data_9DE8 # _entry.id 9DE8 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.402 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9DE8 pdb_00009de8 10.2210/pdb9de8/pdb WWPDB D_1000287924 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-03-12 ? 2 'Structure model' 1 1 2025-03-19 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # _pdbx_audit_revision_category.ordinal 1 _pdbx_audit_revision_category.revision_ordinal 2 _pdbx_audit_revision_category.data_content_type 'Structure model' _pdbx_audit_revision_category.category citation # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.page_last' 2 2 'Structure model' '_citation.pdbx_database_id_PubMed' 3 2 'Structure model' '_citation.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9DE8 _pdbx_database_status.recvd_initial_deposition_date 2024-08-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email jinwei.zhang@nih.gov _pdbx_contact_author.name_first Jinwei _pdbx_contact_author.name_last Zhang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-2114-173X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Bou-Nader, C.' 1 0000-0003-0955-0204 'Zhang, J.' 2 0000-0002-2114-173X # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nat Commun' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 2041-1723 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 16 _citation.language ? _citation.page_first 2252 _citation.page_last 2252 _citation.title 'Structures of complete HIV-1 TAR RNA portray a dynamic platform poised for protein binding and structural remodeling.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1038/s41467-025-57519-w _citation.pdbx_database_id_PubMed 40050622 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Bou-Nader, C.' 1 ? primary 'Link, K.A.' 2 ? primary 'Suddala, K.C.' 3 ? primary 'Knutson, J.R.' 4 ? primary 'Zhang, J.' 5 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (56-MER)' 18299.889 1 ? 'G16A, A17G, U31G, G32A' ? ? 2 non-polymer syn 'CALCIUM ION' 40.078 1 ? ? ? ? 3 water nat water 18.015 7 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGUCUCUCUGGUUAAGCCAGAUCUGAGCCGAAAAGCUCUCUGGCUAACUAGGGAACC _entity_poly.pdbx_seq_one_letter_code_can GGUCUCUCUGGUUAAGCCAGAUCUGAGCCGAAAAGCUCUCUGGCUAACUAGGGAACC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'CALCIUM ION' CA 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 U n 1 4 C n 1 5 U n 1 6 C n 1 7 U n 1 8 C n 1 9 U n 1 10 G n 1 11 G n 1 12 U n 1 13 U n 1 14 A n 1 15 A n 1 16 G n 1 17 C n 1 18 C n 1 19 A n 1 20 G n 1 21 A n 1 22 U n 1 23 C n 1 24 U n 1 25 G n 1 26 A n 1 27 G n 1 28 C n 1 29 C n 1 30 G n 1 31 A n 1 32 A n 1 33 A n 1 34 A n 1 35 G n 1 36 C n 1 37 U n 1 38 C n 1 39 U n 1 40 C n 1 41 U n 1 42 G n 1 43 G n 1 44 C n 1 45 U n 1 46 A n 1 47 A n 1 48 C n 1 49 U n 1 50 A n 1 51 G n 1 52 G n 1 53 G n 1 54 A n 1 55 A n 1 56 C n 1 57 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 57 _pdbx_entity_src_syn.organism_scientific 'Human immunodeficiency virus 1' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 11676 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CA non-polymer . 'CALCIUM ION' ? 'Ca 2' 40.078 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 2 2 G G A . n A 1 2 G 2 3 3 G G A . n A 1 3 U 3 4 4 U U A . n A 1 4 C 4 5 5 C C A . n A 1 5 U 5 6 6 U U A . n A 1 6 C 6 7 7 C C A . n A 1 7 U 7 8 8 U U A . n A 1 8 C 8 9 9 C C A . n A 1 9 U 9 10 10 U U A . n A 1 10 G 10 11 11 G G A . n A 1 11 G 11 12 12 G G A . n A 1 12 U 12 13 13 U U A . n A 1 13 U 13 14 14 U U A . n A 1 14 A 14 15 15 A A A . n A 1 15 A 15 16 16 A A A . n A 1 16 G 16 17 17 G G A . n A 1 17 C 17 18 18 C C A . n A 1 18 C 18 19 19 C C A . n A 1 19 A 19 20 20 A A A . n A 1 20 G 20 21 21 G G A . n A 1 21 A 21 22 22 A A A . n A 1 22 U 22 23 23 U U A . n A 1 23 C 23 24 24 C C A . n A 1 24 U 24 25 25 U U A . n A 1 25 G 25 26 26 G G A . n A 1 26 A 26 27 27 A A A . n A 1 27 G 27 28 28 G G A . n A 1 28 C 28 29 29 C C A . n A 1 29 C 29 30 30 C C A . n A 1 30 G 30 31 31 G G A . n A 1 31 A 31 32 32 A A A . n A 1 32 A 32 33 33 A A A . n A 1 33 A 33 34 34 A A A . n A 1 34 A 34 35 35 A A A . n A 1 35 G 35 36 36 G G A . n A 1 36 C 36 37 37 C C A . n A 1 37 U 37 38 38 U U A . n A 1 38 C 38 39 39 C C A . n A 1 39 U 39 40 40 U U A . n A 1 40 C 40 41 41 C C A . n A 1 41 U 41 42 42 U U A . n A 1 42 G 42 43 43 G G A . n A 1 43 G 43 44 44 G G A . n A 1 44 C 44 45 45 C C A . n A 1 45 U 45 46 46 U U A . n A 1 46 A 46 47 47 A A A . n A 1 47 A 47 48 48 A A A . n A 1 48 C 48 49 49 C C A . n A 1 49 U 49 50 50 U U A . n A 1 50 A 50 51 51 A A A . n A 1 51 G 51 52 52 G G A . n A 1 52 G 52 53 53 G G A . n A 1 53 G 53 54 54 G G A . n A 1 54 A 54 55 55 A A A . n A 1 55 A 55 56 56 A A A . n A 1 56 C 56 57 57 C C A . n A 1 57 C 57 58 ? ? ? A . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 CA 1 101 2 CA CA A . C 3 HOH 1 201 1 HOH HOH A . C 3 HOH 2 202 2 HOH HOH A . C 3 HOH 3 203 4 HOH HOH A . C 3 HOH 4 204 7 HOH HOH A . C 3 HOH 5 205 5 HOH HOH A . C 3 HOH 6 206 3 HOH HOH A . C 3 HOH 7 207 6 HOH HOH A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A G 2 ? N9 ? A G 1 N9 2 1 Y 1 A G 2 ? C8 ? A G 1 C8 3 1 Y 1 A G 2 ? N7 ? A G 1 N7 4 1 Y 1 A G 2 ? C5 ? A G 1 C5 5 1 Y 1 A G 2 ? C6 ? A G 1 C6 6 1 Y 1 A G 2 ? O6 ? A G 1 O6 7 1 Y 1 A G 2 ? N1 ? A G 1 N1 8 1 Y 1 A G 2 ? C2 ? A G 1 C2 9 1 Y 1 A G 2 ? N2 ? A G 1 N2 10 1 Y 1 A G 2 ? N3 ? A G 1 N3 11 1 Y 1 A G 2 ? C4 ? A G 1 C4 12 1 Y 1 A C 5 ? N1 ? A C 4 N1 13 1 Y 1 A C 5 ? C2 ? A C 4 C2 14 1 Y 1 A C 5 ? O2 ? A C 4 O2 15 1 Y 1 A C 5 ? N3 ? A C 4 N3 16 1 Y 1 A C 5 ? C4 ? A C 4 C4 17 1 Y 1 A C 5 ? N4 ? A C 4 N4 18 1 Y 1 A C 5 ? C5 ? A C 4 C5 19 1 Y 1 A C 5 ? C6 ? A C 4 C6 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.21.1_5286 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? 3.27 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 90.000 _cell.angle_gamma_esd ? _cell.entry_id 9DE8 _cell.details ? _cell.formula_units_Z ? _cell.length_a 31.588 _cell.length_a_esd ? _cell.length_b 47.266 _cell.length_b_esd ? _cell.length_c 132.729 _cell.length_c_esd ? _cell.volume 198167.610 _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9DE8 _symmetry.cell_setting ? _symmetry.Int_Tables_number 18 _symmetry.space_group_name_Hall 'P 2 2ab (y,z,x)' _symmetry.space_group_name_H-M 'P 21 2 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9DE8 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.71 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 54.57 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 6.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;50 mM sodium cacodylate pH 6.5, 80 mM NaCl, 12 mM spermine and 30% v/v 2-methyl-2,4-pentanediol (MPD). Soaking with 100 mM CaCl2 for 2 hours at 20 degrees Celsius ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2022-03-18 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'APS BEAMLINE 22-ID' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline 22-ID _diffrn_source.pdbx_synchrotron_site APS # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9DE8 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.76 _reflns.d_resolution_low 44.53 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5512 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.17 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 42.8 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 13.82 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.761 _reflns_shell.d_res_low 2.86 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs 1.62 _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 529 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.669 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 67.04 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details 'A separate dataset of lower quality, which was not deposited, was used for SAD phasing.' _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9DE8 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.76 _refine.ls_d_res_low 44.53 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5497 _refine.ls_number_reflns_R_free 266 _refine.ls_number_reflns_R_work 5231 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.21 _refine.ls_percent_reflns_R_free 4.84 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2477 _refine.ls_R_factor_R_free 0.2951 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2455 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.35 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct SAD _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 23.8864 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2966 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.76 _refine_hist.d_res_low 44.53 _refine_hist.number_atoms_solvent 7 _refine_hist.number_atoms_total 1182 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1174 _refine_hist.pdbx_number_atoms_ligand 1 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0017 ? 1311 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 0.4240 ? 2040 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.0190 ? 278 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.0025 ? 54 ? f_plane_restr ? ? 'X-RAY DIFFRACTION' ? 21.5495 ? 807 ? f_dihedral_angle_d ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.76 3.48 . . 119 2545 98.85 . . . . 0.3320 . . . . . . . . . . . 0.4073 'X-RAY DIFFRACTION' 3.48 44.53 . . 147 2686 99.54 . . . . 0.2165 . . . . . . . . . . . 0.2620 # _struct.entry_id 9DE8 _struct.title 'Structure of full-length HIV TAR RNA soaked in CaCl2' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9DE8 _struct_keywords.text 'viral RNA, HIV RNA, TAR RNA, Ca2+, Calcium, bulge, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name GB _struct_ref.db_code MW061005.1 _struct_ref.pdbx_db_accession 1945658931 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGAAAGCUCUCUGGCUAACUAGGGAACC _struct_ref.pdbx_align_begin 5187 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9DE8 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 1945658931 _struct_ref_seq.db_align_beg 5187 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 5243 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2 _struct_ref_seq.pdbx_auth_seq_align_end 58 # loop_ _struct_ref_seq_dif.align_id _struct_ref_seq_dif.pdbx_pdb_id_code _struct_ref_seq_dif.mon_id _struct_ref_seq_dif.pdbx_pdb_strand_id _struct_ref_seq_dif.seq_num _struct_ref_seq_dif.pdbx_pdb_ins_code _struct_ref_seq_dif.pdbx_seq_db_name _struct_ref_seq_dif.pdbx_seq_db_accession_code _struct_ref_seq_dif.db_mon_id _struct_ref_seq_dif.pdbx_seq_db_seq_num _struct_ref_seq_dif.details _struct_ref_seq_dif.pdbx_auth_seq_num _struct_ref_seq_dif.pdbx_ordinal 1 9DE8 A A 15 ? GB 1945658931 G 5201 'engineered mutation' 16 1 1 9DE8 G A 16 ? GB 1945658931 A 5202 'engineered mutation' 17 2 1 9DE8 G A 30 ? GB 1945658931 U 5216 'engineered mutation' 31 3 1 9DE8 A A 31 ? GB 1945658931 G 5217 'engineered mutation' 32 4 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'native gel electrophoresis' _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 22 OP1 ? ? ? 1_555 B CA . CA ? ? A U 23 A CA 101 1_555 ? ? ? ? ? ? ? 2.400 ? ? metalc2 metalc ? ? A C 23 OP2 ? ? ? 1_555 B CA . CA ? ? A C 24 A CA 101 1_555 ? ? ? ? ? ? ? 2.359 ? ? metalc3 metalc ? ? A U 24 "O3'" ? ? ? 1_555 B CA . CA ? ? A U 25 A CA 101 1_555 ? ? ? ? ? ? ? 3.145 ? ? metalc4 metalc ? ? A G 25 OP1 ? ? ? 1_555 B CA . CA ? ? A G 26 A CA 101 1_555 ? ? ? ? ? ? ? 2.649 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? A G 3 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? A G 3 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? A G 3 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A U 3 N3 ? ? ? 1_555 A A 55 N1 ? ? A U 4 A A 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A U 3 O4 ? ? ? 1_555 A A 55 N6 ? ? A U 4 A A 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 54 N1 ? ? A U 6 A A 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 54 N6 ? ? A U 6 A A 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 53 N1 ? ? A C 7 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 53 O6 ? ? A C 7 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 53 N2 ? ? A C 7 A G 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 7 N3 ? ? ? 1_555 A G 52 O6 ? ? A U 8 A G 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog12 hydrog ? ? A U 7 O2 ? ? ? 1_555 A G 52 N1 ? ? A U 8 A G 53 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog13 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 51 N1 ? ? A C 9 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 51 O6 ? ? A C 9 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 51 N2 ? ? A C 9 A G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 50 N1 ? ? A U 10 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 50 N6 ? ? A U 10 A A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A G 10 N1 ? ? ? 1_555 A U 49 O2 ? ? A G 11 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog19 hydrog ? ? A G 10 O6 ? ? ? 1_555 A U 49 N3 ? ? A G 11 A U 50 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog20 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 12 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 12 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 12 A C 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A U 12 N3 ? ? ? 1_555 A A 47 N1 ? ? A U 13 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 12 O4 ? ? ? 1_555 A A 47 N6 ? ? A U 13 A A 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A U 13 N3 ? ? ? 1_555 A A 46 N1 ? ? A U 14 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A U 13 O4 ? ? ? 1_555 A A 46 N6 ? ? A U 14 A A 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A A 14 N1 ? ? ? 1_555 A U 45 N3 ? ? A A 15 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A A 14 N6 ? ? ? 1_555 A U 45 O4 ? ? A A 15 A U 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 16 N1 ? ? ? 1_555 A C 44 N3 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 16 N2 ? ? ? 1_555 A C 44 O2 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 16 O6 ? ? ? 1_555 A C 44 N4 ? ? A G 17 A C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 17 N3 ? ? ? 1_555 A G 43 N1 ? ? A C 18 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 17 N4 ? ? ? 1_555 A G 43 O6 ? ? A C 18 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 17 O2 ? ? ? 1_555 A G 43 N2 ? ? A C 18 A G 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 18 N3 ? ? ? 1_555 A G 42 N1 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A C 18 N4 ? ? ? 1_555 A G 42 O6 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A C 18 O2 ? ? ? 1_555 A G 42 N2 ? ? A C 19 A G 43 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A A 19 N1 ? ? ? 1_555 A U 41 N3 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A A 19 N6 ? ? ? 1_555 A U 41 O4 ? ? A A 20 A U 42 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 20 N1 ? ? ? 1_555 A C 40 N3 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 20 N2 ? ? ? 1_555 A C 40 O2 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 20 O6 ? ? ? 1_555 A C 40 N4 ? ? A G 21 A C 41 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A A 21 N1 ? ? ? 1_555 A U 39 N3 ? ? A A 22 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A A 21 N6 ? ? ? 1_555 A U 39 O4 ? ? A A 22 A U 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 38 N3 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 38 O2 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 38 N4 ? ? A G 26 A C 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 26 N1 ? ? ? 1_555 A U 37 N3 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A A 26 N6 ? ? ? 1_555 A U 37 O4 ? ? A A 27 A U 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 36 N3 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 36 O2 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 36 N4 ? ? A G 28 A C 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A C 28 N3 ? ? ? 1_555 A G 35 N1 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 28 N4 ? ? ? 1_555 A G 35 O6 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 28 O2 ? ? ? 1_555 A G 35 N2 ? ? A C 29 A G 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 29 O2 ? ? ? 1_555 A A 34 N6 ? ? A C 30 A A 35 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog57 hydrog ? ? A G 30 N2 ? ? ? 1_555 A A 33 N7 ? ? A G 31 A A 34 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A U 22 ? A U 23 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 OP2 ? A C 23 ? A C 24 ? 1_555 77.3 ? 2 OP1 ? A U 22 ? A U 23 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 "O3'" ? A U 24 ? A U 25 ? 1_555 130.4 ? 3 OP2 ? A C 23 ? A C 24 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 "O3'" ? A U 24 ? A U 25 ? 1_555 80.4 ? 4 OP1 ? A U 22 ? A U 23 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 OP1 ? A G 25 ? A G 26 ? 1_555 85.8 ? 5 OP2 ? A C 23 ? A C 24 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 OP1 ? A G 25 ? A G 26 ? 1_555 90.2 ? 6 "O3'" ? A U 24 ? A U 25 ? 1_555 CA ? B CA . ? A CA 101 ? 1_555 OP1 ? A G 25 ? A G 26 ? 1_555 50.4 ? # _pdbx_entry_details.entry_id 9DE8 _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # _pdbx_unobs_or_zero_occ_residues.id 1 _pdbx_unobs_or_zero_occ_residues.PDB_model_num 1 _pdbx_unobs_or_zero_occ_residues.polymer_flag Y _pdbx_unobs_or_zero_occ_residues.occupancy_flag 1 _pdbx_unobs_or_zero_occ_residues.auth_asym_id A _pdbx_unobs_or_zero_occ_residues.auth_comp_id C _pdbx_unobs_or_zero_occ_residues.auth_seq_id 58 _pdbx_unobs_or_zero_occ_residues.PDB_ins_code ? _pdbx_unobs_or_zero_occ_residues.label_asym_id A _pdbx_unobs_or_zero_occ_residues.label_comp_id C _pdbx_unobs_or_zero_occ_residues.label_seq_id 57 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CA CA CA N N 73 G OP3 O N N 74 G P P N N 75 G OP1 O N N 76 G OP2 O N N 77 G "O5'" O N N 78 G "C5'" C N N 79 G "C4'" C N R 80 G "O4'" O N N 81 G "C3'" C N S 82 G "O3'" O N N 83 G "C2'" C N R 84 G "O2'" O N N 85 G "C1'" C N R 86 G N9 N Y N 87 G C8 C Y N 88 G N7 N Y N 89 G C5 C Y N 90 G C6 C N N 91 G O6 O N N 92 G N1 N N N 93 G C2 C N N 94 G N2 N N N 95 G N3 N N N 96 G C4 C Y N 97 G HOP3 H N N 98 G HOP2 H N N 99 G "H5'" H N N 100 G "H5''" H N N 101 G "H4'" H N N 102 G "H3'" H N N 103 G "HO3'" H N N 104 G "H2'" H N N 105 G "HO2'" H N N 106 G "H1'" H N N 107 G H8 H N N 108 G H1 H N N 109 G H21 H N N 110 G H22 H N N 111 HOH O O N N 112 HOH H1 H N N 113 HOH H2 H N N 114 U OP3 O N N 115 U P P N N 116 U OP1 O N N 117 U OP2 O N N 118 U "O5'" O N N 119 U "C5'" C N N 120 U "C4'" C N R 121 U "O4'" O N N 122 U "C3'" C N S 123 U "O3'" O N N 124 U "C2'" C N R 125 U "O2'" O N N 126 U "C1'" C N R 127 U N1 N N N 128 U C2 C N N 129 U O2 O N N 130 U N3 N N N 131 U C4 C N N 132 U O4 O N N 133 U C5 C N N 134 U C6 C N N 135 U HOP3 H N N 136 U HOP2 H N N 137 U "H5'" H N N 138 U "H5''" H N N 139 U "H4'" H N N 140 U "H3'" H N N 141 U "HO3'" H N N 142 U "H2'" H N N 143 U "HO2'" H N N 144 U "H1'" H N N 145 U H3 H N N 146 U H5 H N N 147 U H6 H N N 148 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 U OP3 P sing N N 118 U OP3 HOP3 sing N N 119 U P OP1 doub N N 120 U P OP2 sing N N 121 U P "O5'" sing N N 122 U OP2 HOP2 sing N N 123 U "O5'" "C5'" sing N N 124 U "C5'" "C4'" sing N N 125 U "C5'" "H5'" sing N N 126 U "C5'" "H5''" sing N N 127 U "C4'" "O4'" sing N N 128 U "C4'" "C3'" sing N N 129 U "C4'" "H4'" sing N N 130 U "O4'" "C1'" sing N N 131 U "C3'" "O3'" sing N N 132 U "C3'" "C2'" sing N N 133 U "C3'" "H3'" sing N N 134 U "O3'" "HO3'" sing N N 135 U "C2'" "O2'" sing N N 136 U "C2'" "C1'" sing N N 137 U "C2'" "H2'" sing N N 138 U "O2'" "HO2'" sing N N 139 U "C1'" N1 sing N N 140 U "C1'" "H1'" sing N N 141 U N1 C2 sing N N 142 U N1 C6 sing N N 143 U C2 O2 doub N N 144 U C2 N3 sing N N 145 U N3 C4 sing N N 146 U N3 H3 sing N N 147 U C4 O4 doub N N 148 U C4 C5 sing N N 149 U C5 C6 doub N N 150 U C5 H5 sing N N 151 U C6 H6 sing N N 152 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9DE8 'double helix' 9DE8 'a-form double helix' 9DE8 tetraloop 9DE8 'bulge loop' 9DE8 'mismatched base pair' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 56 1_555 0.428 -0.309 -0.082 -17.560 -21.399 -2.493 1 A_G3:C57_A A 3 ? A 57 ? 19 1 1 A U 3 1_555 A A 55 1_555 0.598 0.115 0.426 -16.227 -14.699 -4.956 2 A_U4:A56_A A 4 ? A 56 ? 20 1 1 A U 5 1_555 A A 54 1_555 1.155 -0.019 -0.151 1.066 -1.913 0.195 3 A_U6:A55_A A 6 ? A 55 ? 20 1 1 A C 6 1_555 A G 53 1_555 0.723 -0.313 -0.729 -2.467 -7.924 -16.994 4 A_C7:G54_A A 7 ? A 54 ? 19 1 1 A U 7 1_555 A G 52 1_555 1.727 -0.557 -0.186 0.401 -7.663 -2.581 5 A_U8:G53_A A 8 ? A 53 ? 28 1 1 A C 8 1_555 A G 51 1_555 0.147 -0.138 0.039 1.299 -17.631 -0.137 6 A_C9:G52_A A 9 ? A 52 ? 19 1 1 A U 9 1_555 A A 50 1_555 -0.281 0.048 0.179 -1.211 -11.083 2.505 7 A_U10:A51_A A 10 ? A 51 ? 20 1 1 A G 10 1_555 A U 49 1_555 -2.264 -0.400 0.116 4.992 -9.475 3.658 8 A_G11:U50_A A 11 ? A 50 ? 28 1 1 A G 11 1_555 A C 48 1_555 -0.147 -0.051 -0.112 -3.156 -17.001 1.329 9 A_G12:C49_A A 12 ? A 49 ? 19 1 1 A U 12 1_555 A A 47 1_555 0.114 -0.035 0.228 -11.701 -14.580 -2.023 10 A_U13:A48_A A 13 ? A 48 ? 20 1 1 A U 13 1_555 A A 46 1_555 0.204 -0.132 0.235 -2.179 -7.678 -1.424 11 A_U14:A47_A A 14 ? A 47 ? 20 1 1 A A 14 1_555 A U 45 1_555 0.194 -0.024 -0.243 -0.751 -18.224 4.359 12 A_A15:U46_A A 15 ? A 46 ? 20 1 1 A G 16 1_555 A C 44 1_555 -0.243 -0.337 -0.511 -5.429 -5.365 4.163 13 A_G17:C45_A A 17 ? A 45 ? 19 1 1 A C 17 1_555 A G 43 1_555 -0.004 -0.072 -0.250 -1.405 2.007 3.448 14 A_C18:G44_A A 18 ? A 44 ? 19 1 1 A C 18 1_555 A G 42 1_555 0.158 0.066 -0.178 -3.304 -7.093 3.561 15 A_C19:G43_A A 19 ? A 43 ? 19 1 1 A A 19 1_555 A U 41 1_555 0.040 -0.042 0.244 -5.530 -8.289 2.061 16 A_A20:U42_A A 20 ? A 42 ? 20 1 1 A G 20 1_555 A C 40 1_555 -0.100 -0.025 0.433 -7.073 -15.405 0.768 17 A_G21:C41_A A 21 ? A 41 ? 19 1 1 A A 21 1_555 A U 39 1_555 -0.107 0.061 0.091 -12.914 -21.471 -2.401 18 A_A22:U40_A A 22 ? A 40 ? 20 1 1 A G 25 1_555 A C 38 1_555 -0.390 -0.235 -0.399 -4.219 -1.717 -0.037 19 A_G26:C39_A A 26 ? A 39 ? 19 1 1 A A 26 1_555 A U 37 1_555 -0.015 0.043 -0.118 -2.113 -6.437 3.937 20 A_A27:U38_A A 27 ? A 38 ? 20 1 1 A G 27 1_555 A C 36 1_555 -0.234 -0.016 -0.483 -10.314 -10.794 0.655 21 A_G28:C37_A A 28 ? A 37 ? 19 1 1 A C 28 1_555 A G 35 1_555 0.513 -0.010 -0.026 -10.997 0.231 1.078 22 A_C29:G36_A A 29 ? A 36 ? 19 1 1 A C 29 1_555 A A 34 1_555 5.243 -0.801 0.232 -9.566 15.671 -5.273 23 A_C30:A35_A A 30 ? A 35 ? ? ? 1 A G 30 1_555 A A 33 1_555 6.875 -5.240 0.605 18.748 20.542 -10.121 24 A_G31:A34_A A 31 ? A 34 ? ? 10 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 56 1_555 A U 3 1_555 A A 55 1_555 -0.054 -1.095 3.149 -1.110 8.912 34.495 -2.986 -0.062 2.790 14.721 1.834 35.611 1 AA_G3U4:A56C57_AA A 3 ? A 57 ? A 4 ? A 56 ? 1 A U 3 1_555 A A 55 1_555 A U 5 1_555 A A 54 1_555 -2.343 -0.592 2.686 2.904 9.264 52.570 -1.121 2.752 2.434 10.359 -3.247 53.396 2 AA_U4U6:A55A56_AA A 4 ? A 56 ? A 6 ? A 55 ? 1 A U 5 1_555 A A 54 1_555 A C 6 1_555 A G 53 1_555 -0.983 -1.862 3.409 3.158 6.355 34.091 -4.060 2.115 2.925 10.695 -5.315 34.800 3 AA_U6C7:G54A55_AA A 6 ? A 55 ? A 7 ? A 54 ? 1 A C 6 1_555 A G 53 1_555 A U 7 1_555 A G 52 1_555 0.221 -1.565 3.230 -1.633 11.124 31.307 -4.429 -0.634 2.528 19.829 2.911 33.217 4 AA_C7U8:G53G54_AA A 7 ? A 54 ? A 8 ? A 53 ? 1 A U 7 1_555 A G 52 1_555 A C 8 1_555 A G 51 1_555 0.360 -1.951 3.006 1.044 9.924 29.626 -5.183 -0.506 2.261 18.750 -1.973 31.225 5 AA_U8C9:G52G53_AA A 8 ? A 53 ? A 9 ? A 52 ? 1 A C 8 1_555 A G 51 1_555 A U 9 1_555 A A 50 1_555 -0.616 -1.604 3.268 -4.029 9.176 27.619 -5.016 0.404 2.671 18.467 8.110 29.348 6 AA_C9U10:A51G52_AA A 9 ? A 52 ? A 10 ? A 51 ? 1 A U 9 1_555 A A 50 1_555 A G 10 1_555 A U 49 1_555 0.328 -1.638 2.894 -3.530 9.596 24.990 -5.445 -1.415 2.069 21.085 7.757 26.970 7 AA_U10G11:U50A51_AA A 10 ? A 51 ? A 11 ? A 50 ? 1 A G 10 1_555 A U 49 1_555 A G 11 1_555 A C 48 1_555 -0.348 -1.260 3.523 -1.533 12.154 40.096 -3.070 0.323 3.043 17.246 2.176 41.852 8 AA_G11G12:C49U50_AA A 11 ? A 50 ? A 12 ? A 49 ? 1 A G 11 1_555 A C 48 1_555 A U 12 1_555 A A 47 1_555 -0.463 -1.395 3.453 -2.930 14.199 34.531 -4.020 0.343 2.720 22.720 4.689 37.365 9 AA_G12U13:A48C49_AA A 12 ? A 49 ? A 13 ? A 48 ? 1 A U 12 1_555 A A 47 1_555 A U 13 1_555 A A 46 1_555 0.199 -1.162 2.957 0.126 6.820 32.784 -2.996 -0.328 2.669 11.923 -0.220 33.468 10 AA_U13U14:A47A48_AA A 13 ? A 48 ? A 14 ? A 47 ? 1 A U 13 1_555 A A 46 1_555 A A 14 1_555 A U 45 1_555 0.454 -1.323 3.193 4.592 10.832 30.452 -4.094 -0.074 2.621 19.722 -8.360 32.596 11 AA_U14A15:U46A47_AA A 14 ? A 47 ? A 15 ? A 46 ? 1 A A 14 1_555 A U 45 1_555 A G 16 1_555 A C 44 1_555 -1.657 -1.221 3.138 -6.080 16.163 41.206 -3.000 1.665 2.707 21.847 8.218 44.532 12 AA_A15G17:C45U46_AA A 15 ? A 46 ? A 17 ? A 45 ? 1 A G 16 1_555 A C 44 1_555 A C 17 1_555 A G 43 1_555 0.019 -1.994 3.159 -2.515 3.570 33.440 -3.980 -0.415 2.928 6.172 4.347 33.716 13 AA_G17C18:G44C45_AA A 17 ? A 45 ? A 18 ? A 44 ? 1 A C 17 1_555 A G 43 1_555 A C 18 1_555 A G 42 1_555 -0.102 -1.847 3.363 4.258 6.128 30.329 -4.564 0.977 2.902 11.494 -7.987 31.213 14 AA_C18C19:G43G44_AA A 18 ? A 44 ? A 19 ? A 43 ? 1 A C 18 1_555 A G 42 1_555 A A 19 1_555 A U 41 1_555 -0.041 -1.641 3.141 -3.196 11.518 29.473 -4.842 -0.436 2.343 21.556 5.981 31.755 15 AA_C19A20:U42G43_AA A 19 ? A 43 ? A 20 ? A 42 ? 1 A A 19 1_555 A U 41 1_555 A G 20 1_555 A C 40 1_555 -0.061 -1.545 3.253 -0.630 4.517 32.688 -3.459 0.004 3.019 7.978 1.113 32.996 16 AA_A20G21:C41U42_AA A 20 ? A 42 ? A 21 ? A 41 ? 1 A G 20 1_555 A C 40 1_555 A A 21 1_555 A U 39 1_555 -0.143 -1.413 3.414 2.959 6.207 34.291 -3.295 0.688 3.096 10.398 -4.957 34.954 17 AA_G21A22:U40C41_AA A 21 ? A 41 ? A 22 ? A 40 ? 1 A A 21 1_555 A U 39 1_555 A G 25 1_555 A C 38 1_555 -1.877 -1.722 3.107 5.427 18.341 47.567 -3.061 2.492 2.137 21.743 -6.433 51.061 18 AA_A22G26:C39U40_AA A 22 ? A 40 ? A 26 ? A 39 ? 1 A G 25 1_555 A C 38 1_555 A A 26 1_555 A U 37 1_555 -0.332 -1.511 3.402 -2.387 4.451 34.564 -3.202 0.187 3.204 7.441 3.990 34.920 19 AA_G26A27:U38C39_AA A 26 ? A 39 ? A 27 ? A 38 ? 1 A A 26 1_555 A U 37 1_555 A G 27 1_555 A C 36 1_555 0.897 -2.132 3.421 4.634 12.100 26.369 -6.643 -0.840 2.358 24.716 -9.466 29.330 20 AA_A27G28:C37U38_AA A 27 ? A 38 ? A 28 ? A 37 ? 1 A G 27 1_555 A C 36 1_555 A C 28 1_555 A G 35 1_555 -0.201 -1.885 3.420 -1.521 0.869 36.799 -3.106 0.104 3.381 1.375 2.408 36.839 21 AA_G28C29:G36C37_AA A 28 ? A 37 ? A 29 ? A 36 ? 1 A C 28 1_555 A G 35 1_555 A C 29 1_555 A A 34 1_555 -0.194 -1.342 3.299 4.986 8.767 47.512 -2.291 0.610 2.988 10.741 -6.109 48.510 22 AA_C29C30:A35G36_AA A 29 ? A 36 ? A 30 ? A 35 ? 1 A C 29 1_555 A A 34 1_555 A G 30 1_555 A A 33 1_555 -0.029 -0.933 2.643 3.019 8.429 34.266 -2.497 0.393 2.344 14.011 -5.019 35.383 23 AA_C30G31:A34A35_AA A 30 ? A 35 ? A 31 ? A 34 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Disease (NIH/NIDDK)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9DE8 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.031658 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.021157 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.007534 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C CA N O P # loop_ #