data_9NBC # _entry.id 9NBC # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.410 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9NBC pdb_00009nbc 10.2210/pdb9nbc/pdb WWPDB D_1000292927 ? ? EMDB EMD-49226 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2026-03-04 ? 2 'EM metadata' 1 0 2026-03-04 ? 3 'Additional map' 1 0 2026-03-04 1 4 'Half map' 1 0 2026-03-04 1 5 'Half map' 1 0 2026-03-04 2 6 Image 1 0 2026-03-04 ? 7 Mask 1 0 2026-03-04 1 8 'Primary map' 1 0 2026-03-04 ? # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 2 'EM metadata' repository 'Initial release' ? ? 3 3 'Additional map' repository 'Initial release' ? ? 4 4 'Half map' repository 'Initial release' ? ? 5 5 'Half map' repository 'Initial release' ? ? 6 6 Image repository 'Initial release' ? ? 7 7 Mask repository 'Initial release' ? ? 8 8 'Primary map' repository 'Initial release' ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9NBC _pdbx_database_status.recvd_initial_deposition_date 2025-02-13 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'RNA scaffold attached to 8-oxoguanine riboswitch aptamer' _pdbx_database_related.db_id EMD-49226 _pdbx_database_related.content_type 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email adrian.ferre@nih.gov _pdbx_contact_author.name_first "Ferre-D'Amare" _pdbx_contact_author.name_last Adrian _pdbx_contact_author.name_mi R _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-4549-1619 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Jones, C.P.' 1 0000-0001-7780-5278 ;Ferre-D'Amare, A.R. ; 2 0000-0003-4549-1619 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Symmetric scaffolds enable de novo modelling of RNA by cryoEM' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Jones, C.P.' 1 0000-0001-7780-5278 primary ;Ferre-D'Amare, A.R. ; 2 0000-0003-4549-1619 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (63-MER)' 51445.496 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 3 non-polymer syn 8-OXOGUANINE 165.110 1 ? ? ? ? 4 water nat water 18.015 13 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGGCCACUGUUUCACUGUUGCGCUACAUCUCCUGUUCGUAUAACCCCGAUAAUCGGUUCGGGGGCUCUACUGGGGUCCGU AAAAUCCUAACUACGAACGGGAGGCCACACGAAAGUGUGGAGUGACCAGUGGCCCCACCCUGAAGGUAAACUUGUAGCGC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGGCCACUGUUUCACUGUUGCGCUACAUCUCCUGUUCGUAUAACCCCGAUAAUCGGUUCGGGGGCUCUACUGGGGUCCGU AAAAUCCUAACUACGAACGGGAGGCCACACGAAAGUGUGGAGUGACCAGUGGCCCCACCCUGAAGGUAAACUUGUAGCGC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 8-OXOGUANINE OXG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 C n 1 6 A n 1 7 C n 1 8 U n 1 9 G n 1 10 U n 1 11 U n 1 12 U n 1 13 C n 1 14 A n 1 15 C n 1 16 U n 1 17 G n 1 18 U n 1 19 U n 1 20 G n 1 21 C n 1 22 G n 1 23 C n 1 24 U n 1 25 A n 1 26 C n 1 27 A n 1 28 U n 1 29 C n 1 30 U n 1 31 C n 1 32 C n 1 33 U n 1 34 G n 1 35 U n 1 36 U n 1 37 C n 1 38 G n 1 39 U n 1 40 A n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 C n 1 47 C n 1 48 G n 1 49 A n 1 50 U n 1 51 A n 1 52 A n 1 53 U n 1 54 C n 1 55 G n 1 56 G n 1 57 U n 1 58 U n 1 59 C n 1 60 G n 1 61 G n 1 62 G n 1 63 G n 1 64 G n 1 65 C n 1 66 U n 1 67 C n 1 68 U n 1 69 A n 1 70 C n 1 71 U n 1 72 G n 1 73 G n 1 74 G n 1 75 G n 1 76 U n 1 77 C n 1 78 C n 1 79 G n 1 80 U n 1 81 A n 1 82 A n 1 83 A n 1 84 A n 1 85 U n 1 86 C n 1 87 C n 1 88 U n 1 89 A n 1 90 A n 1 91 C n 1 92 U n 1 93 A n 1 94 C n 1 95 G n 1 96 A n 1 97 A n 1 98 C n 1 99 G n 1 100 G n 1 101 G n 1 102 A n 1 103 G n 1 104 G n 1 105 C n 1 106 C n 1 107 A n 1 108 C n 1 109 A n 1 110 C n 1 111 G n 1 112 A n 1 113 A n 1 114 A n 1 115 G n 1 116 U n 1 117 G n 1 118 U n 1 119 G n 1 120 G n 1 121 A n 1 122 G n 1 123 U n 1 124 G n 1 125 A n 1 126 C n 1 127 C n 1 128 A n 1 129 G n 1 130 U n 1 131 G n 1 132 G n 1 133 C n 1 134 C n 1 135 C n 1 136 C n 1 137 A n 1 138 C n 1 139 C n 1 140 C n 1 141 U n 1 142 G n 1 143 A n 1 144 A n 1 145 G n 1 146 G n 1 147 U n 1 148 A n 1 149 A n 1 150 A n 1 151 C n 1 152 U n 1 153 U n 1 154 G n 1 155 U n 1 156 A n 1 157 G n 1 158 C n 1 159 G n 1 160 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 160 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 OXG non-polymer . 8-OXOGUANINE ? 'C5 H3 N5 O2' 165.110 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 ? ? ? A . n A 1 2 G 2 2 ? ? ? A . n A 1 3 G 3 3 ? ? ? A . n A 1 4 C 4 4 ? ? ? A . n A 1 5 C 5 5 ? ? ? A . n A 1 6 A 6 6 ? ? ? A . n A 1 7 C 7 7 ? ? ? A . n A 1 8 U 8 8 ? ? ? A . n A 1 9 G 9 9 ? ? ? A . n A 1 10 U 10 10 ? ? ? A . n A 1 11 U 11 11 ? ? ? A . n A 1 12 U 12 12 ? ? ? A . n A 1 13 C 13 13 ? ? ? A . n A 1 14 A 14 14 ? ? ? A . n A 1 15 C 15 15 ? ? ? A . n A 1 16 U 16 16 ? ? ? A . n A 1 17 G 17 17 ? ? ? A . n A 1 18 U 18 18 ? ? ? A . n A 1 19 U 19 19 ? ? ? A . n A 1 20 G 20 20 ? ? ? A . n A 1 21 C 21 21 ? ? ? A . n A 1 22 G 22 22 ? ? ? A . n A 1 23 C 23 23 ? ? ? A . n A 1 24 U 24 24 ? ? ? A . n A 1 25 A 25 25 ? ? ? A . n A 1 26 C 26 26 ? ? ? A . n A 1 27 A 27 27 ? ? ? A . n A 1 28 U 28 28 ? ? ? A . n A 1 29 C 29 29 ? ? ? A . n A 1 30 U 30 30 ? ? ? A . n A 1 31 C 31 31 ? ? ? A . n A 1 32 C 32 32 ? ? ? A . n A 1 33 U 33 33 ? ? ? A . n A 1 34 G 34 34 ? ? ? A . n A 1 35 U 35 35 35 U U A . n A 1 36 U 36 36 36 U U A . n A 1 37 C 37 37 37 C C A . n A 1 38 G 38 38 38 G G A . n A 1 39 U 39 39 39 U U A . n A 1 40 A 40 40 40 A A A . n A 1 41 U 41 41 41 U U A . n A 1 42 A 42 42 42 A A A . n A 1 43 A 43 43 43 A A A . n A 1 44 C 44 44 44 C C A . n A 1 45 C 45 45 45 C C A . n A 1 46 C 46 46 46 C C A . n A 1 47 C 47 47 47 C C A . n A 1 48 G 48 48 48 G G A . n A 1 49 A 49 49 49 A A A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 U 53 53 53 U U A . n A 1 54 C 54 54 54 C C A . n A 1 55 G 55 55 55 G G A . n A 1 56 G 56 56 56 G G A . n A 1 57 U 57 57 57 U U A . n A 1 58 U 58 58 58 U U A . n A 1 59 C 59 59 59 C C A . n A 1 60 G 60 60 60 G G A . n A 1 61 G 61 61 61 G G A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 G 64 64 64 G G A . n A 1 65 C 65 65 65 C C A . n A 1 66 U 66 66 66 U U A . n A 1 67 C 67 67 67 C C A . n A 1 68 U 68 68 68 U U A . n A 1 69 A 69 69 69 A A A . n A 1 70 C 70 70 70 C C A . n A 1 71 U 71 71 71 U U A . n A 1 72 G 72 72 72 G G A . n A 1 73 G 73 73 73 G G A . n A 1 74 G 74 74 74 G G A . n A 1 75 G 75 75 75 G G A . n A 1 76 U 76 76 76 U U A . n A 1 77 C 77 77 77 C C A . n A 1 78 C 78 78 78 C C A . n A 1 79 G 79 79 79 G G A . n A 1 80 U 80 80 80 U U A . n A 1 81 A 81 81 81 A A A . n A 1 82 A 82 82 82 A A A . n A 1 83 A 83 83 83 A A A . n A 1 84 A 84 84 84 A A A . n A 1 85 U 85 85 85 U U A . n A 1 86 C 86 86 86 C C A . n A 1 87 C 87 87 87 C C A . n A 1 88 U 88 88 88 U U A . n A 1 89 A 89 89 89 A A A . n A 1 90 A 90 90 90 A A A . n A 1 91 C 91 91 91 C C A . n A 1 92 U 92 92 92 U U A . n A 1 93 A 93 93 93 A A A . n A 1 94 C 94 94 94 C C A . n A 1 95 G 95 95 95 G G A . n A 1 96 A 96 96 96 A A A . n A 1 97 A 97 97 97 A A A . n A 1 98 C 98 98 ? ? ? A . n A 1 99 G 99 99 ? ? ? A . n A 1 100 G 100 100 ? ? ? A . n A 1 101 G 101 101 ? ? ? A . n A 1 102 A 102 102 ? ? ? A . n A 1 103 G 103 103 ? ? ? A . n A 1 104 G 104 104 ? ? ? A . n A 1 105 C 105 105 ? ? ? A . n A 1 106 C 106 106 ? ? ? A . n A 1 107 A 107 107 ? ? ? A . n A 1 108 C 108 108 ? ? ? A . n A 1 109 A 109 109 ? ? ? A . n A 1 110 C 110 110 ? ? ? A . n A 1 111 G 111 111 ? ? ? A . n A 1 112 A 112 112 ? ? ? A . n A 1 113 A 113 113 ? ? ? A . n A 1 114 A 114 114 ? ? ? A . n A 1 115 G 115 115 ? ? ? A . n A 1 116 U 116 116 ? ? ? A . n A 1 117 G 117 117 ? ? ? A . n A 1 118 U 118 118 ? ? ? A . n A 1 119 G 119 119 ? ? ? A . n A 1 120 G 120 120 ? ? ? A . n A 1 121 A 121 121 ? ? ? A . n A 1 122 G 122 122 ? ? ? A . n A 1 123 U 123 123 ? ? ? A . n A 1 124 G 124 124 ? ? ? A . n A 1 125 A 125 125 ? ? ? A . n A 1 126 C 126 126 ? ? ? A . n A 1 127 C 127 127 ? ? ? A . n A 1 128 A 128 128 ? ? ? A . n A 1 129 G 129 129 ? ? ? A . n A 1 130 U 130 130 ? ? ? A . n A 1 131 G 131 131 ? ? ? A . n A 1 132 G 132 132 ? ? ? A . n A 1 133 C 133 133 ? ? ? A . n A 1 134 C 134 134 ? ? ? A . n A 1 135 C 135 135 ? ? ? A . n A 1 136 C 136 136 ? ? ? A . n A 1 137 A 137 137 ? ? ? A . n A 1 138 C 138 138 ? ? ? A . n A 1 139 C 139 139 ? ? ? A . n A 1 140 C 140 140 ? ? ? A . n A 1 141 U 141 141 ? ? ? A . n A 1 142 G 142 142 ? ? ? A . n A 1 143 A 143 143 ? ? ? A . n A 1 144 A 144 144 ? ? ? A . n A 1 145 G 145 145 ? ? ? A . n A 1 146 G 146 146 ? ? ? A . n A 1 147 U 147 147 ? ? ? A . n A 1 148 A 148 148 ? ? ? A . n A 1 149 A 149 149 ? ? ? A . n A 1 150 A 150 150 ? ? ? A . n A 1 151 C 151 151 ? ? ? A . n A 1 152 U 152 152 ? ? ? A . n A 1 153 U 153 153 ? ? ? A . n A 1 154 G 154 154 ? ? ? A . n A 1 155 U 155 155 ? ? ? A . n A 1 156 A 156 156 ? ? ? A . n A 1 157 G 157 157 ? ? ? A . n A 1 158 C 158 158 ? ? ? A . n A 1 159 G 159 159 ? ? ? A . n A 1 160 C 160 160 ? ? ? A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id OXG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id OXG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 201 1 MG MG A . C 2 MG 1 202 3 MG MG A . D 3 OXG 1 203 1 OXG OXG A . E 4 HOH 1 301 17 HOH HOH A . E 4 HOH 2 302 8 HOH HOH A . E 4 HOH 3 303 7 HOH HOH A . E 4 HOH 4 304 11 HOH HOH A . E 4 HOH 5 305 12 HOH HOH A . E 4 HOH 6 306 16 HOH HOH A . E 4 HOH 7 307 18 HOH HOH A . E 4 HOH 8 308 4 HOH HOH A . E 4 HOH 9 309 14 HOH HOH A . E 4 HOH 10 310 9 HOH HOH A . E 4 HOH 11 311 15 HOH HOH A . E 4 HOH 12 312 10 HOH HOH A . E 4 HOH 13 313 13 HOH HOH A . # loop_ _pdbx_unobs_or_zero_occ_atoms.id _pdbx_unobs_or_zero_occ_atoms.PDB_model_num _pdbx_unobs_or_zero_occ_atoms.polymer_flag _pdbx_unobs_or_zero_occ_atoms.occupancy_flag _pdbx_unobs_or_zero_occ_atoms.auth_asym_id _pdbx_unobs_or_zero_occ_atoms.auth_comp_id _pdbx_unobs_or_zero_occ_atoms.auth_seq_id _pdbx_unobs_or_zero_occ_atoms.PDB_ins_code _pdbx_unobs_or_zero_occ_atoms.auth_atom_id _pdbx_unobs_or_zero_occ_atoms.label_alt_id _pdbx_unobs_or_zero_occ_atoms.label_asym_id _pdbx_unobs_or_zero_occ_atoms.label_comp_id _pdbx_unobs_or_zero_occ_atoms.label_seq_id _pdbx_unobs_or_zero_occ_atoms.label_atom_id 1 1 Y 1 A U 80 ? C2 ? A U 80 C2 2 1 Y 1 A U 80 ? O2 ? A U 80 O2 3 1 Y 1 A U 80 ? N3 ? A U 80 N3 4 1 Y 1 A U 80 ? C4 ? A U 80 C4 5 1 Y 1 A U 80 ? O4 ? A U 80 O4 6 1 Y 1 A U 80 ? C5 ? A U 80 C5 7 1 Y 1 A U 80 ? C6 ? A U 80 C6 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9NBC _cell.details ? _cell.formula_units_Z ? _cell.length_a 1.00 _cell.length_a_esd ? _cell.length_b 1.00 _cell.length_b_esd ? _cell.length_c 1.00 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB ? _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9NBC _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9NBC _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9NBC _refine.pdbx_refine_id 'ELECTRON MICROSCOPY' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.87 _refine.ls_d_res_low ? _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs ? _refine.ls_number_reflns_R_free ? _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs ? _refine.ls_percent_reflns_R_free ? _refine.ls_R_factor_all ? _refine.ls_R_factor_obs ? _refine.ls_R_factor_R_free ? _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work ? _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details ? _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F ? _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method ? _refine.pdbx_method_to_determine_struct ? _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS)' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii ? _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii ? _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error ? _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id ? _refine.overall_SU_B ? _refine.overall_SU_ML ? _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_restraint_function 'ELECTRON MICROSCOPY' ? 0.009 ? 1498 ? f_bond_d ? ? 'ELECTRON MICROSCOPY' ? 1.320 ? 2330 ? f_angle_d ? ? 'ELECTRON MICROSCOPY' ? 20.836 ? 752 ? f_dihedral_angle_d ? ? 'ELECTRON MICROSCOPY' ? 0.058 ? 315 ? f_chiral_restr ? ? 'ELECTRON MICROSCOPY' ? 0.007 ? 63 ? f_plane_restr ? ? # _struct.entry_id 9NBC _struct.title 'RNA scaffold attached to 8-oxoguanine riboswitch aptamer' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9NBC _struct_keywords.text 'viral RNA, scaffold, engineering, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9NBC _struct_ref.pdbx_db_accession 9NBC _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9NBC _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 160 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9NBC _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 160 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 160 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A G 38 N2 ? ? ? 1_555 C MG . MG ? ? A G 38 A MG 202 1_555 ? ? ? ? ? ? ? 2.076 ? ? metalc2 metalc ? ? A A 40 OP2 ? ? ? 1_555 B MG . MG ? ? A A 40 A MG 201 1_555 ? ? ? ? ? ? ? 1.938 ? ? metalc3 metalc ? ? A A 42 OP1 ? ? ? 1_555 B MG . MG ? ? A A 42 A MG 201 1_555 ? ? ? ? ? ? ? 2.848 ? ? hydrog1 hydrog ? ? A U 35 O4 ? ? ? 1_555 A A 97 N6 ? ? A U 35 A A 97 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog2 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 96 N1 ? ? A U 36 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A U 36 O4 ? ? ? 1_555 A A 96 N6 ? ? A U 36 A A 96 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A C 37 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 37 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A C 37 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 37 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A C 37 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 37 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A G 38 N1 ? ? ? 1_555 A C 94 N3 ? ? A G 38 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A G 38 N2 ? ? ? 1_555 A C 94 O2 ? ? A G 38 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 38 O6 ? ? ? 1_555 A C 94 N4 ? ? A G 38 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A U 39 N3 ? ? ? 1_555 A A 93 N1 ? ? A U 39 A A 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A U 39 O4 ? ? ? 1_555 A A 93 N6 ? ? A U 39 A A 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A A 40 N1 ? ? ? 1_555 A U 92 N3 ? ? A A 40 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A A 40 N6 ? ? ? 1_555 A U 92 O4 ? ? A A 40 A U 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 41 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 41 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 41 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 41 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 42 N6 ? ? ? 1_555 A G 64 N3 ? ? A A 42 A G 64 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog17 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 63 N1 ? ? A C 44 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 63 O6 ? ? A C 44 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 63 N2 ? ? A C 44 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 45 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 45 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 45 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 45 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 45 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 45 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 46 N3 ? ? ? 1_555 A G 61 N1 ? ? A C 46 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 46 N4 ? ? ? 1_555 A G 61 O6 ? ? A C 46 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 46 O2 ? ? ? 1_555 A G 61 N2 ? ? A C 46 A G 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 48 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 48 A C 59 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog27 hydrog ? ? A A 49 N1 ? ? ? 1_555 A U 58 N3 ? ? A A 49 A U 58 1_555 ? ? ? ? ? ? 'A-U PAIR' ? ? ? hydrog28 hydrog ? ? A U 50 O2 ? ? ? 1_555 A U 57 N3 ? ? A U 50 A U 57 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog29 hydrog ? ? A A 52 N1 ? ? ? 1_555 A A 83 N6 ? ? A A 52 A A 83 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog30 hydrog ? ? A G 55 N1 ? ? ? 1_555 A C 78 N3 ? ? A G 55 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 55 N2 ? ? ? 1_555 A C 78 O2 ? ? A G 55 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 55 O6 ? ? ? 1_555 A C 78 N4 ? ? A G 55 A C 78 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A G 56 N1 ? ? ? 1_555 A C 77 O2 ? ? A G 56 A C 77 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog34 hydrog ? ? A G 56 N2 ? ? ? 1_555 A A 83 N1 ? ? A G 56 A A 83 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog35 hydrog ? ? A G 56 N3 ? ? ? 1_555 A A 83 N6 ? ? A G 56 A A 83 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog36 hydrog ? ? A G 64 N1 ? ? ? 1_555 A C 70 N3 ? ? A G 64 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 64 N2 ? ? ? 1_555 A C 70 O2 ? ? A G 64 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 64 O6 ? ? ? 1_555 A C 70 N4 ? ? A G 64 A C 70 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 66 N3 ? ? ? 1_555 A A 93 N3 ? ? A U 66 A A 93 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog40 hydrog ? ? A C 67 N4 ? ? ? 1_555 A U 92 O2 ? ? A C 67 A U 92 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog41 hydrog ? ? A U 71 N3 ? ? ? 1_555 A A 89 N1 ? ? A U 71 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A U 71 O4 ? ? ? 1_555 A A 89 N6 ? ? A U 71 A A 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 72 N1 ? ? ? 1_555 A U 88 O2 ? ? A G 72 A U 88 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog44 hydrog ? ? A G 72 O6 ? ? ? 1_555 A U 88 N3 ? ? A G 72 A U 88 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog45 hydrog ? ? A G 73 N1 ? ? ? 1_555 A C 87 N3 ? ? A G 73 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 73 N2 ? ? ? 1_555 A C 87 O2 ? ? A G 73 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 73 O6 ? ? ? 1_555 A C 87 N4 ? ? A G 73 A C 87 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 74 N1 ? ? ? 1_555 A C 86 O2 ? ? A G 74 A C 86 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog49 hydrog ? ? A G 75 N1 ? ? ? 1_555 A U 85 O2 ? ? A G 75 A U 85 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog50 hydrog ? ? A G 75 O6 ? ? ? 1_555 A U 85 N3 ? ? A G 75 A U 85 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog51 hydrog ? ? A U 76 N3 ? ? ? 1_555 A A 84 N1 ? ? A U 76 A A 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A U 76 O4 ? ? ? 1_555 A A 84 N6 ? ? A U 76 A A 84 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id OP2 _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id A _pdbx_struct_conn_angle.ptnr1_label_seq_id 40 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id A _pdbx_struct_conn_angle.ptnr1_auth_comp_id A _pdbx_struct_conn_angle.ptnr1_auth_seq_id 40 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id B _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id A _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 201 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 1_555 _pdbx_struct_conn_angle.ptnr3_label_atom_id OP1 _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id A _pdbx_struct_conn_angle.ptnr3_label_comp_id A _pdbx_struct_conn_angle.ptnr3_label_seq_id 42 _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id A _pdbx_struct_conn_angle.ptnr3_auth_comp_id A _pdbx_struct_conn_angle.ptnr3_auth_seq_id 42 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 104.4 _pdbx_struct_conn_angle.value_esd ? # _pdbx_entry_details.entry_id 9NBC _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O2'" A A 43 ? ? "O2'" A C 70 ? ? 2.12 2 1 O A HOH 304 ? ? O A HOH 305 ? ? 2.18 3 1 OP2 A U 41 ? ? O A HOH 301 ? ? 2.19 # _pdbx_validate_rmsd_bond.id 1 _pdbx_validate_rmsd_bond.PDB_model_num 1 _pdbx_validate_rmsd_bond.auth_atom_id_1 "C5'" _pdbx_validate_rmsd_bond.auth_asym_id_1 A _pdbx_validate_rmsd_bond.auth_comp_id_1 G _pdbx_validate_rmsd_bond.auth_seq_id_1 63 _pdbx_validate_rmsd_bond.PDB_ins_code_1 ? _pdbx_validate_rmsd_bond.label_alt_id_1 ? _pdbx_validate_rmsd_bond.auth_atom_id_2 "C4'" _pdbx_validate_rmsd_bond.auth_asym_id_2 A _pdbx_validate_rmsd_bond.auth_comp_id_2 G _pdbx_validate_rmsd_bond.auth_seq_id_2 63 _pdbx_validate_rmsd_bond.PDB_ins_code_2 ? _pdbx_validate_rmsd_bond.label_alt_id_2 ? _pdbx_validate_rmsd_bond.bond_value 1.460 _pdbx_validate_rmsd_bond.bond_target_value 1.508 _pdbx_validate_rmsd_bond.bond_deviation -0.048 _pdbx_validate_rmsd_bond.bond_standard_deviation 0.007 _pdbx_validate_rmsd_bond.linker_flag N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C6 A C 65 ? ? N1 A C 65 ? ? C2 A C 65 ? ? 117.77 120.30 -2.53 0.40 N 2 1 C5 A C 65 ? ? C6 A C 65 ? ? N1 A C 65 ? ? 125.07 121.00 4.07 0.50 N 3 1 C4 A G 75 ? ? N9 A G 75 ? ? "C1'" A G 75 ? ? 134.86 126.50 8.36 1.30 N # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 9NBC _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol ? # _em_3d_reconstruction.entry_id 9NBC _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 2.87 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 910461 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 7.4 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type COMPLEX _em_entity_assembly.name 'Scaffold RNA attached to 8-oxoguanine aptamer bound to 8-oxoguanine' _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 9NBC _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'SPOT SCAN' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_min 500 _em_imaging.nominal_defocus_max 2500 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification ? _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? # _em_vitrification.entry_id 9NBC _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 277 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 9NBC _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A G 1 ? A G 1 2 1 Y 1 A G 2 ? A G 2 3 1 Y 1 A G 3 ? A G 3 4 1 Y 1 A C 4 ? A C 4 5 1 Y 1 A C 5 ? A C 5 6 1 Y 1 A A 6 ? A A 6 7 1 Y 1 A C 7 ? A C 7 8 1 Y 1 A U 8 ? A U 8 9 1 Y 1 A G 9 ? A G 9 10 1 Y 1 A U 10 ? A U 10 11 1 Y 1 A U 11 ? A U 11 12 1 Y 1 A U 12 ? A U 12 13 1 Y 1 A C 13 ? A C 13 14 1 Y 1 A A 14 ? A A 14 15 1 Y 1 A C 15 ? A C 15 16 1 Y 1 A U 16 ? A U 16 17 1 Y 1 A G 17 ? A G 17 18 1 Y 1 A U 18 ? A U 18 19 1 Y 1 A U 19 ? A U 19 20 1 Y 1 A G 20 ? A G 20 21 1 Y 1 A C 21 ? A C 21 22 1 Y 1 A G 22 ? A G 22 23 1 Y 1 A C 23 ? A C 23 24 1 Y 1 A U 24 ? A U 24 25 1 Y 1 A A 25 ? A A 25 26 1 Y 1 A C 26 ? A C 26 27 1 Y 1 A A 27 ? A A 27 28 1 Y 1 A U 28 ? A U 28 29 1 Y 1 A C 29 ? A C 29 30 1 Y 1 A U 30 ? A U 30 31 1 Y 1 A C 31 ? A C 31 32 1 Y 1 A C 32 ? A C 32 33 1 Y 1 A U 33 ? A U 33 34 1 Y 1 A G 34 ? A G 34 35 1 Y 1 A C 98 ? A C 98 36 1 Y 1 A G 99 ? A G 99 37 1 Y 1 A G 100 ? A G 100 38 1 Y 1 A G 101 ? A G 101 39 1 Y 1 A A 102 ? A A 102 40 1 Y 1 A G 103 ? A G 103 41 1 Y 1 A G 104 ? A G 104 42 1 Y 1 A C 105 ? A C 105 43 1 Y 1 A C 106 ? A C 106 44 1 Y 1 A A 107 ? A A 107 45 1 Y 1 A C 108 ? A C 108 46 1 Y 1 A A 109 ? A A 109 47 1 Y 1 A C 110 ? A C 110 48 1 Y 1 A G 111 ? A G 111 49 1 Y 1 A A 112 ? A A 112 50 1 Y 1 A A 113 ? A A 113 51 1 Y 1 A A 114 ? A A 114 52 1 Y 1 A G 115 ? A G 115 53 1 Y 1 A U 116 ? A U 116 54 1 Y 1 A G 117 ? A G 117 55 1 Y 1 A U 118 ? A U 118 56 1 Y 1 A G 119 ? A G 119 57 1 Y 1 A G 120 ? A G 120 58 1 Y 1 A A 121 ? A A 121 59 1 Y 1 A G 122 ? A G 122 60 1 Y 1 A U 123 ? A U 123 61 1 Y 1 A G 124 ? A G 124 62 1 Y 1 A A 125 ? A A 125 63 1 Y 1 A C 126 ? A C 126 64 1 Y 1 A C 127 ? A C 127 65 1 Y 1 A A 128 ? A A 128 66 1 Y 1 A G 129 ? A G 129 67 1 Y 1 A U 130 ? A U 130 68 1 Y 1 A G 131 ? A G 131 69 1 Y 1 A G 132 ? A G 132 70 1 Y 1 A C 133 ? A C 133 71 1 Y 1 A C 134 ? A C 134 72 1 Y 1 A C 135 ? A C 135 73 1 Y 1 A C 136 ? A C 136 74 1 Y 1 A A 137 ? A A 137 75 1 Y 1 A C 138 ? A C 138 76 1 Y 1 A C 139 ? A C 139 77 1 Y 1 A C 140 ? A C 140 78 1 Y 1 A U 141 ? A U 141 79 1 Y 1 A G 142 ? A G 142 80 1 Y 1 A A 143 ? A A 143 81 1 Y 1 A A 144 ? A A 144 82 1 Y 1 A G 145 ? A G 145 83 1 Y 1 A G 146 ? A G 146 84 1 Y 1 A U 147 ? A U 147 85 1 Y 1 A A 148 ? A A 148 86 1 Y 1 A A 149 ? A A 149 87 1 Y 1 A A 150 ? A A 150 88 1 Y 1 A C 151 ? A C 151 89 1 Y 1 A U 152 ? A U 152 90 1 Y 1 A U 153 ? A U 153 91 1 Y 1 A G 154 ? A G 154 92 1 Y 1 A U 155 ? A U 155 93 1 Y 1 A A 156 ? A A 156 94 1 Y 1 A G 157 ? A G 157 95 1 Y 1 A C 158 ? A C 158 96 1 Y 1 A G 159 ? A G 159 97 1 Y 1 A C 160 ? A C 160 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 MG MG MG N N 114 OXG N9 N N N 115 OXG C8 C N N 116 OXG N7 N N N 117 OXG C5 C N N 118 OXG C6 C N N 119 OXG O6 O N N 120 OXG N1 N N N 121 OXG C2 C N N 122 OXG N2 N N N 123 OXG N3 N N N 124 OXG C4 C N N 125 OXG O8 O N N 126 OXG H1 H N N 127 OXG H21 H N N 128 OXG H22 H N N 129 U OP3 O N N 130 U P P N N 131 U OP1 O N N 132 U OP2 O N N 133 U "O5'" O N N 134 U "C5'" C N N 135 U "C4'" C N R 136 U "O4'" O N N 137 U "C3'" C N S 138 U "O3'" O N N 139 U "C2'" C N R 140 U "O2'" O N N 141 U "C1'" C N R 142 U N1 N N N 143 U C2 C N N 144 U O2 O N N 145 U N3 N N N 146 U C4 C N N 147 U O4 O N N 148 U C5 C N N 149 U C6 C N N 150 U HOP3 H N N 151 U HOP2 H N N 152 U "H5'" H N N 153 U "H5''" H N N 154 U "H4'" H N N 155 U "H3'" H N N 156 U "HO3'" H N N 157 U "H2'" H N N 158 U "HO2'" H N N 159 U "H1'" H N N 160 U H3 H N N 161 U H5 H N N 162 U H6 H N N 163 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 OXG N9 C8 sing N N 118 OXG N9 C4 doub N N 119 OXG C8 N7 sing N N 120 OXG C8 O8 doub N N 121 OXG N7 C5 doub N N 122 OXG C5 C6 sing N N 123 OXG C5 C4 sing N N 124 OXG C6 O6 doub N N 125 OXG C6 N1 sing N N 126 OXG N1 C2 sing N N 127 OXG N1 H1 sing N N 128 OXG C2 N2 sing N N 129 OXG C2 N3 doub N N 130 OXG N2 H21 sing N N 131 OXG N2 H22 sing N N 132 OXG N3 C4 sing N N 133 U OP3 P sing N N 134 U OP3 HOP3 sing N N 135 U P OP1 doub N N 136 U P OP2 sing N N 137 U P "O5'" sing N N 138 U OP2 HOP2 sing N N 139 U "O5'" "C5'" sing N N 140 U "C5'" "C4'" sing N N 141 U "C5'" "H5'" sing N N 142 U "C5'" "H5''" sing N N 143 U "C4'" "O4'" sing N N 144 U "C4'" "C3'" sing N N 145 U "C4'" "H4'" sing N N 146 U "O4'" "C1'" sing N N 147 U "C3'" "O3'" sing N N 148 U "C3'" "C2'" sing N N 149 U "C3'" "H3'" sing N N 150 U "O3'" "HO3'" sing N N 151 U "C2'" "O2'" sing N N 152 U "C2'" "C1'" sing N N 153 U "C2'" "H2'" sing N N 154 U "O2'" "HO2'" sing N N 155 U "C1'" N1 sing N N 156 U "C1'" "H1'" sing N N 157 U N1 C2 sing N N 158 U N1 C6 sing N N 159 U C2 O2 doub N N 160 U C2 N3 sing N N 161 U N3 C4 sing N N 162 U N3 H3 sing N N 163 U C4 O4 doub N N 164 U C4 C5 sing N N 165 U C5 C6 doub N N 166 U C5 H5 sing N N 167 U C6 H6 sing N N 168 # _em_admin.current_status REL _em_admin.deposition_date 2025-02-13 _em_admin.deposition_site RCSB _em_admin.entry_id 9NBC _em_admin.last_update 2026-03-04 _em_admin.map_release_date 2026-03-04 _em_admin.title 'RNA scaffold attached to 8-oxoguanine riboswitch aptamer' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 32644 _em_entity_assembly_naturalsource.organism unidentified _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 905931 _em_entity_assembly_recombinant.organism 'in vitro transcription vector pT7-TP(deltai)' _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 60 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K3 BIOQUANTUM (6k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' ? 1 1 ? ? ? ? 'MODEL REFINEMENT' ? 2 ? ? ? PHENIX 1.19.2_4158 'IMAGE ACQUISITION' ? 3 ? ? 1 ? ? MASKING ? 4 ? ? ? ? ? 'CTF CORRECTION' ? 5 1 ? ? ? ? 'LAYERLINE INDEXING' ? 6 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 7 ? ? ? ? ? 'MODEL FITTING' ? 8 ? ? ? ? ? OTHER ? 9 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 11 1 ? ? ? ? CLASSIFICATION ? 12 1 ? ? ? ? RECONSTRUCTION ? 13 1 ? ? ? ? # _em_specimen.concentration ? _em_specimen.details 'RNA scaffold attached to 8-oxoguanine riboswitch aptamer' _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9NBC 'double helix' 9NBC 'a-form double helix' 9NBC 'mismatched base pair' 9NBC 'internal loop' 9NBC 'triple helix' 9NBC 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A U 35 1_555 A A 97 1_555 0.162 1.511 -0.202 -14.489 -18.627 -54.679 1 A_U35:A97_A A 35 ? A 97 ? ? ? 1 A U 36 1_555 A A 96 1_555 -0.194 -0.069 0.811 -3.845 -11.751 -11.008 2 A_U36:A96_A A 36 ? A 96 ? 20 1 1 A C 37 1_555 A G 95 1_555 0.142 -0.121 0.341 -2.261 -10.273 1.714 3 A_C37:G95_A A 37 ? A 95 ? 19 1 1 A G 38 1_555 A C 94 1_555 -0.253 -0.281 0.322 -0.106 -9.964 -2.269 4 A_G38:C94_A A 38 ? A 94 ? 19 1 1 A U 39 1_555 A A 93 1_555 -0.072 -0.131 -0.120 0.931 -6.905 0.526 5 A_U39:A93_A A 39 ? A 93 ? 20 1 1 A A 40 1_555 A U 92 1_555 0.058 -0.167 0.762 4.557 -4.398 0.265 6 A_A40:U92_A A 40 ? A 92 ? 20 1 1 A U 57 1_555 A U 50 1_555 -5.318 -2.712 2.289 -5.385 -43.694 30.278 7 A_U57:U50_A A 57 ? A 50 ? ? ? 1 A U 58 1_555 A A 49 1_555 -2.496 0.034 1.113 -32.605 -27.171 -5.174 8 A_U58:A49_A A 58 ? A 49 ? ? 1 1 A C 59 1_555 A G 48 1_555 -1.967 0.097 -0.761 -5.214 -23.021 -8.054 9 A_C59:G48_A A 59 ? A 48 ? ? 1 1 A G 61 1_555 A C 46 1_555 -0.262 -0.248 0.404 3.295 -3.548 -0.414 10 A_G61:C46_A A 61 ? A 46 ? 19 1 1 A G 62 1_555 A C 45 1_555 -0.213 -0.244 0.289 -3.585 -9.349 -0.749 11 A_G62:C45_A A 62 ? A 45 ? 19 1 1 A G 63 1_555 A C 44 1_555 -0.137 -0.038 0.196 0.436 1.813 2.332 12 A_G63:C44_A A 63 ? A 44 ? 19 1 1 A G 64 1_555 A C 70 1_555 -0.176 -0.118 -0.464 -10.000 1.587 -1.350 13 A_G64:C70_A A 64 ? A 70 ? 19 1 1 A U 41 1_555 A A 69 1_555 -0.035 -0.071 -0.145 6.423 3.655 -1.733 14 A_U41:A69_A A 41 ? A 69 ? 20 1 1 A G 55 1_555 A C 78 1_555 -0.418 0.101 -0.052 -11.276 -25.540 14.060 15 A_G55:C78_A A 55 ? A 78 ? 19 1 1 A G 56 1_555 A A 83 1_555 3.209 -3.637 0.823 20.426 -11.277 -66.491 16 A_G56:A83_A A 56 ? A 83 ? 10 6 1 A U 76 1_555 A A 84 1_555 -0.025 -0.135 -1.342 13.591 -3.095 -2.809 17 A_U76:A84_A A 76 ? A 84 ? 20 1 1 A G 75 1_555 A U 85 1_555 -1.757 -0.343 -0.754 4.456 2.119 -3.194 18 A_G75:U85_A A 75 ? A 85 ? 28 1 1 A G 74 1_555 A C 86 1_555 -2.523 -0.554 -0.445 9.875 0.004 -9.006 19 A_G74:C86_A A 74 ? A 86 ? ? 1 1 A G 73 1_555 A C 87 1_555 -0.220 -0.184 0.647 4.277 3.127 1.480 20 A_G73:C87_A A 73 ? A 87 ? 19 1 1 A G 72 1_555 A U 88 1_555 -1.962 -0.557 1.010 3.558 4.845 3.306 21 A_G72:U88_A A 72 ? A 88 ? 28 1 1 A U 71 1_555 A A 89 1_555 -0.015 -0.090 -0.150 -8.733 -11.549 3.178 22 A_U71:A89_A A 71 ? A 89 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A U 35 1_555 A A 97 1_555 A U 36 1_555 A A 96 1_555 1.705 -1.352 3.057 -7.758 1.169 28.635 -2.853 -4.734 2.464 2.309 15.326 29.669 1 AA_U35U36:A96A97_AA A 35 ? A 97 ? A 36 ? A 96 ? 1 A U 36 1_555 A A 96 1_555 A C 37 1_555 A G 95 1_555 0.557 -1.564 3.075 2.276 0.332 36.486 -2.536 -0.592 3.089 0.529 -3.631 36.556 2 AA_U36C37:G95A96_AA A 36 ? A 96 ? A 37 ? A 95 ? 1 A C 37 1_555 A G 95 1_555 A G 38 1_555 A C 94 1_555 -0.354 -1.744 2.933 -4.710 6.814 29.391 -4.463 -0.122 2.501 13.105 9.058 30.511 3 AA_C37G38:C94G95_AA A 37 ? A 95 ? A 38 ? A 94 ? 1 A G 38 1_555 A C 94 1_555 A U 39 1_555 A A 93 1_555 -0.167 -1.313 3.267 3.873 5.696 32.603 -3.205 0.913 2.963 10.007 -6.804 33.304 4 AA_G38U39:A93C94_AA A 38 ? A 94 ? A 39 ? A 93 ? 1 A U 39 1_555 A A 93 1_555 A A 40 1_555 A U 92 1_555 0.534 -1.419 2.951 -4.003 7.949 35.216 -3.221 -1.332 2.509 12.886 6.489 36.288 5 AA_U39A40:U92A93_AA A 39 ? A 93 ? A 40 ? A 92 ? 1 A U 57 1_555 A U 50 1_555 A U 58 1_555 A A 49 1_555 -1.675 -1.510 4.411 0.228 0.588 44.158 -2.083 2.257 4.383 0.782 -0.303 44.162 6 AA_U57U58:A49U50_AA A 57 ? A 50 ? A 58 ? A 49 ? 1 A U 58 1_555 A A 49 1_555 A C 59 1_555 A G 48 1_555 -0.376 -0.424 2.864 10.616 3.094 28.238 -1.343 2.544 2.503 6.057 -20.780 30.285 7 AA_U58C59:G48A49_AA A 58 ? A 49 ? A 59 ? A 48 ? 1 A C 59 1_555 A G 48 1_555 A G 61 1_555 A C 46 1_555 1.552 -4.250 5.912 -5.487 22.120 67.118 -4.947 -1.659 4.382 19.442 4.823 70.450 8 AA_C59G61:C46G48_AA A 59 ? A 48 ? A 61 ? A 46 ? 1 A G 61 1_555 A C 46 1_555 A G 62 1_555 A C 45 1_555 0.728 -2.320 3.083 2.681 5.286 30.398 -5.258 -0.902 2.703 9.961 -5.052 30.957 9 AA_G61G62:C45C46_AA A 61 ? A 46 ? A 62 ? A 45 ? 1 A G 62 1_555 A C 45 1_555 A G 63 1_555 A C 44 1_555 0.083 -1.696 3.069 2.278 6.557 31.649 -4.069 0.208 2.673 11.845 -4.115 32.382 10 AA_G62G63:C44C45_AA A 62 ? A 45 ? A 63 ? A 44 ? 1 A G 63 1_555 A C 44 1_555 A G 64 1_555 A C 70 1_555 2.634 -0.921 3.569 13.021 5.792 50.641 -1.488 -1.974 3.968 6.622 -14.887 52.481 11 AA_G63G64:C70C44_AA A 63 ? A 44 ? A 64 ? A 70 ? 1 A G 64 1_555 A C 70 1_555 A U 41 1_555 A A 69 1_555 -1.927 -0.954 3.056 -5.567 5.585 38.090 -2.083 2.248 3.131 8.447 8.420 38.868 12 AA_G64U41:A69C70_AA A 64 ? A 70 ? A 41 ? A 69 ? 1 A G 55 1_555 A C 78 1_555 A G 56 1_555 A A 83 1_555 -3.633 -0.203 2.729 -28.357 -2.169 59.023 -0.091 2.095 3.951 -2.076 27.144 64.957 13 AA_G55G56:A83C78_AA A 55 ? A 78 ? A 56 ? A 83 ? 1 A G 56 1_555 A A 83 1_555 A U 76 1_555 A A 84 1_555 2.833 -3.621 -2.671 -157.795 -45.061 -67.167 1.622 2.129 -0.050 23.501 -82.294 -166.769 14 AA_G56U76:A84A83_AA A 56 ? A 83 ? A 76 ? A 84 ? 1 A U 76 1_555 A A 84 1_555 A G 75 1_555 A U 85 1_555 -0.376 1.089 -2.850 -1.232 -2.105 -36.267 -2.000 -0.455 -2.795 3.378 -1.976 -36.346 15 AA_U76G75:U85A84_AA A 76 ? A 84 ? A 75 ? A 85 ? 1 A G 75 1_555 A U 85 1_555 A G 74 1_555 A C 86 1_555 0.443 1.574 -3.087 6.131 -4.833 -42.803 -2.558 0.047 -2.934 6.557 8.318 -43.476 16 AA_G75G74:C86U85_AA A 75 ? A 85 ? A 74 ? A 86 ? 1 A G 74 1_555 A C 86 1_555 A G 73 1_555 A C 87 1_555 -0.104 1.836 -3.010 -3.502 -7.142 -15.800 -9.412 1.348 -1.976 24.092 -11.814 -17.678 17 AA_G74G73:C87C86_AA A 74 ? A 86 ? A 73 ? A 87 ? 1 A G 73 1_555 A C 87 1_555 A G 72 1_555 A U 88 1_555 0.052 1.723 -3.020 0.432 -2.926 -40.847 -2.753 0.031 -2.896 4.186 0.619 -40.950 18 AA_G73G72:U88C87_AA A 73 ? A 87 ? A 72 ? A 88 ? 1 A G 72 1_555 A U 88 1_555 A U 71 1_555 A A 89 1_555 -0.108 1.433 -2.701 13.139 -0.203 -24.161 -3.060 -2.878 -2.321 0.446 28.822 -27.456 19 AA_G72U71:A89U88_AA A 72 ? A 88 ? A 71 ? A 89 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9NBC _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ #