data_9I5S # _entry.id 9I5S # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.408 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9I5S pdb_00009i5s 10.2210/pdb9i5s/pdb WWPDB D_1292144989 ? ? BMRB 34978 ? 10.13018/BMR34978 # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-12-10 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr . _pdbx_database_status.entry_id 9I5S _pdbx_database_status.recvd_initial_deposition_date 2025-01-28 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBE _pdbx_database_status.process_site PDBE _pdbx_database_status.status_code_cs . _pdbx_database_status.status_code_nmr_data REL _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name BMRB _pdbx_database_related.details 'Human telomeric G-quadruplex' _pdbx_database_related.db_id 34978 _pdbx_database_related.content_type unspecified # _pdbx_contact_author.id 2 _pdbx_contact_author.email brahim.heddi@ens-paris-saclay.fr _pdbx_contact_author.name_first Brahim _pdbx_contact_author.name_last Heddi _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5535-6237 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Avendano Avila, C.' 1 0009-0005-9241-7763 'Heddi, B.' 2 0000-0002-5535-6237 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Chem.Commun.(Camb.)' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1364-548X _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 61 _citation.language ? _citation.page_first 17661 _citation.page_last 17664 _citation.title ;An antiparallel G-quadruplex structure with a 5'-end overhang forms predominantly at the human telomeric ds-ss DNA junction. ; _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/d5cc03633j _citation.pdbx_database_id_PubMed 41099088 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Avendano Avila, C.' 1 0009-0005-9241-7763 primary 'Heddi, B.' 2 0000-0002-5535-6237 # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'Human telomeric DNA G-quadruplex hteloS1[11]' _entity.formula_weight 7670.779 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code ;(DG)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(BGM)(DG)(DG)(DT)(DT)(DA)(DG)(DG)(DG) (DT)(DT)(DA)(DG)(DG) ; _entity_poly.pdbx_seq_one_letter_code_can GTTAGGGTTAGGGTTAGGGTTAGG _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DG n 1 2 DT n 1 3 DT n 1 4 DA n 1 5 DG n 1 6 DG n 1 7 DG n 1 8 DT n 1 9 DT n 1 10 DA n 1 11 BGM n 1 12 DG n 1 13 DG n 1 14 DT n 1 15 DT n 1 16 DA n 1 17 DG n 1 18 DG n 1 19 DG n 1 20 DT n 1 21 DT n 1 22 DA n 1 23 DG n 1 24 DG n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 24 _pdbx_entity_src_syn.organism_scientific 'Homo sapiens' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 9606 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight BGM 'DNA linking' n "8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H13 Br N5 O7 P' 426.117 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DG 1 1 1 DG DG A . n A 1 2 DT 2 2 2 DT DT A . n A 1 3 DT 3 3 3 DT DT A . n A 1 4 DA 4 4 4 DA DA A . n A 1 5 DG 5 5 5 DG DG A . n A 1 6 DG 6 6 6 DG DG A . n A 1 7 DG 7 7 7 DG DG A . n A 1 8 DT 8 8 8 DT DT A . n A 1 9 DT 9 9 9 DT DT A . n A 1 10 DA 10 10 10 DA DA A . n A 1 11 BGM 11 11 11 BGM BGM A . n A 1 12 DG 12 12 12 DG DG A . n A 1 13 DG 13 13 13 DG DG A . n A 1 14 DT 14 14 14 DT DT A . n A 1 15 DT 15 15 15 DT DT A . n A 1 16 DA 16 16 16 DA DA A . n A 1 17 DG 17 17 17 DG DG A . n A 1 18 DG 18 18 18 DG DG A . n A 1 19 DG 19 19 19 DG DG A . n A 1 20 DT 20 20 20 DT DT A . n A 1 21 DT 21 21 21 DT DT A . n A 1 22 DA 22 22 22 DA DA A . n A 1 23 DG 23 23 23 DG DG A . n A 1 24 DG 24 24 24 DG DG A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9I5S _exptl.crystals_number ? _exptl.details ? _exptl.method 'SOLUTION NMR' _exptl.method_details ? # _struct.entry_id 9I5S _struct.title ;Solution structure of an intramolecular anti-parallel G-quadruplex with a 5'-end overhang. ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9I5S _struct_keywords.text 'G-quadruplex, DNA, telomere' _struct_keywords.pdbx_keywords DNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9I5S _struct_ref.pdbx_db_accession 9I5S _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9I5S _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 24 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9I5S _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 24 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 24 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'NMR Distance Restraints' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A DA 10 "O3'" ? ? ? 1_555 A BGM 11 P ? ? A DA 10 A BGM 11 1_555 ? ? ? ? ? ? ? 1.607 ? ? covale2 covale both ? A BGM 11 "O3'" ? ? ? 1_555 A DG 12 P ? ? A BGM 11 A DG 12 1_555 ? ? ? ? ? ? ? 1.607 ? ? hydrog1 hydrog ? ? A DA 4 N1 ? ? ? 1_555 A DG 17 N2 ? ? A DA 4 A DG 17 1_555 ? ? ? ? ? ? 'DA-DG MISPAIR' ? ? ? hydrog2 hydrog ? ? A DG 5 N7 ? ? ? 1_555 A DG 12 N2 ? ? A DG 5 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog3 hydrog ? ? A DG 5 O6 ? ? ? 1_555 A DG 12 N1 ? ? A DG 5 A DG 12 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog4 hydrog ? ? A DG 5 N1 ? ? ? 1_555 A DG 18 O6 ? ? A DG 5 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog5 hydrog ? ? A DG 5 N2 ? ? ? 1_555 A DG 18 N7 ? ? A DG 5 A DG 18 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog6 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A BGM 11 O6 ? ? A DG 6 A BGM 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog7 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A BGM 11 N7 ? ? A DG 6 A BGM 11 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog8 hydrog ? ? A DG 6 N7 ? ? ? 1_555 A DG 19 N2 ? ? A DG 6 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog9 hydrog ? ? A DG 6 O6 ? ? ? 1_555 A DG 19 N1 ? ? A DG 6 A DG 19 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog10 hydrog ? ? A DG 7 N2 ? ? ? 1_555 A DA 10 N7 ? ? A DG 7 A DA 10 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog11 hydrog ? ? A DG 7 N3 ? ? ? 1_555 A DA 10 N6 ? ? A DG 7 A DA 10 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog12 hydrog ? ? A DG 7 N1 ? ? ? 1_555 A DA 22 N1 ? ? A DG 7 A DA 22 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog13 hydrog ? ? A DG 7 O6 ? ? ? 1_555 A DA 22 N6 ? ? A DG 7 A DA 22 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog14 hydrog ? ? A DT 9 N3 ? ? ? 1_555 A DT 21 O2 ? ? A DT 9 A DT 21 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog15 hydrog ? ? A DT 9 O4 ? ? ? 1_555 A DT 21 N3 ? ? A DT 9 A DT 21 1_555 ? ? ? ? ? ? TYPE_16_PAIR ? ? ? hydrog16 hydrog ? ? A DT 9 N3 ? ? ? 1_555 A DA 22 N1 ? ? A DT 9 A DA 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DT 9 O4 ? ? ? 1_555 A DA 22 N6 ? ? A DT 9 A DA 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A BGM 11 N1 ? ? ? 1_555 A DG 23 O6 ? ? A BGM 11 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog19 hydrog ? ? A BGM 11 N2 ? ? ? 1_555 A DG 23 N7 ? ? A BGM 11 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog20 hydrog ? ? A DG 12 N7 ? ? ? 1_555 A DG 24 N2 ? ? A DG 12 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog21 hydrog ? ? A DG 12 O6 ? ? ? 1_555 A DG 24 N1 ? ? A DG 12 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog22 hydrog ? ? A DG 13 N1 ? ? ? 1_555 A DG 17 O6 ? ? A DG 13 A DG 17 1_555 ? ? ? ? ? ? TYPE_3_PAIR ? ? ? hydrog23 hydrog ? ? A DG 13 O6 ? ? ? 1_555 A DG 17 N1 ? ? A DG 13 A DG 17 1_555 ? ? ? ? ? ? TYPE_3_PAIR ? ? ? hydrog24 hydrog ? ? A DG 18 N1 ? ? ? 1_555 A DG 24 O6 ? ? A DG 18 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog25 hydrog ? ? A DG 18 N2 ? ? ? 1_555 A DG 24 N7 ? ? A DG 18 A DG 24 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog26 hydrog ? ? A DG 19 N7 ? ? ? 1_555 A DG 23 N2 ? ? A DG 19 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog27 hydrog ? ? A DG 19 O6 ? ? ? 1_555 A DG 23 N1 ? ? A DG 19 A DG 23 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9I5S _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 6 O2 A DT 9 ? ? O2 A DT 21 ? ? 2.16 2 9 O4 A DT 3 ? ? "O4'" A DA 16 ? ? 2.10 # _pdbx_nmr_ensemble.entry_id 9I5S _pdbx_nmr_ensemble.conformers_calculated_total_number 10 _pdbx_nmr_ensemble.conformers_submitted_total_number 10 _pdbx_nmr_ensemble.conformer_selection_criteria 'structures with the lowest energy' _pdbx_nmr_ensemble.representative_conformer ? _pdbx_nmr_ensemble.average_constraints_per_residue ? _pdbx_nmr_ensemble.average_constraint_violations_per_residue ? _pdbx_nmr_ensemble.maximum_distance_constraint_violation ? _pdbx_nmr_ensemble.average_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation ? _pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation ? _pdbx_nmr_ensemble.distance_constraint_violation_method ? _pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.average_torsion_angle_constraint_violation ? _pdbx_nmr_ensemble.torsion_angle_constraint_violation_method ? # _pdbx_nmr_representative.entry_id 9I5S _pdbx_nmr_representative.conformer_id 1 _pdbx_nmr_representative.selection_criteria 'lowest energy' # loop_ _pdbx_nmr_sample_details.solution_id _pdbx_nmr_sample_details.contents _pdbx_nmr_sample_details.solvent_system _pdbx_nmr_sample_details.label _pdbx_nmr_sample_details.type _pdbx_nmr_sample_details.details 1 '70 mM potassium chloride, 20 mM potassium phosphate, 5 uM DSS, 10 % D2O, 2 mM Human telomeric DNA, 90% H2O/10% D2O' '90% H2O/10% D2O' h2o_sample solution ? 2 '70 mM potassium chloride, 20 mM potassium phosphate, 5 uM DSS, 10 % D2O, 2 mM Human telomeric DNA, 100% D2O' '100% D2O' d2o_sample solution ? 3 ;70 mM potassium chloride, 20 mM potassium phosphate, 5 uM DSS, 10 % D2O, 2 mM [U-13C; U-15N]-Gua 3% Human telomeric DNA, 90% H2O/10% D2O ; '90% H2O/10% D2O' 15nN_sample solution ? # loop_ _pdbx_nmr_exptl_sample.solution_id _pdbx_nmr_exptl_sample.component _pdbx_nmr_exptl_sample.concentration _pdbx_nmr_exptl_sample.concentration_range _pdbx_nmr_exptl_sample.concentration_units _pdbx_nmr_exptl_sample.isotopic_labeling 1 'potassium chloride' 70 ? mM 'natural abundance' 1 'potassium phosphate' 20 ? mM 'natural abundance' 1 DSS 5 ? uM 'natural abundance' 1 D2O 10 ? % 'natural abundance' 1 'Human telomeric DNA' 2 ? mM 'natural abundance' 2 'potassium chloride' 70 ? mM 'natural abundance' 2 'potassium phosphate' 20 ? mM 'natural abundance' 2 DSS 5 ? uM 'natural abundance' 2 D2O 10 ? % 'natural abundance' 2 'Human telomeric DNA' 2 ? mM 'natural abundance' 3 'potassium chloride' 70 ? mM 'natural abundance' 3 'potassium phosphate' 20 ? mM 'natural abundance' 3 DSS 5 ? uM 'natural abundance' 3 D2O 10 ? % 'natural abundance' 3 'Human telomeric DNA' 2 ? mM '[U-13C; U-15N]-Gua 3%' # _pdbx_nmr_exptl_sample_conditions.conditions_id 1 _pdbx_nmr_exptl_sample_conditions.temperature 298 _pdbx_nmr_exptl_sample_conditions.pressure_units Pa _pdbx_nmr_exptl_sample_conditions.pressure 1 _pdbx_nmr_exptl_sample_conditions.pH 7 _pdbx_nmr_exptl_sample_conditions.ionic_strength 0.1 _pdbx_nmr_exptl_sample_conditions.details ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_err ? _pdbx_nmr_exptl_sample_conditions.ionic_strength_units M _pdbx_nmr_exptl_sample_conditions.label condition1 _pdbx_nmr_exptl_sample_conditions.pH_err ? _pdbx_nmr_exptl_sample_conditions.pH_units pH _pdbx_nmr_exptl_sample_conditions.pressure_err ? _pdbx_nmr_exptl_sample_conditions.temperature_err ? _pdbx_nmr_exptl_sample_conditions.temperature_units K # loop_ _pdbx_nmr_exptl.experiment_id _pdbx_nmr_exptl.conditions_id _pdbx_nmr_exptl.solution_id _pdbx_nmr_exptl.type _pdbx_nmr_exptl.spectrometer_id _pdbx_nmr_exptl.sample_state 1 1 1 '2D 1H-1H NOESY' 1 isotropic 2 1 2 '2D 1H-1H NOESY' 1 isotropic 3 1 2 '2D 1H-13C HSQC aromatic' 1 isotropic 4 1 3 '1D 1H-15N HMQC' 1 isotropic 5 1 1 '2D 1H-1H TOCSY' 1 isotropic # _pdbx_nmr_refine.entry_id 9I5S _pdbx_nmr_refine.method 'DGSA-distance geometry simulated annealing' _pdbx_nmr_refine.details ? _pdbx_nmr_refine.software_ordinal 2 # loop_ _pdbx_nmr_software.ordinal _pdbx_nmr_software.classification _pdbx_nmr_software.name _pdbx_nmr_software.version _pdbx_nmr_software.authors 1 'chemical shift assignment' NMRFAM-SPARKY ? 'Woonghee Lee, Marco Tonelli, John L Markley' 2 'structure calculation' 'X-PLOR NIH' ? 'Schwieters, Kuszewski, Tjandra and Clore' 3 'peak picking' NMRFAM-SPARKY ? 'Woonghee Lee, Marco Tonelli, John L Markley' # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal BGM P P N N 1 BGM OP1 O N N 2 BGM OP2 O N N 3 BGM "O5'" O N N 4 BGM "C5'" C N N 5 BGM "C4'" C N R 6 BGM "O4'" O N N 7 BGM "C1'" C N R 8 BGM N9 N Y N 9 BGM C8 C Y N 10 BGM N7 N Y N 11 BGM C5 C Y N 12 BGM C4 C Y N 13 BGM N3 N N N 14 BGM C2 C N N 15 BGM N2 N N N 16 BGM N1 N N N 17 BGM C6 C N N 18 BGM O6 O N N 19 BGM "C2'" C N N 20 BGM "C3'" C N S 21 BGM "O3'" O N N 22 BGM OP3 O N N 23 BGM BR BR N N 24 BGM HOP2 H N N 25 BGM "H5'" H N N 26 BGM "H5''" H N N 27 BGM "H4'" H N N 28 BGM "H1'" H N N 29 BGM H21 H N N 30 BGM H22 H N N 31 BGM H1 H N N 32 BGM "H2'" H N N 33 BGM "H2''" H N N 34 BGM "H3'" H N N 35 BGM "HO3'" H N N 36 BGM HOP3 H N N 37 DA OP3 O N N 38 DA P P N N 39 DA OP1 O N N 40 DA OP2 O N N 41 DA "O5'" O N N 42 DA "C5'" C N N 43 DA "C4'" C N R 44 DA "O4'" O N N 45 DA "C3'" C N S 46 DA "O3'" O N N 47 DA "C2'" C N N 48 DA "C1'" C N R 49 DA N9 N Y N 50 DA C8 C Y N 51 DA N7 N Y N 52 DA C5 C Y N 53 DA C6 C Y N 54 DA N6 N N N 55 DA N1 N Y N 56 DA C2 C Y N 57 DA N3 N Y N 58 DA C4 C Y N 59 DA HOP3 H N N 60 DA HOP2 H N N 61 DA "H5'" H N N 62 DA "H5''" H N N 63 DA "H4'" H N N 64 DA "H3'" H N N 65 DA "HO3'" H N N 66 DA "H2'" H N N 67 DA "H2''" H N N 68 DA "H1'" H N N 69 DA H8 H N N 70 DA H61 H N N 71 DA H62 H N N 72 DA H2 H N N 73 DG OP3 O N N 74 DG P P N N 75 DG OP1 O N N 76 DG OP2 O N N 77 DG "O5'" O N N 78 DG "C5'" C N N 79 DG "C4'" C N R 80 DG "O4'" O N N 81 DG "C3'" C N S 82 DG "O3'" O N N 83 DG "C2'" C N N 84 DG "C1'" C N R 85 DG N9 N Y N 86 DG C8 C Y N 87 DG N7 N Y N 88 DG C5 C Y N 89 DG C6 C N N 90 DG O6 O N N 91 DG N1 N N N 92 DG C2 C N N 93 DG N2 N N N 94 DG N3 N N N 95 DG C4 C Y N 96 DG HOP3 H N N 97 DG HOP2 H N N 98 DG "H5'" H N N 99 DG "H5''" H N N 100 DG "H4'" H N N 101 DG "H3'" H N N 102 DG "HO3'" H N N 103 DG "H2'" H N N 104 DG "H2''" H N N 105 DG "H1'" H N N 106 DG H8 H N N 107 DG H1 H N N 108 DG H21 H N N 109 DG H22 H N N 110 DT OP3 O N N 111 DT P P N N 112 DT OP1 O N N 113 DT OP2 O N N 114 DT "O5'" O N N 115 DT "C5'" C N N 116 DT "C4'" C N R 117 DT "O4'" O N N 118 DT "C3'" C N S 119 DT "O3'" O N N 120 DT "C2'" C N N 121 DT "C1'" C N R 122 DT N1 N N N 123 DT C2 C N N 124 DT O2 O N N 125 DT N3 N N N 126 DT C4 C N N 127 DT O4 O N N 128 DT C5 C N N 129 DT C7 C N N 130 DT C6 C N N 131 DT HOP3 H N N 132 DT HOP2 H N N 133 DT "H5'" H N N 134 DT "H5''" H N N 135 DT "H4'" H N N 136 DT "H3'" H N N 137 DT "HO3'" H N N 138 DT "H2'" H N N 139 DT "H2''" H N N 140 DT "H1'" H N N 141 DT H3 H N N 142 DT H71 H N N 143 DT H72 H N N 144 DT H73 H N N 145 DT H6 H N N 146 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal BGM P OP1 doub N N 1 BGM P OP2 sing N N 2 BGM P "O5'" sing N N 3 BGM P OP3 sing N N 4 BGM OP2 HOP2 sing N N 5 BGM "O5'" "C5'" sing N N 6 BGM "C5'" "C4'" sing N N 7 BGM "C5'" "H5'" sing N N 8 BGM "C5'" "H5''" sing N N 9 BGM "C4'" "O4'" sing N N 10 BGM "C4'" "C3'" sing N N 11 BGM "C4'" "H4'" sing N N 12 BGM "O4'" "C1'" sing N N 13 BGM "C1'" N9 sing N N 14 BGM "C1'" "C2'" sing N N 15 BGM "C1'" "H1'" sing N N 16 BGM N9 C8 sing Y N 17 BGM N9 C4 sing Y N 18 BGM C8 N7 doub Y N 19 BGM C8 BR sing N N 20 BGM N7 C5 sing Y N 21 BGM C5 C4 doub Y N 22 BGM C5 C6 sing N N 23 BGM C4 N3 sing N N 24 BGM N3 C2 doub N N 25 BGM C2 N2 sing N N 26 BGM C2 N1 sing N N 27 BGM N2 H21 sing N N 28 BGM N2 H22 sing N N 29 BGM N1 C6 sing N N 30 BGM N1 H1 sing N N 31 BGM C6 O6 doub N N 32 BGM "C2'" "C3'" sing N N 33 BGM "C2'" "H2'" sing N N 34 BGM "C2'" "H2''" sing N N 35 BGM "C3'" "O3'" sing N N 36 BGM "C3'" "H3'" sing N N 37 BGM "O3'" "HO3'" sing N N 38 BGM OP3 HOP3 sing N N 39 DA OP3 P sing N N 40 DA OP3 HOP3 sing N N 41 DA P OP1 doub N N 42 DA P OP2 sing N N 43 DA P "O5'" sing N N 44 DA OP2 HOP2 sing N N 45 DA "O5'" "C5'" sing N N 46 DA "C5'" "C4'" sing N N 47 DA "C5'" "H5'" sing N N 48 DA "C5'" "H5''" sing N N 49 DA "C4'" "O4'" sing N N 50 DA "C4'" "C3'" sing N N 51 DA "C4'" "H4'" sing N N 52 DA "O4'" "C1'" sing N N 53 DA "C3'" "O3'" sing N N 54 DA "C3'" "C2'" sing N N 55 DA "C3'" "H3'" sing N N 56 DA "O3'" "HO3'" sing N N 57 DA "C2'" "C1'" sing N N 58 DA "C2'" "H2'" sing N N 59 DA "C2'" "H2''" sing N N 60 DA "C1'" N9 sing N N 61 DA "C1'" "H1'" sing N N 62 DA N9 C8 sing Y N 63 DA N9 C4 sing Y N 64 DA C8 N7 doub Y N 65 DA C8 H8 sing N N 66 DA N7 C5 sing Y N 67 DA C5 C6 sing Y N 68 DA C5 C4 doub Y N 69 DA C6 N6 sing N N 70 DA C6 N1 doub Y N 71 DA N6 H61 sing N N 72 DA N6 H62 sing N N 73 DA N1 C2 sing Y N 74 DA C2 N3 doub Y N 75 DA C2 H2 sing N N 76 DA N3 C4 sing Y N 77 DG OP3 P sing N N 78 DG OP3 HOP3 sing N N 79 DG P OP1 doub N N 80 DG P OP2 sing N N 81 DG P "O5'" sing N N 82 DG OP2 HOP2 sing N N 83 DG "O5'" "C5'" sing N N 84 DG "C5'" "C4'" sing N N 85 DG "C5'" "H5'" sing N N 86 DG "C5'" "H5''" sing N N 87 DG "C4'" "O4'" sing N N 88 DG "C4'" "C3'" sing N N 89 DG "C4'" "H4'" sing N N 90 DG "O4'" "C1'" sing N N 91 DG "C3'" "O3'" sing N N 92 DG "C3'" "C2'" sing N N 93 DG "C3'" "H3'" sing N N 94 DG "O3'" "HO3'" sing N N 95 DG "C2'" "C1'" sing N N 96 DG "C2'" "H2'" sing N N 97 DG "C2'" "H2''" sing N N 98 DG "C1'" N9 sing N N 99 DG "C1'" "H1'" sing N N 100 DG N9 C8 sing Y N 101 DG N9 C4 sing Y N 102 DG C8 N7 doub Y N 103 DG C8 H8 sing N N 104 DG N7 C5 sing Y N 105 DG C5 C6 sing N N 106 DG C5 C4 doub Y N 107 DG C6 O6 doub N N 108 DG C6 N1 sing N N 109 DG N1 C2 sing N N 110 DG N1 H1 sing N N 111 DG C2 N2 sing N N 112 DG C2 N3 doub N N 113 DG N2 H21 sing N N 114 DG N2 H22 sing N N 115 DG N3 C4 sing N N 116 DT OP3 P sing N N 117 DT OP3 HOP3 sing N N 118 DT P OP1 doub N N 119 DT P OP2 sing N N 120 DT P "O5'" sing N N 121 DT OP2 HOP2 sing N N 122 DT "O5'" "C5'" sing N N 123 DT "C5'" "C4'" sing N N 124 DT "C5'" "H5'" sing N N 125 DT "C5'" "H5''" sing N N 126 DT "C4'" "O4'" sing N N 127 DT "C4'" "C3'" sing N N 128 DT "C4'" "H4'" sing N N 129 DT "O4'" "C1'" sing N N 130 DT "C3'" "O3'" sing N N 131 DT "C3'" "C2'" sing N N 132 DT "C3'" "H3'" sing N N 133 DT "O3'" "HO3'" sing N N 134 DT "C2'" "C1'" sing N N 135 DT "C2'" "H2'" sing N N 136 DT "C2'" "H2''" sing N N 137 DT "C1'" N1 sing N N 138 DT "C1'" "H1'" sing N N 139 DT N1 C2 sing N N 140 DT N1 C6 sing N N 141 DT C2 O2 doub N N 142 DT C2 N3 sing N N 143 DT N3 C4 sing N N 144 DT N3 H3 sing N N 145 DT C4 O4 doub N N 146 DT C4 C5 sing N N 147 DT C5 C7 sing N N 148 DT C5 C6 doub N N 149 DT C7 H71 sing N N 150 DT C7 H72 sing N N 151 DT C7 H73 sing N N 152 DT C6 H6 sing N N 153 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9I5S 'double helix' 9I5S 'z-form double helix' 9I5S 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DT 9 1_555 A DT 21 1_555 1.477 -4.300 2.369 -7.196 -26.056 -18.923 1 A_DT9:DT21_A A 9 ? A 21 ? 16 1 1 A DG 7 1_555 A DA 22 1_555 -0.822 1.418 0.268 -15.062 20.619 27.449 2 A_DG7:DA22_A A 7 ? A 22 ? 8 1 1 A DG 19 1_555 A DG 23 1_555 1.657 -3.606 0.104 3.805 3.190 -89.197 3 A_DG19:DG23_A A 19 ? A 23 ? 6 3 1 A DG 17 1_555 A DG 13 1_555 1.047 0.854 -1.178 -12.631 0.852 -160.895 4 A_DG17:DG13_A A 17 ? A 13 ? 3 2 1 A DG 24 1_555 A DG 12 1_555 1.121 3.706 0.291 3.335 -4.645 -91.072 5 A_DG24:DG12_A A 24 ? A 12 ? 6 3 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DT 9 1_555 A DT 21 1_555 A DG 7 1_555 A DA 22 1_555 -0.189 -0.811 3.640 -0.863 -8.208 39.588 -0.123 0.163 3.731 -11.961 1.257 40.406 1 AA_DT9DG7:DA22DT21_AA A 9 ? A 21 ? A 7 ? A 22 ? 1 A DG 7 1_555 A DA 22 1_555 A DG 19 1_555 A DG 23 1_555 2.583 1.800 3.290 4.496 5.577 -160.930 -0.926 1.321 3.258 -2.827 2.279 -160.967 2 AA_DG7DG19:DG23DA22_AA A 7 ? A 22 ? A 19 ? A 23 ? 1 A DG 17 1_555 A DG 13 1_555 A DG 24 1_555 A DG 12 1_555 -0.400 3.530 -2.245 154.459 68.543 15.692 2.039 -0.397 0.748 36.200 -81.575 169.087 3 AA_DG17DG24:DG12DG13_AA A 17 ? A 13 ? A 24 ? A 12 ? # _pdbx_audit_support.funding_organization 'Agence Nationale de la Recherche (ANR)' _pdbx_audit_support.country France _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # loop_ _pdbx_nmr_spectrometer.spectrometer_id _pdbx_nmr_spectrometer.model _pdbx_nmr_spectrometer.type _pdbx_nmr_spectrometer.manufacturer _pdbx_nmr_spectrometer.field_strength _pdbx_nmr_spectrometer.details 1 'AVANCE III' ? Bruker 600 ? 2 'AVANCE II' ? Bruker 800 ? # _atom_sites.entry_id 9I5S _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol BR C H N O P # loop_ #