data_9J6P # _entry.id 9J6P # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.403 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9J6P pdb_00009j6p 10.2210/pdb9j6p/pdb WWPDB D_1300050452 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2025-01-15 ? 2 'Structure model' 1 1 2025-04-16 ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_audit_revision_group.ordinal 1 _pdbx_audit_revision_group.revision_ordinal 2 _pdbx_audit_revision_group.data_content_type 'Structure model' _pdbx_audit_revision_group.group 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 2 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.country' 2 2 'Structure model' '_citation.journal_abbrev' 3 2 'Structure model' '_citation.journal_id_CSD' 4 2 'Structure model' '_citation.journal_id_ISSN' 5 2 'Structure model' '_citation.journal_volume' 6 2 'Structure model' '_citation.page_first' 7 2 'Structure model' '_citation.page_last' 8 2 'Structure model' '_citation.pdbx_database_id_DOI' 9 2 'Structure model' '_citation.pdbx_database_id_PubMed' 10 2 'Structure model' '_citation.title' 11 2 'Structure model' '_citation.year' 12 2 'Structure model' '_citation_author.identifier_ORCID' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9J6P _pdbx_database_status.recvd_initial_deposition_date 2024-08-16 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBJ _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible N # _pdbx_contact_author.id 2 _pdbx_contact_author.email j.kondo@sophia.ac.jp _pdbx_contact_author.name_first Jiro _pdbx_contact_author.name_last Kondo _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5682-3685 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kondo, J.' 1 0000-0002-5682-3685 'Nagasawa, R.' 2 ? 'Onizuka, K.' 3 ? 'Kawamura, K.' 4 ? 'Tsuzuki, K.' 5 ? 'Murase, H.' 6 ? 'Komatsu, K.R.' 7 ? 'Miyashita, E.' 8 ? 'Saito, H.' 9 ? 'Nagatsugi, F.' 10 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Chem.Commun.(Camb.)' _citation.journal_id_ASTM ? _citation.journal_id_CSD ? _citation.journal_id_ISSN 1364-548X _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 61 _citation.language ? _citation.page_first 1120 _citation.page_last 1123 _citation.title 'Crystallographic analysis of G-clamp-RNA complex assisted by large scale RNA-binding profile.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1039/d4cc04677c _citation.pdbx_database_id_PubMed 39641381 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Nagasawa, R.' 1 0009-0002-0474-3218 primary 'Onizuka, K.' 2 0000-0001-9713-4619 primary 'Kawamura, K.' 3 ? primary 'Tsuzuki, K.' 4 ? primary 'Murase, H.' 5 0000-0001-5747-191X primary 'Komatsu, K.R.' 6 0000-0002-4505-0840 primary 'Miyashita, E.' 7 ? primary 'Saito, H.' 8 ? primary 'Kondo, J.' 9 0000-0002-5682-3685 primary 'Nagatsugi, F.' 10 0000-0002-5526-6020 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn ;RNA (5'-R(P*UP*GP*CP*GP*GP*GP*GP*UP*CP*CP*CP*GP*GP*GP*AP*GP*GP*AP*CP*CP*GP*C)-3') ; 7159.323 2 ? ? ? ? 2 non-polymer syn ;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide ; 492.525 2 ? ? ? ? 3 water nat water 18.015 13 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code UGCGGGGUCCCGGGAGGACCGC _entity_poly.pdbx_seq_one_letter_code_can UGCGGGGUCCCGGGAGGACCGC _entity_poly.pdbx_strand_id A,B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide ; A1L3Y 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 U n 1 2 G n 1 3 C n 1 4 G n 1 5 G n 1 6 G n 1 7 G n 1 8 U n 1 9 C n 1 10 C n 1 11 C n 1 12 G n 1 13 G n 1 14 G n 1 15 A n 1 16 G n 1 17 G n 1 18 A n 1 19 C n 1 20 C n 1 21 G n 1 22 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 22 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 A1L3Y non-polymer . ;~{N}-[2-[2-[2-(2-azanylethoxy)ethoxy]ethoxy]ethyl]-2-[9-(2-azanylethoxy)-2-oxidanylidene-10~{H}-pyrimido[5,4-b][1,4]benzoxazin-3-yl]ethanamide ; ? 'C22 H32 N6 O7' 492.525 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 U 1 2 2 U U A . n A 1 2 G 2 3 3 G G A . n A 1 3 C 3 4 4 C C A . n A 1 4 G 4 5 5 G G A . n A 1 5 G 5 6 6 G G A . n A 1 6 G 6 7 7 G G A . n A 1 7 G 7 8 8 G G A . n A 1 8 U 8 9 9 U U A . n A 1 9 C 9 10 10 C C A . n A 1 10 C 10 11 11 C C A . n A 1 11 C 11 12 12 C C A . n A 1 12 G 12 13 13 G G A . n A 1 13 G 13 14 14 G G A . n A 1 14 G 14 15 15 G G A . n A 1 15 A 15 16 16 A A A . n A 1 16 G 16 17 17 G G A . n A 1 17 G 17 18 18 G G A . n A 1 18 A 18 19 19 A A A . n A 1 19 C 19 20 20 C C A . n A 1 20 C 20 21 21 C C A . n A 1 21 G 21 22 22 G G A . n A 1 22 C 22 23 23 C C A . n B 1 1 U 1 2 ? ? ? B . n B 1 2 G 2 3 3 G G B . n B 1 3 C 3 4 4 C C B . n B 1 4 G 4 5 5 G G B . n B 1 5 G 5 6 6 G G B . n B 1 6 G 6 7 7 G G B . n B 1 7 G 7 8 8 G G B . n B 1 8 U 8 9 9 U U B . n B 1 9 C 9 10 10 C C B . n B 1 10 C 10 11 11 C C B . n B 1 11 C 11 12 12 C C B . n B 1 12 G 12 13 13 G G B . n B 1 13 G 13 14 14 G G B . n B 1 14 G 14 15 15 G G B . n B 1 15 A 15 16 16 A A B . n B 1 16 G 16 17 17 G G B . n B 1 17 G 17 18 18 G G B . n B 1 18 A 18 19 19 A A B . n B 1 19 C 19 20 20 C C B . n B 1 20 C 20 21 21 C C B . n B 1 21 G 21 22 22 G G B . n B 1 22 C 22 23 23 C C B . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id A1L3Y _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id A1L3Y _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code C 2 A1L3Y 1 101 102 A1L3Y LIG A . D 2 A1L3Y 1 101 101 A1L3Y LIG B . E 3 HOH 1 201 1 HOH HOH A . E 3 HOH 2 202 9 HOH HOH A . E 3 HOH 3 203 7 HOH HOH A . E 3 HOH 4 204 3 HOH HOH A . E 3 HOH 5 205 6 HOH HOH A . E 3 HOH 6 206 4 HOH HOH A . E 3 HOH 7 207 12 HOH HOH A . E 3 HOH 8 208 5 HOH HOH A . E 3 HOH 9 209 2 HOH HOH A . E 3 HOH 10 210 13 HOH HOH A . F 3 HOH 1 201 8 HOH HOH B . F 3 HOH 2 202 11 HOH HOH B . F 3 HOH 3 203 10 HOH HOH B . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 N 1 A A1L3Y 101 ? C03 ? C A1L3Y 1 C03 2 1 N 1 A A1L3Y 101 ? C08 ? C A1L3Y 1 C08 3 1 N 1 A A1L3Y 101 ? O01 ? C A1L3Y 1 O01 4 1 N 1 A A1L3Y 101 ? C04 ? C A1L3Y 1 C04 5 1 N 1 A A1L3Y 101 ? N01 ? C A1L3Y 1 N01 6 1 N 1 B A1L3Y 101 ? C04 ? D A1L3Y 1 C04 7 1 N 1 B A1L3Y 101 ? N01 ? D A1L3Y 1 N01 # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.17.1_3660: ???)' 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? . 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . 3 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? . 4 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9J6P _cell.details ? _cell.formula_units_Z ? _cell.length_a 46.156 _cell.length_a_esd ? _cell.length_b 46.156 _cell.length_b_esd ? _cell.length_c 336.178 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 36 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9J6P _symmetry.cell_setting ? _symmetry.Int_Tables_number 155 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'H 3 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9J6P _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.46 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 49.98 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'MPD, spermine, MOPS' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 293 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2023-11-26 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.605 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'PHOTON FACTORY BEAMLINE BL-17A' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.605 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL-17A _diffrn_source.pdbx_synchrotron_site 'Photon Factory' # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9J6P _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.49 _reflns.d_resolution_low 39.7 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 9098 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 97.2 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.3 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 19.09 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.095 _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.993 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.09 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.49 2.56 ? ? ? ? ? ? 671 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.364 ? ? 1 1 0.964 ? ? ? ? 0.346 ? ? ? ? ? ? ? ? ? 2.56 2.63 ? ? ? ? ? ? 623 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.303 ? ? 2 1 0.987 ? ? ? ? 0.289 ? ? ? ? ? ? ? ? ? 2.63 2.7 ? ? ? ? ? ? 653 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.241 ? ? 3 1 0.991 ? ? ? ? 0.229 ? ? ? ? ? ? ? ? ? 2.70 2.79 ? ? ? ? ? ? 584 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.201 ? ? 4 1 0.991 ? ? ? ? 0.191 ? ? ? ? ? ? ? ? ? 2.79 2.88 ? ? ? ? ? ? 638 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.166 ? ? 5 1 0.993 ? ? ? ? 0.157 ? ? ? ? ? ? ? ? ? 2.88 2.98 ? ? ? ? ? ? 546 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.129 ? ? 6 1 0.996 ? ? ? ? 0.122 ? ? ? ? ? ? ? ? ? 2.98 3.09 ? ? ? ? ? ? 574 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.109 ? ? 7 1 0.993 ? ? ? ? 0.102 ? ? ? ? ? ? ? ? ? 3.09 3.22 ? ? ? ? ? ? 532 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.106 ? ? 8 1 0.997 ? ? ? ? 0.101 ? ? ? ? ? ? ? ? ? 3.22 3.36 ? ? ? ? ? ? 515 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.106 ? ? 9 1 0.995 ? ? ? ? 0.101 ? ? ? ? ? ? ? ? ? 3.36 3.53 ? ? ? ? ? ? 500 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.109 ? ? 10 1 0.994 ? ? ? ? 0.103 ? ? ? ? ? ? ? ? ? 3.53 3.72 ? ? ? ? ? ? 458 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.095 ? ? 11 1 0.994 ? ? ? ? 0.089 ? ? ? ? ? ? ? ? ? 3.72 3.94 ? ? ? ? ? ? 460 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.078 ? ? 12 1 0.999 ? ? ? ? 0.075 ? ? ? ? ? ? ? ? ? 3.94 4.21 ? ? ? ? ? ? 436 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.079 ? ? 13 1 0.997 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ? 4.21 4.55 ? ? ? ? ? ? 378 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.078 ? ? 14 1 0.997 ? ? ? ? 0.074 ? ? ? ? ? ? ? ? ? 4.55 4.99 ? ? ? ? ? ? 363 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.08 ? ? 15 1 0.998 ? ? ? ? 0.076 ? ? ? ? ? ? ? ? ? 4.99 5.58 ? ? ? ? ? ? 333 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.09 ? ? 16 1 0.994 ? ? ? ? 0.086 ? ? ? ? ? ? ? ? ? 5.58 6.44 ? ? ? ? ? ? 297 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.09 ? ? 17 1 0.996 ? ? ? ? 0.086 ? ? ? ? ? ? ? ? ? 6.44 7.88 ? ? ? ? ? ? 243 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.084 ? ? 18 1 0.997 ? ? ? ? 0.08 ? ? ? ? ? ? ? ? ? 7.88 11.15 ? ? ? ? ? ? 193 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.095 ? ? 19 1 0.997 ? ? ? ? 0.09 ? ? ? ? ? ? ? ? ? 11.15 39.7 ? ? ? ? ? ? 101 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 0.083 ? ? 20 1 0.99 ? ? ? ? 0.077 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9J6P _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.49 _refine.ls_d_res_low 39.69 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 9010 _refine.ls_number_reflns_R_free 898 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 96.31 _refine.ls_percent_reflns_R_free 9.97 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2069 _refine.ls_R_factor_R_free 0.2680 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2004 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.97 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.11 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.14 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.43 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 934 _refine_hist.pdbx_number_atoms_ligand 63 _refine_hist.number_atoms_solvent 13 _refine_hist.number_atoms_total 1010 _refine_hist.d_res_high 2.49 _refine_hist.d_res_low 39.69 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.007 ? 1111 ? f_bond_d ? ? 'X-RAY DIFFRACTION' ? 1.199 ? 1715 ? f_angle_d ? ? 'X-RAY DIFFRACTION' ? 9.606 ? 529 ? f_dihedral_angle_d ? ? 'X-RAY DIFFRACTION' ? 0.043 ? 215 ? f_chiral_restr ? ? 'X-RAY DIFFRACTION' ? 0.006 ? 47 ? f_plane_restr ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.49 2.65 . . 151 1345 96.00 . . . . 0.3207 . . . . . . . . . . . 0.4482 'X-RAY DIFFRACTION' 2.65 2.85 . . 150 1349 97.00 . . . . 0.3001 . . . . . . . . . . . 0.3594 'X-RAY DIFFRACTION' 2.85 3.14 . . 149 1337 96.00 . . . . 0.2697 . . . . . . . . . . . 0.3402 'X-RAY DIFFRACTION' 3.14 3.59 . . 145 1325 94.00 . . . . 0.2180 . . . . . . . . . . . 0.2729 'X-RAY DIFFRACTION' 3.60 4.52 . . 154 1359 97.00 . . . . 0.1738 . . . . . . . . . . . 0.2419 'X-RAY DIFFRACTION' 4.53 39.69 . . 149 1397 99.00 . . . . 0.1508 . . . . . . . . . . . 0.2084 # _struct.entry_id 9J6P _struct.title 'pre-mir-125a internal loop in complex with G-clamp' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9J6P _struct_keywords.text 'micro RNA, G-clamp, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 1 ? C N N 2 ? D N N 2 ? E N N 3 ? F N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9J6P _struct_ref.pdbx_db_accession 9J6P _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # loop_ _struct_ref_seq.align_id _struct_ref_seq.ref_id _struct_ref_seq.pdbx_PDB_id_code _struct_ref_seq.pdbx_strand_id _struct_ref_seq.seq_align_beg _struct_ref_seq.pdbx_seq_align_beg_ins_code _struct_ref_seq.seq_align_end _struct_ref_seq.pdbx_seq_align_end_ins_code _struct_ref_seq.pdbx_db_accession _struct_ref_seq.db_align_beg _struct_ref_seq.pdbx_db_align_beg_ins_code _struct_ref_seq.db_align_end _struct_ref_seq.pdbx_db_align_end_ins_code _struct_ref_seq.pdbx_auth_seq_align_beg _struct_ref_seq.pdbx_auth_seq_align_end 1 1 9J6P A 1 ? 22 ? 9J6P 2 ? 23 ? 2 23 2 1 9J6P B 1 ? 22 ? 9J6P 2 ? 23 ? 2 23 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2510 ? 1 MORE -9 ? 1 'SSA (A^2)' 8470 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A U 1 O4 ? ? ? 1_555 B C 19 N4 ? ? A U 2 B C 20 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog2 hydrog ? ? A G 2 N1 ? ? ? 1_555 B C 22 N3 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 N2 ? ? ? 1_555 B C 22 O2 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 O6 ? ? ? 1_555 B C 22 N4 ? ? A G 3 B C 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 3 N3 ? ? ? 1_555 B G 21 N1 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 3 N4 ? ? ? 1_555 B G 21 O6 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A C 3 O2 ? ? ? 1_555 B G 21 N2 ? ? A C 4 B G 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 4 N1 ? ? ? 1_555 B C 20 N3 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N2 ? ? ? 1_555 B C 20 O2 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 O6 ? ? ? 1_555 B C 20 N4 ? ? A G 5 B C 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 5 N1 ? ? ? 1_555 B C 19 N3 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 5 N2 ? ? ? 1_555 B C 19 O2 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A G 5 O6 ? ? ? 1_555 B C 19 N4 ? ? A G 6 B C 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A G 7 N1 ? ? ? 1_555 B G 16 O6 ? ? A G 8 B G 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog15 hydrog ? ? A G 7 N2 ? ? ? 1_555 B G 16 N7 ? ? A G 8 B G 17 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog16 hydrog ? ? A U 8 N3 ? ? ? 1_555 B A 15 N1 ? ? A U 9 B A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 8 O4 ? ? ? 1_555 B A 15 N6 ? ? A U 9 B A 16 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 9 N3 ? ? ? 1_555 B G 14 N1 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 9 N4 ? ? ? 1_555 B G 14 O6 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 9 O2 ? ? ? 1_555 B G 14 N2 ? ? A C 10 B G 15 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 11 B G 14 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 11 N3 ? ? ? 1_555 B G 12 N1 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 11 N4 ? ? ? 1_555 B G 12 O6 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 11 O2 ? ? ? 1_555 B G 12 N2 ? ? A C 12 B G 13 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 13 B C 12 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 13 N1 ? ? ? 1_555 B C 10 N3 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 13 N2 ? ? ? 1_555 B C 10 O2 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 13 O6 ? ? ? 1_555 B C 10 N4 ? ? A G 14 B C 11 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 9 N3 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 9 O2 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 9 N4 ? ? A G 15 B C 10 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 15 N1 ? ? ? 1_555 B U 8 N3 ? ? A A 16 B U 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 15 N6 ? ? ? 1_555 B U 8 O4 ? ? A A 16 B U 9 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 16 N7 ? ? ? 1_555 B G 7 N2 ? ? A G 17 B G 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog39 hydrog ? ? A G 16 O6 ? ? ? 1_555 B G 7 N1 ? ? A G 17 B G 8 1_555 ? ? ? ? ? ? TYPE_6_PAIR ? ? ? hydrog40 hydrog ? ? A C 19 N3 ? ? ? 1_555 B G 5 N1 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A C 19 N4 ? ? ? 1_555 B G 5 O6 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A C 19 O2 ? ? ? 1_555 B G 5 N2 ? ? A C 20 B G 6 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A C 20 N3 ? ? ? 1_555 B G 4 N1 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 20 N4 ? ? ? 1_555 B G 4 O6 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 20 O2 ? ? ? 1_555 B G 4 N2 ? ? A C 21 B G 5 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 21 N1 ? ? ? 1_555 B C 3 N3 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 21 N2 ? ? ? 1_555 B C 3 O2 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 21 O6 ? ? ? 1_555 B C 3 N4 ? ? A G 22 B C 4 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 22 N3 ? ? ? 1_555 B G 2 N1 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 22 N4 ? ? ? 1_555 B G 2 O6 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 22 O2 ? ? ? 1_555 B G 2 N2 ? ? A C 23 B G 3 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _pdbx_entry_details.entry_id 9J6P _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 A HOH 201 ? E HOH . 2 1 A HOH 206 ? E HOH . 3 1 A HOH 209 ? E HOH . 4 1 A HOH 210 ? E HOH . # _pdbx_unobs_or_zero_occ_residues.id 1 _pdbx_unobs_or_zero_occ_residues.PDB_model_num 1 _pdbx_unobs_or_zero_occ_residues.polymer_flag Y _pdbx_unobs_or_zero_occ_residues.occupancy_flag 1 _pdbx_unobs_or_zero_occ_residues.auth_asym_id B _pdbx_unobs_or_zero_occ_residues.auth_comp_id U _pdbx_unobs_or_zero_occ_residues.auth_seq_id 2 _pdbx_unobs_or_zero_occ_residues.PDB_ins_code ? _pdbx_unobs_or_zero_occ_residues.label_asym_id B _pdbx_unobs_or_zero_occ_residues.label_comp_id U _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 A1L3Y C10 C N N 38 A1L3Y C13 C N N 39 A1L3Y C15 C N N 40 A1L3Y C17 C Y N 41 A1L3Y C20 C Y N 42 A1L3Y C21 C N N 43 A1L3Y C22 C N N 44 A1L3Y C01 C N N 45 A1L3Y C02 C N N 46 A1L3Y C03 C N N 47 A1L3Y C06 C N N 48 A1L3Y C07 C N N 49 A1L3Y C08 C N N 50 A1L3Y C09 C Y N 51 A1L3Y C11 C N N 52 A1L3Y C12 C Y N 53 A1L3Y C14 C N N 54 A1L3Y C16 C N N 55 A1L3Y C18 C Y N 56 A1L3Y C19 C Y N 57 A1L3Y C23 C N N 58 A1L3Y N02 N N N 59 A1L3Y N03 N N N 60 A1L3Y N04 N N N 61 A1L3Y N05 N N N 62 A1L3Y N06 N N N 63 A1L3Y O01 O N N 64 A1L3Y O02 O N N 65 A1L3Y O03 O N N 66 A1L3Y O05 O N N 67 A1L3Y O06 O N N 68 A1L3Y O07 O N N 69 A1L3Y O08 O N N 70 A1L3Y H1 H N N 71 A1L3Y H2 H N N 72 A1L3Y H3 H N N 73 A1L3Y H5 H N N 74 A1L3Y H6 H N N 75 A1L3Y H7 H N N 76 A1L3Y H8 H N N 77 A1L3Y H9 H N N 78 A1L3Y H10 H N N 79 A1L3Y H11 H N N 80 A1L3Y H12 H N N 81 A1L3Y H13 H N N 82 A1L3Y H14 H N N 83 A1L3Y H15 H N N 84 A1L3Y H17 H N N 85 A1L3Y H18 H N N 86 A1L3Y H19 H N N 87 A1L3Y H20 H N N 88 A1L3Y H21 H N N 89 A1L3Y H22 H N N 90 A1L3Y H23 H N N 91 A1L3Y H24 H N N 92 A1L3Y H25 H N N 93 A1L3Y H26 H N N 94 A1L3Y H27 H N N 95 A1L3Y H28 H N N 96 A1L3Y H31 H N N 97 A1L3Y C04 C N N 98 A1L3Y N01 N N N 99 A1L3Y H29 H N N 100 A1L3Y H32 H N N 101 A1L3Y H33 H N N 102 A1L3Y H34 H N N 103 A1L3Y H4 H N N 104 C OP3 O N N 105 C P P N N 106 C OP1 O N N 107 C OP2 O N N 108 C "O5'" O N N 109 C "C5'" C N N 110 C "C4'" C N R 111 C "O4'" O N N 112 C "C3'" C N S 113 C "O3'" O N N 114 C "C2'" C N R 115 C "O2'" O N N 116 C "C1'" C N R 117 C N1 N N N 118 C C2 C N N 119 C O2 O N N 120 C N3 N N N 121 C C4 C N N 122 C N4 N N N 123 C C5 C N N 124 C C6 C N N 125 C HOP3 H N N 126 C HOP2 H N N 127 C "H5'" H N N 128 C "H5''" H N N 129 C "H4'" H N N 130 C "H3'" H N N 131 C "HO3'" H N N 132 C "H2'" H N N 133 C "HO2'" H N N 134 C "H1'" H N N 135 C H41 H N N 136 C H42 H N N 137 C H5 H N N 138 C H6 H N N 139 G OP3 O N N 140 G P P N N 141 G OP1 O N N 142 G OP2 O N N 143 G "O5'" O N N 144 G "C5'" C N N 145 G "C4'" C N R 146 G "O4'" O N N 147 G "C3'" C N S 148 G "O3'" O N N 149 G "C2'" C N R 150 G "O2'" O N N 151 G "C1'" C N R 152 G N9 N Y N 153 G C8 C Y N 154 G N7 N Y N 155 G C5 C Y N 156 G C6 C N N 157 G O6 O N N 158 G N1 N N N 159 G C2 C N N 160 G N2 N N N 161 G N3 N N N 162 G C4 C Y N 163 G HOP3 H N N 164 G HOP2 H N N 165 G "H5'" H N N 166 G "H5''" H N N 167 G "H4'" H N N 168 G "H3'" H N N 169 G "HO3'" H N N 170 G "H2'" H N N 171 G "HO2'" H N N 172 G "H1'" H N N 173 G H8 H N N 174 G H1 H N N 175 G H21 H N N 176 G H22 H N N 177 HOH O O N N 178 HOH H1 H N N 179 HOH H2 H N N 180 U OP3 O N N 181 U P P N N 182 U OP1 O N N 183 U OP2 O N N 184 U "O5'" O N N 185 U "C5'" C N N 186 U "C4'" C N R 187 U "O4'" O N N 188 U "C3'" C N S 189 U "O3'" O N N 190 U "C2'" C N R 191 U "O2'" O N N 192 U "C1'" C N R 193 U N1 N N N 194 U C2 C N N 195 U O2 O N N 196 U N3 N N N 197 U C4 C N N 198 U O4 O N N 199 U C5 C N N 200 U C6 C N N 201 U HOP3 H N N 202 U HOP2 H N N 203 U "H5'" H N N 204 U "H5''" H N N 205 U "H4'" H N N 206 U "H3'" H N N 207 U "HO3'" H N N 208 U "H2'" H N N 209 U "HO2'" H N N 210 U "H1'" H N N 211 U H3 H N N 212 U H5 H N N 213 U H6 H N N 214 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 A1L3Y C18 C17 sing Y N 40 A1L3Y C18 C19 doub Y N 41 A1L3Y C17 C12 doub Y N 42 A1L3Y C19 C20 sing Y N 43 A1L3Y C12 O05 sing N N 44 A1L3Y C12 C09 sing Y N 45 A1L3Y O05 C16 sing N N 46 A1L3Y C20 C09 doub Y N 47 A1L3Y C20 O08 sing N N 48 A1L3Y C09 N03 sing N N 49 A1L3Y O08 C21 sing N N 50 A1L3Y C16 C15 doub N N 51 A1L3Y C16 C10 sing N N 52 A1L3Y C15 N05 sing N N 53 A1L3Y N03 C10 sing N N 54 A1L3Y C10 N04 doub N N 55 A1L3Y N05 C13 sing N N 56 A1L3Y N05 C11 sing N N 57 A1L3Y C13 C14 sing N N 58 A1L3Y N04 C11 sing N N 59 A1L3Y N02 C22 sing N N 60 A1L3Y C11 O06 doub N N 61 A1L3Y C21 C22 sing N N 62 A1L3Y C08 C06 sing N N 63 A1L3Y C08 O01 sing N N 64 A1L3Y C14 N06 sing N N 65 A1L3Y C14 O07 doub N N 66 A1L3Y C06 O02 sing N N 67 A1L3Y O01 C03 sing N N 68 A1L3Y N06 C23 sing N N 69 A1L3Y O02 C02 sing N N 70 A1L3Y C23 C07 sing N N 71 A1L3Y C02 C01 sing N N 72 A1L3Y C07 O03 sing N N 73 A1L3Y C01 O03 sing N N 74 A1L3Y C13 H1 sing N N 75 A1L3Y C13 H2 sing N N 76 A1L3Y C15 H3 sing N N 77 A1L3Y C17 H5 sing N N 78 A1L3Y C21 H6 sing N N 79 A1L3Y C21 H7 sing N N 80 A1L3Y C22 H8 sing N N 81 A1L3Y C22 H9 sing N N 82 A1L3Y C01 H10 sing N N 83 A1L3Y C01 H11 sing N N 84 A1L3Y C02 H12 sing N N 85 A1L3Y C02 H13 sing N N 86 A1L3Y C03 H14 sing N N 87 A1L3Y C03 H15 sing N N 88 A1L3Y C06 H17 sing N N 89 A1L3Y C06 H18 sing N N 90 A1L3Y C07 H19 sing N N 91 A1L3Y C07 H20 sing N N 92 A1L3Y C08 H21 sing N N 93 A1L3Y C08 H22 sing N N 94 A1L3Y C18 H23 sing N N 95 A1L3Y C19 H24 sing N N 96 A1L3Y C23 H25 sing N N 97 A1L3Y C23 H26 sing N N 98 A1L3Y N02 H27 sing N N 99 A1L3Y N02 H28 sing N N 100 A1L3Y N06 H31 sing N N 101 A1L3Y C03 C04 sing N N 102 A1L3Y C04 N01 sing N N 103 A1L3Y C04 H29 sing N N 104 A1L3Y C04 H32 sing N N 105 A1L3Y N01 H33 sing N N 106 A1L3Y N01 H34 sing N N 107 A1L3Y N03 H4 sing N N 108 C OP3 P sing N N 109 C OP3 HOP3 sing N N 110 C P OP1 doub N N 111 C P OP2 sing N N 112 C P "O5'" sing N N 113 C OP2 HOP2 sing N N 114 C "O5'" "C5'" sing N N 115 C "C5'" "C4'" sing N N 116 C "C5'" "H5'" sing N N 117 C "C5'" "H5''" sing N N 118 C "C4'" "O4'" sing N N 119 C "C4'" "C3'" sing N N 120 C "C4'" "H4'" sing N N 121 C "O4'" "C1'" sing N N 122 C "C3'" "O3'" sing N N 123 C "C3'" "C2'" sing N N 124 C "C3'" "H3'" sing N N 125 C "O3'" "HO3'" sing N N 126 C "C2'" "O2'" sing N N 127 C "C2'" "C1'" sing N N 128 C "C2'" "H2'" sing N N 129 C "O2'" "HO2'" sing N N 130 C "C1'" N1 sing N N 131 C "C1'" "H1'" sing N N 132 C N1 C2 sing N N 133 C N1 C6 sing N N 134 C C2 O2 doub N N 135 C C2 N3 sing N N 136 C N3 C4 doub N N 137 C C4 N4 sing N N 138 C C4 C5 sing N N 139 C N4 H41 sing N N 140 C N4 H42 sing N N 141 C C5 C6 doub N N 142 C C5 H5 sing N N 143 C C6 H6 sing N N 144 G OP3 P sing N N 145 G OP3 HOP3 sing N N 146 G P OP1 doub N N 147 G P OP2 sing N N 148 G P "O5'" sing N N 149 G OP2 HOP2 sing N N 150 G "O5'" "C5'" sing N N 151 G "C5'" "C4'" sing N N 152 G "C5'" "H5'" sing N N 153 G "C5'" "H5''" sing N N 154 G "C4'" "O4'" sing N N 155 G "C4'" "C3'" sing N N 156 G "C4'" "H4'" sing N N 157 G "O4'" "C1'" sing N N 158 G "C3'" "O3'" sing N N 159 G "C3'" "C2'" sing N N 160 G "C3'" "H3'" sing N N 161 G "O3'" "HO3'" sing N N 162 G "C2'" "O2'" sing N N 163 G "C2'" "C1'" sing N N 164 G "C2'" "H2'" sing N N 165 G "O2'" "HO2'" sing N N 166 G "C1'" N9 sing N N 167 G "C1'" "H1'" sing N N 168 G N9 C8 sing Y N 169 G N9 C4 sing Y N 170 G C8 N7 doub Y N 171 G C8 H8 sing N N 172 G N7 C5 sing Y N 173 G C5 C6 sing N N 174 G C5 C4 doub Y N 175 G C6 O6 doub N N 176 G C6 N1 sing N N 177 G N1 C2 sing N N 178 G N1 H1 sing N N 179 G C2 N2 sing N N 180 G C2 N3 doub N N 181 G N2 H21 sing N N 182 G N2 H22 sing N N 183 G N3 C4 sing N N 184 HOH O H1 sing N N 185 HOH O H2 sing N N 186 U OP3 P sing N N 187 U OP3 HOP3 sing N N 188 U P OP1 doub N N 189 U P OP2 sing N N 190 U P "O5'" sing N N 191 U OP2 HOP2 sing N N 192 U "O5'" "C5'" sing N N 193 U "C5'" "C4'" sing N N 194 U "C5'" "H5'" sing N N 195 U "C5'" "H5''" sing N N 196 U "C4'" "O4'" sing N N 197 U "C4'" "C3'" sing N N 198 U "C4'" "H4'" sing N N 199 U "O4'" "C1'" sing N N 200 U "C3'" "O3'" sing N N 201 U "C3'" "C2'" sing N N 202 U "C3'" "H3'" sing N N 203 U "O3'" "HO3'" sing N N 204 U "C2'" "O2'" sing N N 205 U "C2'" "C1'" sing N N 206 U "C2'" "H2'" sing N N 207 U "O2'" "HO2'" sing N N 208 U "C1'" N1 sing N N 209 U "C1'" "H1'" sing N N 210 U N1 C2 sing N N 211 U N1 C6 sing N N 212 U C2 O2 doub N N 213 U C2 N3 sing N N 214 U N3 C4 sing N N 215 U N3 H3 sing N N 216 U C4 O4 doub N N 217 U C4 C5 sing N N 218 U C5 C6 doub N N 219 U C5 H5 sing N N 220 U C6 H6 sing N N 221 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9J6P 'double helix' 9J6P 'a-form double helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 B C 22 1_555 -0.056 -0.214 0.175 1.598 -7.788 -3.593 1 A_G3:C23_B A 3 ? B 23 ? 19 1 1 A C 3 1_555 B G 21 1_555 -0.091 -0.101 -0.313 9.091 -14.327 -3.599 2 A_C4:G22_B A 4 ? B 22 ? 19 1 1 A G 4 1_555 B C 20 1_555 -0.184 -0.234 -0.279 -0.013 -8.606 1.164 3 A_G5:C21_B A 5 ? B 21 ? 19 1 1 A G 5 1_555 B C 19 1_555 -0.058 -0.350 -0.140 2.693 2.034 -3.570 4 A_G6:C20_B A 6 ? B 20 ? 19 1 1 A G 7 1_555 B G 16 1_555 1.603 3.616 0.448 -14.265 -2.221 -87.416 5 A_G8:G17_B A 8 ? B 17 ? 6 3 1 A U 8 1_555 B A 15 1_555 -0.130 -0.293 -0.216 2.767 -22.413 0.769 6 A_U9:A16_B A 9 ? B 16 ? 20 1 1 A C 9 1_555 B G 14 1_555 0.238 -0.338 0.224 6.235 -10.403 -1.327 7 A_C10:G15_B A 10 ? B 15 ? 19 1 1 A C 10 1_555 B G 13 1_555 0.004 -0.050 -0.227 3.152 -12.137 0.273 8 A_C11:G14_B A 11 ? B 14 ? 19 1 1 A C 11 1_555 B G 12 1_555 0.049 -0.129 0.063 4.881 -9.586 -3.067 9 A_C12:G13_B A 12 ? B 13 ? 19 1 1 A G 12 1_555 B C 11 1_555 -0.258 -0.162 -0.305 -10.765 -12.888 -3.681 10 A_G13:C12_B A 13 ? B 12 ? 19 1 1 A G 13 1_555 B C 10 1_555 0.063 -0.116 -0.259 -7.811 -9.791 0.286 11 A_G14:C11_B A 14 ? B 11 ? 19 1 1 A G 14 1_555 B C 9 1_555 -0.170 -0.092 0.281 -2.448 -9.589 -0.246 12 A_G15:C10_B A 15 ? B 10 ? 19 1 1 A A 15 1_555 B U 8 1_555 -0.041 -0.066 -0.096 -8.244 -10.410 2.052 13 A_A16:U9_B A 16 ? B 9 ? 20 1 1 A G 16 1_555 B G 7 1_555 -1.965 -3.436 -0.326 12.672 -6.622 86.481 14 A_G17:G8_B A 17 ? B 8 ? 6 3 1 A C 19 1_555 B G 5 1_555 -0.125 -0.205 0.216 -2.637 -2.701 -5.611 15 A_C20:G6_B A 20 ? B 6 ? 19 1 1 A C 20 1_555 B G 4 1_555 0.198 -0.235 -0.361 3.533 -3.448 -1.443 16 A_C21:G5_B A 21 ? B 5 ? 19 1 1 A G 21 1_555 B C 3 1_555 -0.029 -0.072 -0.322 -8.884 -11.836 -0.952 17 A_G22:C4_B A 22 ? B 4 ? 19 1 1 A C 22 1_555 B G 2 1_555 0.276 -0.016 0.074 2.081 -7.052 -2.689 18 A_C23:G3_B A 23 ? B 3 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 B C 22 1_555 A C 3 1_555 B G 21 1_555 -0.573 -1.901 3.088 2.447 -1.707 32.494 -3.102 1.425 3.130 -3.043 -4.361 32.627 1 AA_G3C4:G22C23_BB A 3 ? B 23 ? A 4 ? B 22 ? 1 A C 3 1_555 B G 21 1_555 A G 4 1_555 B C 20 1_555 0.762 -1.916 3.546 0.581 10.079 28.893 -5.614 -1.331 2.752 19.466 -1.121 30.570 2 AA_C4G5:C21G22_BB A 4 ? B 22 ? A 5 ? B 21 ? 1 A G 4 1_555 B C 20 1_555 A G 5 1_555 B C 19 1_555 -0.607 -1.983 3.273 -4.367 5.334 31.750 -4.448 0.347 2.964 9.608 7.867 32.471 3 AA_G5G6:C20C21_BB A 5 ? B 21 ? A 6 ? B 20 ? 1 A G 7 1_555 B G 16 1_555 A U 8 1_555 B A 15 1_555 -0.878 1.400 3.055 4.238 9.362 -20.502 -6.416 -0.902 2.333 -24.420 11.055 -22.909 4 AA_G8U9:A16G17_BB A 8 ? B 17 ? A 9 ? B 16 ? 1 A U 8 1_555 B A 15 1_555 A C 9 1_555 B G 14 1_555 0.220 -1.351 3.185 -5.465 6.269 34.298 -3.098 -1.120 2.834 10.440 9.102 35.263 5 AA_U9C10:G15A16_BB A 9 ? B 16 ? A 10 ? B 15 ? 1 A C 9 1_555 B G 14 1_555 A C 10 1_555 B G 13 1_555 0.405 -1.870 3.302 4.771 8.014 28.734 -5.133 0.139 2.724 15.636 -9.310 30.179 6 AA_C10C11:G14G15_BB A 10 ? B 15 ? A 11 ? B 14 ? 1 A C 10 1_555 B G 13 1_555 A C 11 1_555 B G 12 1_555 -0.332 -2.059 3.199 -3.445 5.336 31.432 -4.625 0.022 2.839 9.726 6.280 32.052 7 AA_C11C12:G13G14_BB A 11 ? B 14 ? A 12 ? B 13 ? 1 A C 11 1_555 B G 12 1_555 A G 12 1_555 B C 11 1_555 -0.154 -1.960 3.634 1.337 11.906 28.401 -6.009 0.551 2.610 23.015 -2.584 30.777 8 AA_C12G13:C12G13_BB A 12 ? B 13 ? A 13 ? B 12 ? 1 A G 12 1_555 B C 11 1_555 A G 13 1_555 B C 10 1_555 0.158 -1.828 3.118 -0.787 11.515 32.131 -4.693 -0.377 2.339 20.015 1.368 34.089 9 AA_G13G14:C11C12_BB A 13 ? B 12 ? A 14 ? B 11 ? 1 A G 13 1_555 B C 10 1_555 A G 14 1_555 B C 9 1_555 0.550 -1.946 3.089 -2.345 6.643 28.274 -5.136 -1.540 2.523 13.339 4.708 29.121 10 AA_G14G15:C10C11_BB A 14 ? B 11 ? A 15 ? B 10 ? 1 A G 14 1_555 B C 9 1_555 A A 15 1_555 B U 8 1_555 0.127 -1.644 3.271 5.544 9.104 33.271 -4.040 0.579 2.726 15.416 -9.387 34.891 11 AA_G15A16:U9C10_BB A 15 ? B 10 ? A 16 ? B 9 ? 1 A A 15 1_555 B U 8 1_555 A G 16 1_555 B G 7 1_555 0.167 3.079 -1.237 171.231 -34.284 -166.768 -1.553 0.015 -1.178 17.146 85.633 -179.381 12 AA_A16G17:G8U9_BB A 16 ? B 9 ? A 17 ? B 8 ? 1 A C 19 1_555 B G 5 1_555 A C 20 1_555 B G 4 1_555 1.018 -2.559 3.168 4.779 0.054 27.891 -5.248 -0.982 3.289 0.110 -9.823 28.290 13 AA_C20C21:G5G6_BB A 20 ? B 6 ? A 21 ? B 5 ? 1 A C 20 1_555 B G 4 1_555 A G 21 1_555 B C 3 1_555 -1.310 -2.253 3.854 -2.830 6.724 26.991 -6.452 1.961 3.323 14.082 5.926 27.942 14 AA_C21G22:C4G5_BB A 21 ? B 5 ? A 22 ? B 4 ? 1 A G 21 1_555 B C 3 1_555 A C 22 1_555 B G 2 1_555 0.292 -1.616 3.069 -2.887 0.096 34.364 -2.740 -0.912 3.031 0.162 4.875 34.482 15 AA_G22C23:G3C4_BB A 22 ? B 4 ? A 23 ? B 3 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'Japan Agency for Medical Research and Development (AMED)' Japan JP23ama121014 1 'Japan Science and Technology' Japan JPMJFR2002 2 'Japan Science and Technology' Japan JPMJSP2114 3 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'in silico model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details Coot # _atom_sites.entry_id 9J6P _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.021666 _atom_sites.fract_transf_matrix[1][2] 0.012509 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.025017 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.002975 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C N O P # loop_ #