin.map_release_date 2026-09-02 _em_admin.title 'SARS-CoV-2 SL5 rotated junction' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 2697049 _em_entity_assembly_naturalsource.organism 'Severe acute respiratory syndrome coronavirus 2' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 60 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version _em_software.reference_DOI 'PARTICLE SELECTION' ? 1 1 ? ? cryoSPARC ? ? 'IMAGE ACQUISITION' ? 2 ? ? 1 ? ? ? MASKING ? 3 ? ? ? ? ? ? 'CTF CORRECTION' ? 4 1 ? ? ? ? ? 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? ? 'MODEL FITTING' ? 7 ? ? ? ? ? ? 'MODEL REFINEMENT' ? 8 ? ? ? ? ? ? OTHER ? 9 ? ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 11 1 ? ? ? ? ? CLASSIFICATION ? 12 1 ? ? ? ? ? RECONSTRUCTION ? 13 1 ? ? cryoSPARC ? ? # _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9YX9 'double helix' 9YX9 'a-form double helix' 9YX9 'hairpin loop' 9YX9 tetraloop 9YX9 'bulge loop' 9YX9 'mismatched base pair' 9YX9 'internal loop' 9YX9 'triple helix' 9YX9 'quadruple helix' 9YX9 'four-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 123 1_555 -0.139 -0.137 -0.121 -4.724 -4.881 -1.053 1 A_G1:C123_A A 1 ? A 123 ? 19 1 1 A G 2 1_555 A C 122 1_555 -0.118 -0.126 -0.142 -6.722 -4.722 -1.542 2 A_G2:C122_A A 2 ? A 122 ? 19 1 1 A A 3 1_555 A U 121 1_555 0.026 -0.070 -0.107 -4.015 -3.065 -3.613 3 A_A3:U121_A A 3 ? A 121 ? 20 1 1 A C 4 1_555 A G 120 1_555 0.155 -0.127 -0.025 0.005 -1.896 -1.089 4 A_C4:G120_A A 4 ? A 120 ? 19 1 1 A A 5 1_555 A U 119 1_555 0.032 -0.076 -0.129 -2.364 -3.628 -3.465 5 A_A5:U119_A A 5 ? A 119 ? 20 1 1 A A 8 1_555 A U 118 1_555 -0.040 -0.123 -0.200 -1.065 -7.544 -0.946 6 A_A8:U118_A A 8 ? A 118 ? 20 1 1 A G 9 1_555 A C 117 1_555 -0.119 -0.132 -0.166 -7.063 -5.320 -1.192 7 A_G9:C117_A A 9 ? A 117 ? 19 1 1 A A 12 1_555 A C 116 1_555 -2.599 -0.722 -0.934 4.783 -6.248 3.433 8 A_A12:C116_A A 12 ? A 116 ? ? 1 1 A C 13 1_555 A G 115 1_555 0.150 -0.139 -0.085 2.295 -3.718 -0.665 9 A_C13:G115_A A 13 ? A 115 ? 19 1 1 A U 14 1_555 A A 114 1_555 0.074 -0.104 -0.165 -2.570 -6.025 -2.025 10 A_U14:A114_A A 14 ? A 114 ? 20 1 1 A C 15 1_555 A G 113 1_555 0.162 -0.129 0.015 -2.864 -0.718 -1.269 11 A_C15:G113_A A 15 ? A 113 ? 19 1 1 A U 17 1_555 A A 112 1_555 0.060 -0.115 -0.169 -1.015 -7.234 -0.998 12 A_U17:A112_A A 17 ? A 112 ? 20 1 1 A C 18 1_555 A G 111 1_555 0.154 -0.121 0.003 -3.191 0.240 -1.365 13 A_C18:G111_A A 18 ? A 111 ? 19 1 1 A U 19 1_555 A G 110 1_555 2.130 -0.468 -0.029 -2.448 0.297 -2.803 14 A_U19:G110_A A 19 ? A 110 ? 28 1 1 A A 20 1_555 A U 109 1_555 -0.012 -0.103 -0.181 -7.950 -1.486 -1.588 15 A_A20:U109_A A 20 ? A 109 ? 20 1 1 A U 21 1_555 A A 108 1_555 0.081 -0.080 -0.097 -2.168 -4.084 -3.137 16 A_U21:A108_A A 21 ? A 108 ? 20 1 1 A C 22 1_555 A G 107 1_555 0.158 -0.128 -0.026 -0.706 -0.909 -1.224 17 A_C22:G107_A A 22 ? A 107 ? 19 1 1 A U 23 1_555 A A 106 1_555 0.055 -0.083 -0.100 -1.172 -2.979 -3.192 18 A_U23:A106_A A 23 ? A 106 ? 20 1 1 A G 24 1_555 A C 105 1_555 -0.104 -0.124 -0.105 -5.106 -4.366 -1.751 19 A_G24:C105_A A 24 ? A 105 ? 19 1 1 A A 95 1_555 A U 104 1_555 -0.044 -0.121 -0.181 -0.785 -7.698 -0.831 20 A_A95:U104_A A 95 ? A 104 ? 20 1 1 A C 96 1_555 A G 103 1_555 0.167 -0.137 -0.051 -0.369 -2.098 -0.659 21 A_C96:G103_A A 96 ? A 103 ? 19 1 1 A C 97 1_555 A G 102 1_555 0.159 -0.128 -0.053 -0.751 -1.160 -1.346 22 A_C97:G102_A A 97 ? A 102 ? 19 1 1 A G 98 1_555 A A 101 1_555 7.098 -5.196 0.796 19.531 -0.587 -24.376 23 A_G98:A101_A A 98 ? A 101 ? ? ? 1 A G 46 1_555 A U 43 1_555 -2.171 -0.620 -1.053 -40.153 5.439 -5.962 24 A_G46:U43_A A 46 ? A 43 ? 28 1 1 A U 47 1_555 A U 42 1_555 2.515 -1.091 -0.030 -10.738 13.517 -20.594 25 A_U47:U42_A A 47 ? A 42 ? ? ? 1 A C 48 1_555 A G 41 1_555 0.107 -0.122 -0.097 5.133 -5.104 -1.804 26 A_C48:G41_A A 48 ? A 41 ? 19 1 1 A C 49 1_555 A G 40 1_555 0.091 -0.123 -0.125 4.735 -3.374 -2.152 27 A_C49:G40_A A 49 ? A 40 ? 19 1 1 A G 50 1_555 A C 39 1_555 -0.163 -0.129 -0.003 1.862 -1.006 -1.192 28 A_G50:C39_A A 50 ? A 39 ? 19 1 1 A U 51 1_555 A A 38 1_555 0.021 -0.108 -0.226 8.315 -2.844 -1.478 29 A_U51:A38_A A 51 ? A 38 ? 20 1 1 A G 52 1_555 A U 37 1_555 -2.122 -0.476 -0.043 -0.057 -3.334 -1.668 30 A_G52:U37_A A 52 ? A 37 ? 28 1 1 A G 55 1_555 A C 35 1_555 -0.160 -0.125 -0.035 -0.778 -3.188 -1.269 31 A_G55:C35_A A 55 ? A 35 ? 19 1 1 A C 56 1_555 A G 34 1_555 0.099 -0.124 -0.111 5.351 -4.468 -1.814 32 A_C56:G34_A A 56 ? A 34 ? 19 1 1 A A 57 1_555 A U 33 1_555 -0.059 -0.084 -0.106 1.796 -3.641 -3.211 33 A_A57:U33_A A 57 ? A 33 ? 20 1 1 A G 58 1_555 A C 32 1_555 -0.161 -0.127 -0.035 0.102 -2.129 -1.156 34 A_G58:C32_A A 58 ? A 32 ? 19 1 1 A C 59 1_555 A G 31 1_555 0.119 -0.126 -0.134 6.969 -5.501 -1.582 35 A_C59:G31_A A 59 ? A 31 ? 19 1 1 A C 60 1_555 A G 30 1_555 0.138 -0.138 -0.116 4.709 -4.893 -1.039 36 A_C60:G30_A A 60 ? A 30 ? 19 1 1 A U 66 1_555 A A 29 1_555 0.068 -0.418 -1.439 27.238 -12.520 12.687 37 A_U66:A29_A A 66 ? A 29 ? 20 1 1 A C 67 1_555 A G 27 1_555 0.098 -0.124 -0.129 6.863 -4.830 -1.907 38 A_C67:G27_A A 67 ? A 27 ? 19 1 1 A A 68 1_555 A U 26 1_555 -0.065 -0.105 -0.135 3.058 -5.529 -1.986 39 A_A68:U26_A A 68 ? A 26 ? 20 1 1 A G 69 1_555 A C 25 1_555 -0.153 -0.140 -0.084 -2.282 -3.744 -0.652 40 A_G69:C25_A A 69 ? A 25 ? 19 1 1 A A 70 1_555 A U 94 1_555 -0.045 -0.123 -0.192 -0.953 -7.490 -0.774 41 A_A70:U94_A A 70 ? A 94 ? 20 1 1 A A 71 1_555 A U 93 1_555 -0.003 -0.095 -0.180 -4.305 -3.690 -1.858 42 A_A71:U93_A A 71 ? A 93 ? 20 1 1 A C 72 1_555 A G 92 1_555 0.157 -0.131 -0.025 -0.876 -1.501 -0.961 43 A_C72:G92_A A 72 ? A 92 ? 19 1 1 A A 73 1_555 A U 91 1_555 0.038 -0.052 -0.119 -3.878 -2.843 -4.343 44 A_A73:U91_A A 73 ? A 91 ? 20 1 1 A U 74 1_555 A G 90 1_555 2.123 -0.457 -0.013 -2.226 -1.533 -2.689 45 A_U74:G90_A A 74 ? A 90 ? 28 1 1 A C 75 1_555 A G 89 1_555 0.156 -0.145 -0.033 -2.245 -0.479 -0.782 46 A_C75:G89_A A 75 ? A 89 ? 19 1 1 A U 76 1_555 A G 88 1_555 2.133 -0.459 -0.020 -2.867 0.408 -3.262 47 A_U76:G88_A A 76 ? A 88 ? 28 1 1 A G 78 1_555 A C 87 1_555 -0.138 -0.138 -0.117 -4.695 -4.898 -1.064 48 A_G78:C87_A A 78 ? A 87 ? 19 1 1 A G 79 1_555 A C 86 1_555 -0.116 -0.125 -0.133 -6.943 -5.471 -1.613 49 A_G79:C86_A A 79 ? A 86 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 123 1_555 A G 2 1_555 A C 122 1_555 -0.018 -1.789 3.286 0.077 6.698 32.573 -4.194 0.045 2.871 11.786 -0.135 33.236 1 AA_G1G2:C122C123_AA A 1 ? A 123 ? A 2 ? A 122 ? 1 A G 2 1_555 A C 122 1_555 A A 3 1_555 A U 121 1_555 -0.008 -1.639 3.172 -0.318 6.882 32.511 -3.927 -0.035 2.777 12.123 0.559 33.214 2 AA_G2A3:U121C122_AA A 2 ? A 122 ? A 3 ? A 121 ? 1 A A 3 1_555 A U 121 1_555 A C 4 1_555 A G 120 1_555 0.356 -1.667 3.209 0.105 6.368 32.589 -3.916 -0.606 2.842 11.214 -0.186 33.189 3 AA_A3C4:G120U121_AA A 3 ? A 121 ? A 4 ? A 120 ? 1 A C 4 1_555 A G 120 1_555 A A 5 1_555 A U 119 1_555 0.018 -1.720 3.320 1.135 8.684 30.919 -4.583 0.160 2.747 15.893 -2.077 32.106 4 AA_C4A5:U119G120_AA A 4 ? A 120 ? A 5 ? A 119 ? 1 A A 5 1_555 A U 119 1_555 A A 8 1_555 A U 118 1_555 -0.509 -2.209 3.812 16.854 25.393 46.638 -3.887 1.547 2.150 28.774 -19.098 55.244 5 AA_A5A8:U118U119_AA A 5 ? A 119 ? A 8 ? A 118 ? 1 A A 8 1_555 A U 118 1_555 A G 9 1_555 A C 117 1_555 -0.039 -1.849 3.381 -0.416 7.799 32.221 -4.515 0.000 2.867 13.801 0.736 33.130 6 AA_A8G9:C117U118_AA A 8 ? A 118 ? A 9 ? A 117 ? 1 A G 9 1_555 A C 117 1_555 A A 12 1_555 A C 116 1_555 -1.918 -2.342 3.307 12.888 16.201 41.137 -4.142 3.366 1.676 21.497 -17.101 45.850 7 AA_G9A12:C116C117_AA A 9 ? A 117 ? A 12 ? A 116 ? 1 A A 12 1_555 A C 116 1_555 A C 13 1_555 A G 115 1_555 0.067 -0.755 3.464 -8.539 16.510 41.779 -2.460 -0.855 2.916 21.898 11.326 45.558 8 AA_A12C13:G115C116_AA A 12 ? A 116 ? A 13 ? A 115 ? 1 A C 13 1_555 A G 115 1_555 A U 14 1_555 A A 114 1_555 0.096 -1.901 3.345 1.907 6.380 31.632 -4.511 0.155 2.917 11.545 -3.451 32.308 9 AA_C13U14:A114G115_AA A 13 ? A 115 ? A 14 ? A 114 ? 1 A U 14 1_555 A A 114 1_555 A C 15 1_555 A G 113 1_555 0.195 -1.737 3.274 -0.063 6.536 32.766 -4.053 -0.349 2.883 11.445 0.111 33.394 10 AA_U14C15:G113A114_AA A 14 ? A 114 ? A 15 ? A 113 ? 1 A C 15 1_555 A G 113 1_555 A U 17 1_555 A A 112 1_555 -1.854 -1.255 3.238 0.463 -2.153 44.795 -1.450 2.473 3.273 -2.823 -0.607 44.846 11 AA_C15U17:A112G113_AA A 15 ? A 113 ? A 17 ? A 112 ? 1 A U 17 1_555 A A 112 1_555 A C 18 1_555 A G 111 1_555 0.007 -1.841 3.302 -0.355 7.448 33.257 -4.269 -0.065 2.835 12.814 0.610 34.060 12 AA_U17C18:G111A112_AA A 17 ? A 112 ? A 18 ? A 111 ? 1 A C 18 1_555 A G 111 1_555 A U 19 1_555 A G 110 1_555 0.241 -1.583 3.338 2.510 5.053 37.840 -3.046 -0.055 3.117 7.740 -3.844 38.243 13 AA_C18U19:G110G111_AA A 18 ? A 111 ? A 19 ? A 110 ? 1 A U 19 1_555 A G 110 1_555 A A 20 1_555 A U 109 1_555 0.271 -2.115 3.419 4.747 8.119 24.802 -6.663 0.606 2.613 18.093 -10.578 26.499 14 AA_U19A20:U109G110_AA A 19 ? A 110 ? A 20 ? A 109 ? 1 A A 20 1_555 A U 109 1_555 A U 21 1_555 A A 108 1_555 0.195 -1.627 3.164 0.771 5.660 31.027 -3.967 -0.227 2.834 10.468 -1.427 31.536 15 AA_A20U21:A108U109_AA A 20 ? A 109 ? A 21 ? A 108 ? 1 A U 21 1_555 A A 108 1_555 A C 22 1_555 A G 107 1_555 0.339 -1.670 3.228 0.274 8.048 32.539 -4.128 -0.547 2.751 14.095 -0.479 33.495 16 AA_U21C22:G107A108_AA A 21 ? A 108 ? A 22 ? A 107 ? 1 A C 22 1_555 A G 107 1_555 A U 23 1_555 A A 106 1_555 0.154 -1.756 3.350 1.612 7.033 30.505 -4.534 0.008 2.887 13.136 -3.011 31.327 17 AA_C22U23:A106G107_AA A 22 ? A 107 ? A 23 ? A 106 ? 1 A U 23 1_555 A A 106 1_555 A G 24 1_555 A C 105 1_555 0.306 -1.683 3.359 0.316 10.283 31.744 -4.560 -0.483 2.700 18.211 -0.559 33.329 18 AA_U23G24:C105A106_AA A 23 ? A 106 ? A 24 ? A 105 ? 1 A G 24 1_555 A C 105 1_555 A A 95 1_555 A U 104 1_555 1.285 -2.086 3.320 14.501 20.428 36.029 -4.650 -0.419 2.231 29.106 -20.661 43.644 19 AA_G24A95:U104C105_AA A 24 ? A 105 ? A 95 ? A 104 ? 1 A A 95 1_555 A U 104 1_555 A C 96 1_555 A G 103 1_555 -0.002 -1.791 3.235 -0.431 5.935 33.557 -3.947 -0.061 2.886 10.180 0.739 34.065 20 AA_A95C96:G103U104_AA A 95 ? A 104 ? A 96 ? A 103 ? 1 A C 96 1_555 A G 103 1_555 A C 97 1_555 A G 102 1_555 0.149 -1.823 3.259 1.239 6.347 31.505 -4.364 -0.059 2.851 11.538 -2.253 32.145 21 AA_C96C97:G102G103_AA A 96 ? A 103 ? A 97 ? A 102 ? 1 A C 97 1_555 A G 102 1_555 A G 98 1_555 A A 101 1_555 -1.930 -0.896 2.655 -2.708 7.154 58.456 -1.209 1.849 2.618 7.292 2.760 58.910 22 AA_C97G98:A101G102_AA A 97 ? A 102 ? A 98 ? A 101 ? 1 A G 46 1_555 A U 43 1_555 A U 47 1_555 A U 42 1_555 -0.586 -0.984 2.737 -4.380 6.633 46.146 -1.695 0.438 2.621 8.388 5.540 46.789 23 AA_G46U47:U42U43_AA A 46 ? A 43 ? A 47 ? A 42 ? 1 A U 47 1_555 A U 42 1_555 A C 48 1_555 A G 41 1_555 1.530 -1.716 2.898 3.942 7.791 22.426 -6.224 -2.608 2.404 19.126 -9.677 24.045 24 AA_U47C48:G41U42_AA A 47 ? A 42 ? A 48 ? A 41 ? 1 A C 48 1_555 A G 41 1_555 A C 49 1_555 A G 40 1_555 -0.237 -1.661 3.284 0.228 7.222 32.084 -4.110 0.456 2.851 12.864 -0.406 32.866 25 AA_C48C49:G40G41_AA A 48 ? A 41 ? A 49 ? A 40 ? 1 A C 49 1_555 A G 40 1_555 A G 50 1_555 A C 39 1_555 -0.137 -1.703 3.359 -1.222 8.914 30.377 -4.697 0.035 2.763 16.560 2.270 31.651 26 AA_C49G50:C39G40_AA A 49 ? A 40 ? A 50 ? A 39 ? 1 A G 50 1_555 A C 39 1_555 A U 51 1_555 A A 38 1_555 -0.225 -1.651 3.123 0.136 5.276 31.978 -3.808 0.426 2.821 9.495 -0.245 32.399 27 AA_G50U51:A38C39_AA A 50 ? A 39 ? A 51 ? A 38 ? 1 A U 51 1_555 A A 38 1_555 A G 52 1_555 A U 37 1_555 -0.033 -2.155 3.418 -5.039 9.117 25.596 -6.598 -1.081 2.480 19.578 10.820 27.601 28 AA_U51G52:U37A38_AA A 51 ? A 38 ? A 52 ? A 37 ? 1 A G 52 1_555 A U 37 1_555 A G 55 1_555 A C 35 1_555 -1.110 -3.394 3.501 2.057 -1.543 76.056 -2.705 0.966 3.532 -1.252 -1.669 76.093 29 AA_G52G55:C35U37_AA A 52 ? A 37 ? A 55 ? A 35 ? 1 A G 55 1_555 A C 35 1_555 A C 56 1_555 A G 34 1_555 -0.260 -1.618 3.104 0.084 4.702 33.196 -3.514 0.464 2.854 8.178 -0.147 33.518 30 AA_G55C56:G34C35_AA A 55 ? A 35 ? A 56 ? A 34 ? 1 A C 56 1_555 A G 34 1_555 A A 57 1_555 A U 33 1_555 -0.303 -1.668 3.346 -0.332 10.000 31.777 -4.497 0.476 2.714 17.723 0.588 33.276 31 AA_C56A57:U33G34_AA A 56 ? A 34 ? A 57 ? A 33 ? 1 A A 57 1_555 A U 33 1_555 A G 58 1_555 A C 32 1_555 -0.122 -1.770 3.365 -1.663 7.017 30.647 -4.537 -0.078 2.901 13.049 3.093 31.464 32 AA_A57G58:C32U33_AA A 57 ? A 33 ? A 58 ? A 32 ? 1 A G 58 1_555 A C 32 1_555 A C 59 1_555 A G 31 1_555 -0.180 -1.633 3.060 0.279 4.295 33.258 -3.469 0.354 2.831 7.464 -0.485 33.528 33 AA_G58C59:G31C32_AA A 58 ? A 32 ? A 59 ? A 31 ? 1 A C 59 1_555 A G 31 1_555 A C 60 1_555 A G 30 1_555 0.001 -1.796 3.288 -0.056 6.334 32.443 -4.182 -0.010 2.895 11.204 0.099 33.039 34 AA_C59C60:G30G31_AA A 59 ? A 31 ? A 60 ? A 30 ? 1 A C 60 1_555 A G 30 1_555 A U 66 1_555 A A 29 1_555 -4.123 0.518 3.394 13.685 3.764 72.378 0.319 3.855 2.708 3.157 -11.480 73.569 35 AA_C60U66:A29G30_AA A 60 ? A 30 ? A 66 ? A 29 ? 1 A U 66 1_555 A A 29 1_555 A C 67 1_555 A G 27 1_555 0.629 -3.524 4.305 -1.836 15.514 33.497 -7.857 -1.264 2.452 25.281 2.992 36.866 36 AA_U66C67:G27A29_AA A 66 ? A 29 ? A 67 ? A 27 ? 1 A C 67 1_555 A G 27 1_555 A A 68 1_555 A U 26 1_555 -0.133 -1.673 3.350 -0.580 8.829 31.653 -4.409 0.141 2.797 15.804 1.037 32.836 37 AA_C67A68:U26G27_AA A 67 ? A 27 ? A 68 ? A 26 ? 1 A A 68 1_555 A U 26 1_555 A G 69 1_555 A C 25 1_555 -0.074 -1.903 3.372 -1.818 6.874 31.709 -4.574 -0.178 2.906 12.387 3.275 32.477 38 AA_A68G69:C25U26_AA A 68 ? A 26 ? A 69 ? A 25 ? 1 A G 69 1_555 A C 25 1_555 A A 70 1_555 A U 94 1_555 1.050 -1.306 3.292 -1.586 8.314 40.812 -2.684 -1.639 2.941 11.770 2.246 41.644 39 AA_G69A70:U94C25_AA A 69 ? A 25 ? A 70 ? A 94 ? 1 A A 70 1_555 A U 94 1_555 A A 71 1_555 A U 93 1_555 -0.127 -1.801 3.311 -0.409 8.115 32.648 -4.372 0.157 2.797 14.163 0.713 33.617 40 AA_A70A71:U93U94_AA A 70 ? A 94 ? A 71 ? A 93 ? 1 A A 71 1_555 A U 93 1_555 A C 72 1_555 A G 92 1_555 0.190 -1.732 3.201 -0.058 5.690 32.696 -3.926 -0.342 2.867 10.013 0.102 33.174 41 AA_A71C72:G92U93_AA A 71 ? A 93 ? A 72 ? A 92 ? 1 A C 72 1_555 A G 92 1_555 A A 73 1_555 A U 91 1_555 -0.031 -1.752 3.370 1.255 8.534 31.041 -4.624 0.272 2.799 15.572 -2.290 32.189 42 AA_C72A73:U91G92_AA A 72 ? A 92 ? A 73 ? A 91 ? 1 A A 73 1_555 A U 91 1_555 A U 74 1_555 A G 90 1_555 0.392 -1.522 3.327 1.044 6.130 39.295 -2.938 -0.457 3.074 9.046 -1.540 39.765 43 AA_A73U74:G90U91_AA A 73 ? A 91 ? A 74 ? A 90 ? 1 A U 74 1_555 A G 90 1_555 A C 75 1_555 A G 89 1_555 0.301 -2.085 3.152 4.318 7.764 26.186 -6.033 0.296 2.461 16.542 -9.201 27.627 44 AA_U74C75:G89G90_AA A 74 ? A 90 ? A 75 ? A 89 ? 1 A C 75 1_555 A G 89 1_555 A U 76 1_555 A G 88 1_555 0.224 -1.545 3.378 2.583 5.567 37.430 -3.092 -0.014 3.133 8.605 -3.992 37.912 45 AA_C75U76:G88G89_AA A 75 ? A 89 ? A 76 ? A 88 ? 1 A U 76 1_555 A G 88 1_555 A G 78 1_555 A C 87 1_555 -2.494 -0.964 2.936 1.591 11.314 46.075 -1.981 3.213 2.563 14.200 -1.997 47.396 46 AA_U76G78:C87G88_AA A 76 ? A 88 ? A 78 ? A 87 ? 1 A G 78 1_555 A C 87 1_555 A G 79 1_555 A C 86 1_555 -0.001 -1.796 3.287 0.044 6.339 32.458 -4.179 0.010 2.894 11.207 -0.078 33.055 47 AA_G78G79:C86C87_AA A 78 ? A 87 ? A 79 ? A 86 ? # _pdbx_audit_support.funding_organization 'National Science Foundation (NSF, United States)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number 2330652 _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9YX9 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C H N O P # loop_ #