data_9NDV # _entry.id 9NDV # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.410 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9NDV pdb_00009ndv 10.2210/pdb9ndv/pdb WWPDB D_1000293138 ? ? EMDB EMD-49278 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date _pdbx_audit_revision_history.part_number 1 'Structure model' 1 0 2026-03-04 ? 2 'EM metadata' 1 0 2026-03-04 ? 3 'Additional map' 1 0 2026-03-04 1 4 'Half map' 1 0 2026-03-04 1 5 'Half map' 1 0 2026-03-04 2 6 Image 1 0 2026-03-04 ? 7 Mask 1 0 2026-03-04 1 8 'Primary map' 1 0 2026-03-04 ? # loop_ _pdbx_audit_revision_details.ordinal _pdbx_audit_revision_details.revision_ordinal _pdbx_audit_revision_details.data_content_type _pdbx_audit_revision_details.provider _pdbx_audit_revision_details.type _pdbx_audit_revision_details.description _pdbx_audit_revision_details.details 1 1 'Structure model' repository 'Initial release' ? ? 2 2 'EM metadata' repository 'Initial release' ? ? 3 3 'Additional map' repository 'Initial release' ? ? 4 4 'Half map' repository 'Initial release' ? ? 5 5 'Half map' repository 'Initial release' ? ? 6 6 Image repository 'Initial release' ? ? 7 7 Mask repository 'Initial release' ? ? 8 8 'Primary map' repository 'Initial release' ? ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9NDV _pdbx_database_status.recvd_initial_deposition_date 2025-02-18 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_database_related.db_name EMDB _pdbx_database_related.details 'Scaffold attached to quinine-I aptamer (Tonic) local refinement of aptamer' _pdbx_database_related.db_id EMD-49278 _pdbx_database_related.content_type 'associated EM volume' # _pdbx_contact_author.id 2 _pdbx_contact_author.email adrian.ferre@nih.gov _pdbx_contact_author.name_first Adrian _pdbx_contact_author.name_last "Ferre-D'Amare" _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0003-4549-1619 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Jones, C.P.' 1 0000-0001-7780-5278 ;Ferre-D'Amare, A.R. ; 2 0000-0003-4549-1619 # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Symmetric scaffolds enable de novo modelling of RNA by cryoEM' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Jones, C.P.' 1 0000-0001-7780-5278 primary ;Ferre-D'Amare, A.R. ; 2 0000-0003-4549-1619 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'RNA (67-MER)' 53433.723 1 ? ? ? ? 2 non-polymer syn Quinine 324.417 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 4 non-polymer syn 'POTASSIUM ION' 39.098 2 ? ? ? ? 5 water nat water 18.015 17 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGGCCACUGUUUCACUGUUGCGCUACAUCUCCGGACGACUCUAUACCGCGUGGAUAUGGCACGCAACUUCAAGACGGGCA CCGUAAAUGUCCUCGGGCGUCGUCCGGAGGCCACACGAAAGUGUGGAGUGACCAGUGGCCCCACCCUGAAGGUAAACUUG UAGCGC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGGCCACUGUUUCACUGUUGCGCUACAUCUCCGGACGACUCUAUACCGCGUGGAUAUGGCACGCAACUUCAAGACGGGCA CCGUAAAUGUCCUCGGGCGUCGUCCGGAGGCCACACGAAAGUGUGGAGUGACCAGUGGCCCCACCCUGAAGGUAAACUUG UAGCGC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 Quinine QI9 3 'MAGNESIUM ION' MG 4 'POTASSIUM ION' K 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 C n 1 5 C n 1 6 A n 1 7 C n 1 8 U n 1 9 G n 1 10 U n 1 11 U n 1 12 U n 1 13 C n 1 14 A n 1 15 C n 1 16 U n 1 17 G n 1 18 U n 1 19 U n 1 20 G n 1 21 C n 1 22 G n 1 23 C n 1 24 U n 1 25 A n 1 26 C n 1 27 A n 1 28 U n 1 29 C n 1 30 U n 1 31 C n 1 32 C n 1 33 G n 1 34 G n 1 35 A n 1 36 C n 1 37 G n 1 38 A n 1 39 C n 1 40 U n 1 41 C n 1 42 U n 1 43 A n 1 44 U n 1 45 A n 1 46 C n 1 47 C n 1 48 G n 1 49 C n 1 50 G n 1 51 U n 1 52 G n 1 53 G n 1 54 A n 1 55 U n 1 56 A n 1 57 U n 1 58 G n 1 59 G n 1 60 C n 1 61 A n 1 62 C n 1 63 G n 1 64 C n 1 65 A n 1 66 A n 1 67 C n 1 68 U n 1 69 U n 1 70 C n 1 71 A n 1 72 A n 1 73 G n 1 74 A n 1 75 C n 1 76 G n 1 77 G n 1 78 G n 1 79 C n 1 80 A n 1 81 C n 1 82 C n 1 83 G n 1 84 U n 1 85 A n 1 86 A n 1 87 A n 1 88 U n 1 89 G n 1 90 U n 1 91 C n 1 92 C n 1 93 U n 1 94 C n 1 95 G n 1 96 G n 1 97 G n 1 98 C n 1 99 G n 1 100 U n 1 101 C n 1 102 G n 1 103 U n 1 104 C n 1 105 C n 1 106 G n 1 107 G n 1 108 A n 1 109 G n 1 110 G n 1 111 C n 1 112 C n 1 113 A n 1 114 C n 1 115 A n 1 116 C n 1 117 G n 1 118 A n 1 119 A n 1 120 A n 1 121 G n 1 122 U n 1 123 G n 1 124 U n 1 125 G n 1 126 G n 1 127 A n 1 128 G n 1 129 U n 1 130 G n 1 131 A n 1 132 C n 1 133 C n 1 134 A n 1 135 G n 1 136 U n 1 137 G n 1 138 G n 1 139 C n 1 140 C n 1 141 C n 1 142 C n 1 143 A n 1 144 C n 1 145 C n 1 146 C n 1 147 U n 1 148 G n 1 149 A n 1 150 A n 1 151 G n 1 152 G n 1 153 U n 1 154 A n 1 155 A n 1 156 A n 1 157 C n 1 158 U n 1 159 U n 1 160 G n 1 161 U n 1 162 A n 1 163 G n 1 164 C n 1 165 G n 1 166 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 166 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 K non-polymer . 'POTASSIUM ION' ? 'K 1' 39.098 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 QI9 non-polymer . Quinine "(3alpha,8alpha,9R)-6'-methoxycinchonan-9-ol" 'C20 H24 N2 O2' 324.417 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 ? ? ? A . n A 1 2 G 2 2 ? ? ? A . n A 1 3 G 3 3 ? ? ? A . n A 1 4 C 4 4 ? ? ? A . n A 1 5 C 5 5 ? ? ? A . n A 1 6 A 6 6 ? ? ? A . n A 1 7 C 7 7 ? ? ? A . n A 1 8 U 8 8 ? ? ? A . n A 1 9 G 9 9 ? ? ? A . n A 1 10 U 10 10 ? ? ? A . n A 1 11 U 11 11 ? ? ? A . n A 1 12 U 12 12 ? ? ? A . n A 1 13 C 13 13 ? ? ? A . n A 1 14 A 14 14 ? ? ? A . n A 1 15 C 15 15 ? ? ? A . n A 1 16 U 16 16 ? ? ? A . n A 1 17 G 17 17 ? ? ? A . n A 1 18 U 18 18 ? ? ? A . n A 1 19 U 19 19 ? ? ? A . n A 1 20 G 20 20 ? ? ? A . n A 1 21 C 21 21 ? ? ? A . n A 1 22 G 22 22 ? ? ? A . n A 1 23 C 23 23 ? ? ? A . n A 1 24 U 24 24 ? ? ? A . n A 1 25 A 25 25 ? ? ? A . n A 1 26 C 26 26 ? ? ? A . n A 1 27 A 27 27 ? ? ? A . n A 1 28 U 28 28 ? ? ? A . n A 1 29 C 29 29 ? ? ? A . n A 1 30 U 30 30 ? ? ? A . n A 1 31 C 31 31 ? ? ? A . n A 1 32 C 32 32 ? ? ? A . n A 1 33 G 33 33 ? ? ? A . n A 1 34 G 34 34 ? ? ? A . n A 1 35 A 35 35 ? ? ? A . n A 1 36 C 36 36 36 C C A . n A 1 37 G 37 37 37 G G A . n A 1 38 A 38 38 38 A A A . n A 1 39 C 39 39 39 C C A . n A 1 40 U 40 40 40 U U A . n A 1 41 C 41 41 41 C C A . n A 1 42 U 42 42 42 U U A . n A 1 43 A 43 43 43 A A A . n A 1 44 U 44 44 44 U U A . n A 1 45 A 45 45 45 A A A . n A 1 46 C 46 46 46 C C A . n A 1 47 C 47 47 47 C C A . n A 1 48 G 48 48 48 G G A . n A 1 49 C 49 49 49 C C A . n A 1 50 G 50 50 50 G G A . n A 1 51 U 51 51 51 U U A . n A 1 52 G 52 52 52 G G A . n A 1 53 G 53 53 53 G G A . n A 1 54 A 54 54 54 A A A . n A 1 55 U 55 55 55 U U A . n A 1 56 A 56 56 56 A A A . n A 1 57 U 57 57 57 U U A . n A 1 58 G 58 58 58 G G A . n A 1 59 G 59 59 59 G G A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 C 62 62 62 C C A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 A 65 65 65 A A A . n A 1 66 A 66 66 66 A A A . n A 1 67 C 67 67 67 C C A . n A 1 68 U 68 68 68 U U A . n A 1 69 U 69 69 69 U U A . n A 1 70 C 70 70 70 C C A . n A 1 71 A 71 71 71 A A A . n A 1 72 A 72 72 72 A A A . n A 1 73 G 73 73 73 G G A . n A 1 74 A 74 74 74 A A A . n A 1 75 C 75 75 75 C C A . n A 1 76 G 76 76 76 G G A . n A 1 77 G 77 77 77 G G A . n A 1 78 G 78 78 78 G G A . n A 1 79 C 79 79 79 C C A . n A 1 80 A 80 80 80 A A A . n A 1 81 C 81 81 81 C C A . n A 1 82 C 82 82 82 C C A . n A 1 83 G 83 83 83 G G A . n A 1 84 U 84 84 84 U U A . n A 1 85 A 85 85 85 A A A . n A 1 86 A 86 86 86 A A A . n A 1 87 A 87 87 87 A A A . n A 1 88 U 88 88 88 U U A . n A 1 89 G 89 89 89 G G A . n A 1 90 U 90 90 90 U U A . n A 1 91 C 91 91 91 C C A . n A 1 92 C 92 92 92 C C A . n A 1 93 U 93 93 93 U U A . n A 1 94 C 94 94 94 C C A . n A 1 95 G 95 95 95 G G A . n A 1 96 G 96 96 96 G G A . n A 1 97 G 97 97 97 G G A . n A 1 98 C 98 98 98 C C A . n A 1 99 G 99 99 99 G G A . n A 1 100 U 100 100 100 U U A . n A 1 101 C 101 101 101 C C A . n A 1 102 G 102 102 102 G G A . n A 1 103 U 103 103 ? ? ? A . n A 1 104 C 104 104 ? ? ? A . n A 1 105 C 105 105 ? ? ? A . n A 1 106 G 106 106 ? ? ? A . n A 1 107 G 107 107 ? ? ? A . n A 1 108 A 108 108 ? ? ? A . n A 1 109 G 109 109 ? ? ? A . n A 1 110 G 110 110 ? ? ? A . n A 1 111 C 111 111 ? ? ? A . n A 1 112 C 112 112 ? ? ? A . n A 1 113 A 113 113 ? ? ? A . n A 1 114 C 114 114 ? ? ? A . n A 1 115 A 115 115 ? ? ? A . n A 1 116 C 116 116 ? ? ? A . n A 1 117 G 117 117 ? ? ? A . n A 1 118 A 118 118 ? ? ? A . n A 1 119 A 119 119 ? ? ? A . n A 1 120 A 120 120 ? ? ? A . n A 1 121 G 121 121 ? ? ? A . n A 1 122 U 122 122 ? ? ? A . n A 1 123 G 123 123 ? ? ? A . n A 1 124 U 124 124 ? ? ? A . n A 1 125 G 125 125 ? ? ? A . n A 1 126 G 126 126 ? ? ? A . n A 1 127 A 127 127 ? ? ? A . n A 1 128 G 128 128 ? ? ? A . n A 1 129 U 129 129 ? ? ? A . n A 1 130 G 130 130 ? ? ? A . n A 1 131 A 131 131 ? ? ? A . n A 1 132 C 132 132 ? ? ? A . n A 1 133 C 133 133 ? ? ? A . n A 1 134 A 134 134 ? ? ? A . n A 1 135 G 135 135 ? ? ? A . n A 1 136 U 136 136 ? ? ? A . n A 1 137 G 137 137 ? ? ? A . n A 1 138 G 138 138 ? ? ? A . n A 1 139 C 139 139 ? ? ? A . n A 1 140 C 140 140 ? ? ? A . n A 1 141 C 141 141 ? ? ? A . n A 1 142 C 142 142 ? ? ? A . n A 1 143 A 143 143 ? ? ? A . n A 1 144 C 144 144 ? ? ? A . n A 1 145 C 145 145 ? ? ? A . n A 1 146 C 146 146 ? ? ? A . n A 1 147 U 147 147 ? ? ? A . n A 1 148 G 148 148 ? ? ? A . n A 1 149 A 149 149 ? ? ? A . n A 1 150 A 150 150 ? ? ? A . n A 1 151 G 151 151 ? ? ? A . n A 1 152 G 152 152 ? ? ? A . n A 1 153 U 153 153 ? ? ? A . n A 1 154 A 154 154 ? ? ? A . n A 1 155 A 155 155 ? ? ? A . n A 1 156 A 156 156 ? ? ? A . n A 1 157 C 157 157 ? ? ? A . n A 1 158 U 158 158 ? ? ? A . n A 1 159 U 159 159 ? ? ? A . n A 1 160 G 160 160 ? ? ? A . n A 1 161 U 161 161 ? ? ? A . n A 1 162 A 162 162 ? ? ? A . n A 1 163 G 163 163 ? ? ? A . n A 1 164 C 164 164 ? ? ? A . n A 1 165 G 165 165 ? ? ? A . n A 1 166 C 166 166 ? ? ? A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id QI9 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id QI9 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 QI9 1 201 1 QI9 QI9 A . C 3 MG 1 202 1 MG MG A . D 4 K 1 203 1 K K A . E 4 K 1 204 2 K K A . F 5 HOH 1 301 11 HOH HOH A . F 5 HOH 2 302 15 HOH HOH A . F 5 HOH 3 303 13 HOH HOH A . F 5 HOH 4 304 14 HOH HOH A . F 5 HOH 5 305 7 HOH HOH A . F 5 HOH 6 306 20 HOH HOH A . F 5 HOH 7 307 1 HOH HOH A . F 5 HOH 8 308 21 HOH HOH A . F 5 HOH 9 309 24 HOH HOH A . F 5 HOH 10 310 19 HOH HOH A . F 5 HOH 11 311 17 HOH HOH A . F 5 HOH 12 312 10 HOH HOH A . F 5 HOH 13 313 8 HOH HOH A . F 5 HOH 14 314 18 HOH HOH A . F 5 HOH 15 315 23 HOH HOH A . F 5 HOH 16 316 16 HOH HOH A . F 5 HOH 17 317 9 HOH HOH A . # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9NDV _cell.details ? _cell.formula_units_Z ? _cell.length_a 1.00 _cell.length_a_esd ? _cell.length_b 1.00 _cell.length_b_esd ? _cell.length_c 1.00 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB ? _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9NDV _symmetry.cell_setting ? _symmetry.Int_Tables_number 1 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 1' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9NDV _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 9NDV _struct.title 'Scaffold attached to quinine-I aptamer (Tonic) local refinement of aptamer' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9NDV _struct_keywords.text 'Synthetic, aptamer, engineering, riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 4 ? F N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9NDV _struct_ref.pdbx_db_accession 9NDV _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9NDV _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 166 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9NDV _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 166 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 166 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A U 68 OP2 ? ? ? 1_555 C MG . MG ? ? A U 68 A MG 202 1_555 ? ? ? ? ? ? ? 2.035 ? ? metalc2 metalc ? ? A A 71 OP2 ? ? ? 1_555 C MG . MG ? ? A A 71 A MG 202 1_555 ? ? ? ? ? ? ? 2.313 ? ? hydrog1 hydrog ? ? A C 36 N3 ? ? ? 1_555 A G 102 N1 ? ? A C 36 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A C 36 N4 ? ? ? 1_555 A G 102 O6 ? ? A C 36 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A C 36 O2 ? ? ? 1_555 A G 102 N2 ? ? A C 36 A G 102 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 37 N1 ? ? ? 1_555 A C 101 N3 ? ? A G 37 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 37 N2 ? ? ? 1_555 A C 101 O2 ? ? A G 37 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 37 O6 ? ? ? 1_555 A C 101 N4 ? ? A G 37 A C 101 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 38 N1 ? ? ? 1_555 A U 100 N3 ? ? A A 38 A U 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 38 N6 ? ? ? 1_555 A U 100 O4 ? ? A A 38 A U 100 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 99 N1 ? ? A C 39 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 99 O6 ? ? A C 39 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 99 N2 ? ? A C 39 A G 99 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A U 40 O4 ? ? ? 1_555 A C 98 N4 ? ? A U 40 A C 98 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog13 hydrog ? ? A C 41 N3 ? ? ? 1_555 A G 97 N1 ? ? A C 41 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 41 N4 ? ? ? 1_555 A G 97 O6 ? ? A C 41 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 41 O2 ? ? ? 1_555 A G 97 N2 ? ? A C 41 A G 97 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A U 42 N3 ? ? ? 1_555 A U 68 O4 ? ? A U 42 A U 68 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog17 hydrog ? ? A U 42 N3 ? ? ? 1_555 A G 96 O6 ? ? A U 42 A G 96 1_555 ? ? ? ? ? ? TYPE_27_PAIR ? ? ? hydrog18 hydrog ? ? A U 42 O4 ? ? ? 1_555 A G 96 N1 ? ? A U 42 A G 96 1_555 ? ? ? ? ? ? TYPE_27_PAIR ? ? ? hydrog19 hydrog ? ? A A 43 N1 ? ? ? 1_555 A A 71 N6 ? ? A A 43 A A 71 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog20 hydrog ? ? A A 43 N6 ? ? ? 1_555 A G 95 O6 ? ? A A 43 A G 95 1_555 ? ? ? ? ? ? 'A-G MISPAIR' ? ? ? hydrog21 hydrog ? ? A U 44 N3 ? ? ? 1_555 A A 72 N1 ? ? A U 44 A A 72 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog22 hydrog ? ? A U 44 O2 ? ? ? 1_555 A A 72 N6 ? ? A U 44 A A 72 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? ? hydrog23 hydrog ? ? A C 46 O2 ? ? ? 1_555 A A 65 N6 ? ? A C 46 A A 65 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog24 hydrog ? ? A G 48 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 48 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 48 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 48 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 48 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 48 A C 64 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 49 N3 ? ? ? 1_555 A G 63 N1 ? ? A C 49 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 49 N4 ? ? ? 1_555 A G 63 O6 ? ? A C 49 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 49 O2 ? ? ? 1_555 A G 63 N2 ? ? A C 49 A G 63 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A G 50 N1 ? ? ? 1_555 A C 62 N3 ? ? A G 50 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 50 N2 ? ? ? 1_555 A C 62 O2 ? ? A G 50 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A G 50 O6 ? ? ? 1_555 A C 62 N4 ? ? A G 50 A C 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 51 N3 ? ? ? 1_555 A A 61 N1 ? ? A U 51 A A 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A U 51 O4 ? ? ? 1_555 A A 61 N6 ? ? A U 51 A A 61 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 52 N1 ? ? ? 1_555 A C 60 N3 ? ? A G 52 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 52 N2 ? ? ? 1_555 A C 60 O2 ? ? A G 52 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A G 52 O6 ? ? ? 1_555 A C 60 N4 ? ? A G 52 A C 60 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 55 O2 ? ? ? 1_555 A G 58 N2 ? ? A U 55 A G 58 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog39 hydrog ? ? A G 58 N1 ? ? ? 1_555 A C 82 N3 ? ? A G 58 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 58 N2 ? ? ? 1_555 A C 82 O2 ? ? A G 58 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 58 O6 ? ? ? 1_555 A C 82 N4 ? ? A G 58 A C 82 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 59 N1 ? ? ? 1_555 A C 81 N3 ? ? A G 59 A C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 59 N2 ? ? ? 1_555 A C 81 O2 ? ? A G 59 A C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 59 O6 ? ? ? 1_555 A C 81 N4 ? ? A G 59 A C 81 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 59 N2 ? ? ? 1_555 A A 87 N1 ? ? A G 59 A A 87 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog46 hydrog ? ? A U 68 O4 ? ? ? 1_555 A C 70 N4 ? ? A U 68 A C 70 1_555 ? ? ? ? ? ? 'U-C MISPAIR' ? ? ? hydrog47 hydrog ? ? A C 70 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 70 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A C 70 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 70 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A C 70 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 70 A G 95 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 73 N1 ? ? ? 1_555 A C 94 N3 ? ? A G 73 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 73 N2 ? ? ? 1_555 A C 94 O2 ? ? A G 73 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 73 O6 ? ? ? 1_555 A C 94 N4 ? ? A G 73 A C 94 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 74 N1 ? ? ? 1_555 A U 93 N3 ? ? A A 74 A U 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A A 74 N6 ? ? ? 1_555 A U 93 O4 ? ? A A 74 A U 93 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 76 N1 ? ? ? 1_555 A C 92 N3 ? ? A G 76 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 76 N2 ? ? ? 1_555 A C 92 O2 ? ? A G 76 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 76 O6 ? ? ? 1_555 A C 92 N4 ? ? A G 76 A C 92 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 77 N1 ? ? ? 1_555 A C 91 N3 ? ? A G 77 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 77 N2 ? ? ? 1_555 A C 91 O2 ? ? A G 77 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 77 O6 ? ? ? 1_555 A C 91 N4 ? ? A G 77 A C 91 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 79 N3 ? ? ? 1_555 A G 89 N1 ? ? A C 79 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 79 N4 ? ? ? 1_555 A G 89 O6 ? ? A C 79 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 79 O2 ? ? ? 1_555 A G 89 N2 ? ? A C 79 A G 89 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A A 80 N1 ? ? ? 1_555 A U 88 N3 ? ? A A 80 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 80 N6 ? ? ? 1_555 A U 88 O4 ? ? A A 80 A U 88 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 82 O2 ? ? ? 1_555 A A 87 N6 ? ? A C 82 A A 87 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? hydrog67 hydrog ? ? A G 83 N2 ? ? ? 1_555 A A 85 N1 ? ? A G 83 A A 85 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id OP2 _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id U _pdbx_struct_conn_angle.ptnr1_label_seq_id 68 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id A _pdbx_struct_conn_angle.ptnr1_auth_comp_id U _pdbx_struct_conn_angle.ptnr1_auth_seq_id 68 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id C _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id A _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 202 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 1_555 _pdbx_struct_conn_angle.ptnr3_label_atom_id OP2 _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id A _pdbx_struct_conn_angle.ptnr3_label_comp_id A _pdbx_struct_conn_angle.ptnr3_label_seq_id 71 _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id A _pdbx_struct_conn_angle.ptnr3_auth_comp_id A _pdbx_struct_conn_angle.ptnr3_auth_seq_id 71 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 138.2 _pdbx_struct_conn_angle.value_esd ? # _pdbx_entry_details.entry_id 9NDV _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 C6 A C 64 ? ? N1 A C 64 ? ? C2 A C 64 ? ? 117.22 120.30 -3.08 0.40 N 2 1 C5 A C 64 ? ? C6 A C 64 ? ? N1 A C 64 ? ? 124.20 121.00 3.20 0.50 N 3 1 "O5'" A A 65 ? ? P A A 65 ? ? OP2 A A 65 ? ? 100.12 105.70 -5.58 0.90 N 4 1 C5 A G 83 ? ? C6 A G 83 ? ? O6 A G 83 ? ? 124.49 128.60 -4.11 0.60 N 5 1 OP1 A C 101 ? ? P A C 101 ? ? OP2 A C 101 ? ? 129.80 119.60 10.20 1.50 N 6 1 "O5'" A C 101 ? ? P A C 101 ? ? OP2 A C 101 ? ? 98.91 105.70 -6.79 0.90 N 7 1 C5 A C 101 ? ? C6 A C 101 ? ? N1 A C 101 ? ? 124.52 121.00 3.52 0.50 N 8 1 C2 A C 101 ? ? N1 A C 101 ? ? "C1'" A C 101 ? ? 125.99 118.80 7.19 1.10 N # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 9NDV _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space ? _em_3d_fitting.ref_protocol ? # _em_3d_reconstruction.entry_id 9NDV _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm ? _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 2.92 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 882884 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages ? _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 7.4 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type COMPLEX _em_entity_assembly.name 'Scaffold attached to quinine-I aptamer (Tonic) local refinement of aptamer' _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_imaging.entry_id 9NDV _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model ? _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'SPOT SCAN' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs ? _em_imaging.nominal_defocus_min 800 _em_imaging.nominal_defocus_max 2000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification ? _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure ? _em_imaging.c2_aperture_diameter ? _em_imaging.specimen_id 1 _em_imaging.cryogen ? _em_imaging.objective_aperture ? _em_imaging.microscope_serial_number ? _em_imaging.microscope_version ? # _em_vitrification.entry_id 9NDV _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity ? _em_vitrification.temp ? _em_vitrification.chamber_temperature ? _em_vitrification.instrument ? _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 9NDV _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # loop_ _pdbx_unobs_or_zero_occ_residues.id _pdbx_unobs_or_zero_occ_residues.PDB_model_num _pdbx_unobs_or_zero_occ_residues.polymer_flag _pdbx_unobs_or_zero_occ_residues.occupancy_flag _pdbx_unobs_or_zero_occ_residues.auth_asym_id _pdbx_unobs_or_zero_occ_residues.auth_comp_id _pdbx_unobs_or_zero_occ_residues.auth_seq_id _pdbx_unobs_or_zero_occ_residues.PDB_ins_code _pdbx_unobs_or_zero_occ_residues.label_asym_id _pdbx_unobs_or_zero_occ_residues.label_comp_id _pdbx_unobs_or_zero_occ_residues.label_seq_id 1 1 Y 1 A G 1 ? A G 1 2 1 Y 1 A G 2 ? A G 2 3 1 Y 1 A G 3 ? A G 3 4 1 Y 1 A C 4 ? A C 4 5 1 Y 1 A C 5 ? A C 5 6 1 Y 1 A A 6 ? A A 6 7 1 Y 1 A C 7 ? A C 7 8 1 Y 1 A U 8 ? A U 8 9 1 Y 1 A G 9 ? A G 9 10 1 Y 1 A U 10 ? A U 10 11 1 Y 1 A U 11 ? A U 11 12 1 Y 1 A U 12 ? A U 12 13 1 Y 1 A C 13 ? A C 13 14 1 Y 1 A A 14 ? A A 14 15 1 Y 1 A C 15 ? A C 15 16 1 Y 1 A U 16 ? A U 16 17 1 Y 1 A G 17 ? A G 17 18 1 Y 1 A U 18 ? A U 18 19 1 Y 1 A U 19 ? A U 19 20 1 Y 1 A G 20 ? A G 20 21 1 Y 1 A C 21 ? A C 21 22 1 Y 1 A G 22 ? A G 22 23 1 Y 1 A C 23 ? A C 23 24 1 Y 1 A U 24 ? A U 24 25 1 Y 1 A A 25 ? A A 25 26 1 Y 1 A C 26 ? A C 26 27 1 Y 1 A A 27 ? A A 27 28 1 Y 1 A U 28 ? A U 28 29 1 Y 1 A C 29 ? A C 29 30 1 Y 1 A U 30 ? A U 30 31 1 Y 1 A C 31 ? A C 31 32 1 Y 1 A C 32 ? A C 32 33 1 Y 1 A G 33 ? A G 33 34 1 Y 1 A G 34 ? A G 34 35 1 Y 1 A A 35 ? A A 35 36 1 Y 1 A U 103 ? A U 103 37 1 Y 1 A C 104 ? A C 104 38 1 Y 1 A C 105 ? A C 105 39 1 Y 1 A G 106 ? A G 106 40 1 Y 1 A G 107 ? A G 107 41 1 Y 1 A A 108 ? A A 108 42 1 Y 1 A G 109 ? A G 109 43 1 Y 1 A G 110 ? A G 110 44 1 Y 1 A C 111 ? A C 111 45 1 Y 1 A C 112 ? A C 112 46 1 Y 1 A A 113 ? A A 113 47 1 Y 1 A C 114 ? A C 114 48 1 Y 1 A A 115 ? A A 115 49 1 Y 1 A C 116 ? A C 116 50 1 Y 1 A G 117 ? A G 117 51 1 Y 1 A A 118 ? A A 118 52 1 Y 1 A A 119 ? A A 119 53 1 Y 1 A A 120 ? A A 120 54 1 Y 1 A G 121 ? A G 121 55 1 Y 1 A U 122 ? A U 122 56 1 Y 1 A G 123 ? A G 123 57 1 Y 1 A U 124 ? A U 124 58 1 Y 1 A G 125 ? A G 125 59 1 Y 1 A G 126 ? A G 126 60 1 Y 1 A A 127 ? A A 127 61 1 Y 1 A G 128 ? A G 128 62 1 Y 1 A U 129 ? A U 129 63 1 Y 1 A G 130 ? A G 130 64 1 Y 1 A A 131 ? A A 131 65 1 Y 1 A C 132 ? A C 132 66 1 Y 1 A C 133 ? A C 133 67 1 Y 1 A A 134 ? A A 134 68 1 Y 1 A G 135 ? A G 135 69 1 Y 1 A U 136 ? A U 136 70 1 Y 1 A G 137 ? A G 137 71 1 Y 1 A G 138 ? A G 138 72 1 Y 1 A C 139 ? A C 139 73 1 Y 1 A C 140 ? A C 140 74 1 Y 1 A C 141 ? A C 141 75 1 Y 1 A C 142 ? A C 142 76 1 Y 1 A A 143 ? A A 143 77 1 Y 1 A C 144 ? A C 144 78 1 Y 1 A C 145 ? A C 145 79 1 Y 1 A C 146 ? A C 146 80 1 Y 1 A U 147 ? A U 147 81 1 Y 1 A G 148 ? A G 148 82 1 Y 1 A A 149 ? A A 149 83 1 Y 1 A A 150 ? A A 150 84 1 Y 1 A G 151 ? A G 151 85 1 Y 1 A G 152 ? A G 152 86 1 Y 1 A U 153 ? A U 153 87 1 Y 1 A A 154 ? A A 154 88 1 Y 1 A A 155 ? A A 155 89 1 Y 1 A A 156 ? A A 156 90 1 Y 1 A C 157 ? A C 157 91 1 Y 1 A U 158 ? A U 158 92 1 Y 1 A U 159 ? A U 159 93 1 Y 1 A G 160 ? A G 160 94 1 Y 1 A U 161 ? A U 161 95 1 Y 1 A A 162 ? A A 162 96 1 Y 1 A G 163 ? A G 163 97 1 Y 1 A C 164 ? A C 164 98 1 Y 1 A G 165 ? A G 165 99 1 Y 1 A C 166 ? A C 166 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 HOH O O N N 111 HOH H1 H N N 112 HOH H2 H N N 113 K K K N N 114 MG MG MG N N 115 QI9 O1 O N N 116 QI9 C10 C N R 117 QI9 C11 C N S 118 QI9 N1 N N S 119 QI9 C15 C N N 120 QI9 C14 C N N 121 QI9 C16 C N N 122 QI9 C17 C N R 123 QI9 C18 C N N 124 QI9 C19 C N N 125 QI9 C13 C N S 126 QI9 C12 C N N 127 QI9 C4 C Y N 128 QI9 C5 C Y N 129 QI9 C6 C Y N 130 QI9 N N Y N 131 QI9 C7 C Y N 132 QI9 C3 C Y N 133 QI9 C2 C Y N 134 QI9 C8 C Y N 135 QI9 C9 C Y N 136 QI9 C1 C Y N 137 QI9 O O N N 138 QI9 C C N N 139 QI9 H1 H N N 140 QI9 H2 H N N 141 QI9 H3 H N N 142 QI9 H5 H N N 143 QI9 H6 H N N 144 QI9 H7 H N N 145 QI9 H8 H N N 146 QI9 H9 H N N 147 QI9 H10 H N N 148 QI9 H11 H N N 149 QI9 H12 H N N 150 QI9 H13 H N N 151 QI9 H14 H N N 152 QI9 H15 H N N 153 QI9 H16 H N N 154 QI9 H17 H N N 155 QI9 H18 H N N 156 QI9 H19 H N N 157 QI9 H20 H N N 158 QI9 H21 H N N 159 QI9 H22 H N N 160 QI9 H23 H N N 161 QI9 H24 H N N 162 QI9 H25 H N N 163 U OP3 O N N 164 U P P N N 165 U OP1 O N N 166 U OP2 O N N 167 U "O5'" O N N 168 U "C5'" C N N 169 U "C4'" C N R 170 U "O4'" O N N 171 U "C3'" C N S 172 U "O3'" O N N 173 U "C2'" C N R 174 U "O2'" O N N 175 U "C1'" C N R 176 U N1 N N N 177 U C2 C N N 178 U O2 O N N 179 U N3 N N N 180 U C4 C N N 181 U O4 O N N 182 U C5 C N N 183 U C6 C N N 184 U HOP3 H N N 185 U HOP2 H N N 186 U "H5'" H N N 187 U "H5''" H N N 188 U "H4'" H N N 189 U "H3'" H N N 190 U "HO3'" H N N 191 U "H2'" H N N 192 U "HO2'" H N N 193 U "H1'" H N N 194 U H3 H N N 195 U H5 H N N 196 U H6 H N N 197 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 HOH O H1 sing N N 116 HOH O H2 sing N N 117 QI9 C16 N1 sing N N 118 QI9 C16 C17 sing N N 119 QI9 N1 C15 sing N N 120 QI9 N1 C11 sing N N 121 QI9 C15 C14 sing N N 122 QI9 C17 C18 sing N N 123 QI9 C17 C13 sing N N 124 QI9 O C sing N N 125 QI9 O C1 sing N N 126 QI9 C19 C18 doub N N 127 QI9 C14 C13 sing N N 128 QI9 C11 C10 sing N N 129 QI9 C11 C12 sing N N 130 QI9 C13 C12 sing N N 131 QI9 C1 C2 doub Y N 132 QI9 C1 C9 sing Y N 133 QI9 C2 C3 sing Y N 134 QI9 C10 O1 sing N N 135 QI9 C10 C4 sing N N 136 QI9 C9 C8 doub Y N 137 QI9 C3 C4 doub Y N 138 QI9 C3 C7 sing Y N 139 QI9 C4 C5 sing Y N 140 QI9 C8 C7 sing Y N 141 QI9 C7 N doub Y N 142 QI9 C5 C6 doub Y N 143 QI9 N C6 sing Y N 144 QI9 O1 H1 sing N N 145 QI9 C10 H2 sing N N 146 QI9 C11 H3 sing N N 147 QI9 C15 H5 sing N N 148 QI9 C15 H6 sing N N 149 QI9 C14 H7 sing N N 150 QI9 C14 H8 sing N N 151 QI9 C16 H9 sing N N 152 QI9 C16 H10 sing N N 153 QI9 C17 H11 sing N N 154 QI9 C18 H12 sing N N 155 QI9 C19 H13 sing N N 156 QI9 C19 H14 sing N N 157 QI9 C13 H15 sing N N 158 QI9 C12 H16 sing N N 159 QI9 C12 H17 sing N N 160 QI9 C5 H18 sing N N 161 QI9 C6 H19 sing N N 162 QI9 C2 H20 sing N N 163 QI9 C8 H21 sing N N 164 QI9 C9 H22 sing N N 165 QI9 C H23 sing N N 166 QI9 C H24 sing N N 167 QI9 C H25 sing N N 168 U OP3 P sing N N 169 U OP3 HOP3 sing N N 170 U P OP1 doub N N 171 U P OP2 sing N N 172 U P "O5'" sing N N 173 U OP2 HOP2 sing N N 174 U "O5'" "C5'" sing N N 175 U "C5'" "C4'" sing N N 176 U "C5'" "H5'" sing N N 177 U "C5'" "H5''" sing N N 178 U "C4'" "O4'" sing N N 179 U "C4'" "C3'" sing N N 180 U "C4'" "H4'" sing N N 181 U "O4'" "C1'" sing N N 182 U "C3'" "O3'" sing N N 183 U "C3'" "C2'" sing N N 184 U "C3'" "H3'" sing N N 185 U "O3'" "HO3'" sing N N 186 U "C2'" "O2'" sing N N 187 U "C2'" "C1'" sing N N 188 U "C2'" "H2'" sing N N 189 U "O2'" "HO2'" sing N N 190 U "C1'" N1 sing N N 191 U "C1'" "H1'" sing N N 192 U N1 C2 sing N N 193 U N1 C6 sing N N 194 U C2 O2 doub N N 195 U C2 N3 sing N N 196 U N3 C4 sing N N 197 U N3 H3 sing N N 198 U C4 O4 doub N N 199 U C4 C5 sing N N 200 U C5 C6 doub N N 201 U C5 H5 sing N N 202 U C6 H6 sing N N 203 # _em_admin.current_status REL _em_admin.deposition_date 2025-02-18 _em_admin.deposition_site RCSB _em_admin.entry_id 9NDV _em_admin.last_update 2026-03-04 _em_admin.map_release_date 2026-03-04 _em_admin.title 'Scaffold attached to quinine-I aptamer (Tonic) local refinement of aptamer' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 32630 _em_entity_assembly_naturalsource.organism 'synthetic construct' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 905931 _em_entity_assembly_recombinant.organism 'in vitro transcription vector pT7-TP(deltai)' _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time ? _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 45.09 _em_image_recording.details ? _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'GATAN K3 BIOQUANTUM (6k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged ? _em_image_recording.num_real_images ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' ? 1 1 ? ? ? ? 'IMAGE ACQUISITION' ? 2 ? ? 1 ? ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' ? 4 1 ? ? ? ? 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' ? 7 ? ? ? ? ? 'MODEL REFINEMENT' ? 8 ? ? ? ? ? OTHER ? 9 ? ? ? ? ? 'INITIAL EULER ASSIGNMENT' ? 10 1 ? ? ? ? 'FINAL EULER ASSIGNMENT' ? 11 1 ? ? ? ? CLASSIFICATION ? 12 1 ? ? ? ? RECONSTRUCTION ? 13 1 ? ? ? ? # _em_specimen.concentration ? _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9NDV 'double helix' 9NDV 'a-form double helix' 9NDV 'bulge loop' 9NDV 'mismatched base pair' 9NDV 'internal loop' 9NDV 'triple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A C 36 1_555 A G 102 1_555 0.211 -0.173 -0.273 -5.441 4.928 0.095 1 A_C36:G102_A A 36 ? A 102 ? 19 1 1 A G 37 1_555 A C 101 1_555 -0.036 -0.464 0.884 4.479 -3.909 -8.775 2 A_G37:C101_A A 37 ? A 101 ? 19 1 1 A A 38 1_555 A U 100 1_555 -0.068 -0.396 0.758 2.602 -3.598 2.956 3 A_A38:U100_A A 38 ? A 100 ? 20 1 1 A C 39 1_555 A G 99 1_555 0.192 -0.284 0.583 1.197 -6.533 -1.475 4 A_C39:G99_A A 39 ? A 99 ? 19 1 1 A U 40 1_555 A C 98 1_555 1.253 -1.214 0.352 -0.665 -11.664 -11.987 5 A_U40:C98_A A 40 ? A 98 ? ? ? 1 A C 41 1_555 A G 97 1_555 0.251 -0.158 0.174 0.454 -9.333 -0.933 6 A_C41:G97_A A 41 ? A 97 ? 19 1 1 A U 42 1_555 A G 96 1_555 -0.206 1.104 -0.102 -13.620 8.793 -168.176 7 A_U42:G96_A A 42 ? A 96 ? 27 2 1 A C 70 1_555 A G 95 1_555 0.386 0.192 -0.385 -6.030 -1.807 2.027 8 A_C70:G95_A A 70 ? A 95 ? 19 1 1 A A 71 1_555 A A 43 1_555 -1.985 -1.055 0.860 -49.424 -15.795 158.860 9 A_A71:A43_A A 71 ? A 43 ? ? ? 1 A A 72 1_555 A U 44 1_555 0.203 1.040 -0.753 12.876 1.494 177.063 10 A_A72:U44_A A 72 ? A 44 ? 21 2 1 A C 46 1_555 A A 65 1_555 5.968 0.664 -1.701 -36.441 -10.712 72.623 11 A_C46:A65_A A 46 ? A 65 ? ? 5 1 A G 48 1_555 A C 64 1_555 -0.113 -0.181 1.115 12.082 7.792 2.598 12 A_G48:C64_A A 48 ? A 64 ? 19 1 1 A C 49 1_555 A G 63 1_555 1.865 -0.700 0.672 4.698 -36.766 10.139 13 A_C49:G63_A A 49 ? A 63 ? 19 1 1 A G 50 1_555 A C 62 1_555 -0.080 -0.162 0.495 1.774 -0.353 -0.473 14 A_G50:C62_A A 50 ? A 62 ? 19 1 1 A U 51 1_555 A A 61 1_555 -0.254 -0.076 0.733 2.811 -7.473 -8.592 15 A_U51:A61_A A 51 ? A 61 ? 20 1 1 A G 52 1_555 A C 60 1_555 -0.239 -0.277 -0.723 8.418 -1.986 -0.130 16 A_G52:C60_A A 52 ? A 60 ? 19 1 1 A G 73 1_555 A C 94 1_555 -0.171 -0.171 -0.280 -5.176 3.882 1.170 17 A_G73:C94_A A 73 ? A 94 ? 19 1 1 A A 74 1_555 A U 93 1_555 -0.612 -0.052 -0.141 6.863 3.709 6.059 18 A_A74:U93_A A 74 ? A 93 ? 20 1 1 A G 76 1_555 A C 92 1_555 -0.231 -0.122 -0.505 0.373 -7.209 2.230 19 A_G76:C92_A A 76 ? A 92 ? 19 1 1 A G 77 1_555 A C 91 1_555 -0.219 -0.176 -0.604 -1.078 2.945 0.316 20 A_G77:C91_A A 77 ? A 91 ? 19 1 1 A C 79 1_555 A G 89 1_555 0.205 -0.350 -0.733 -17.695 5.230 -6.502 21 A_C79:G89_A A 79 ? A 89 ? 19 1 1 A A 80 1_555 A U 88 1_555 0.044 0.044 0.364 -5.320 6.330 -3.313 22 A_A80:U88_A A 80 ? A 88 ? 20 1 1 A C 81 1_555 A G 59 1_555 0.152 -0.076 0.263 -6.726 4.450 2.357 23 A_C81:G59_A A 81 ? A 59 ? 19 1 1 A C 82 1_555 A G 58 1_555 0.174 -0.358 1.278 -7.733 5.446 3.097 24 A_C82:G58_A A 82 ? A 58 ? 19 1 1 A G 83 1_555 A A 85 1_555 4.039 3.037 0.151 9.242 57.320 113.759 25 A_G83:A85_A A 83 ? A 85 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A C 36 1_555 A G 102 1_555 A G 37 1_555 A C 101 1_555 0.010 -1.551 2.783 -7.119 18.228 34.464 -3.894 -0.639 1.745 28.135 10.988 39.485 1 AA_C36G37:C101G102_AA A 36 ? A 102 ? A 37 ? A 101 ? 1 A G 37 1_555 A C 101 1_555 A A 38 1_555 A U 100 1_555 0.265 -1.801 3.140 -2.298 1.479 35.438 -3.156 -0.751 3.042 2.426 3.769 35.540 2 AA_G37A38:U100C101_AA A 37 ? A 101 ? A 38 ? A 100 ? 1 A A 38 1_555 A U 100 1_555 A C 39 1_555 A G 99 1_555 -0.674 -1.837 3.293 0.339 2.324 30.695 -3.908 1.336 3.141 4.383 -0.638 30.783 3 AA_A38C39:G99U100_AA A 38 ? A 100 ? A 39 ? A 99 ? 1 A C 39 1_555 A G 99 1_555 A U 40 1_555 A C 98 1_555 -0.749 -1.619 3.094 0.977 3.062 38.157 -2.824 1.256 2.941 4.673 -1.492 38.287 4 AA_C39U40:C98G99_AA A 39 ? A 99 ? A 40 ? A 98 ? 1 A U 40 1_555 A C 98 1_555 A C 41 1_555 A G 97 1_555 0.245 -1.683 3.086 5.004 6.898 35.233 -3.581 0.240 2.728 11.195 -8.121 36.217 5 AA_U40C41:G97C98_AA A 40 ? A 98 ? A 41 ? A 97 ? 1 A C 41 1_555 A G 97 1_555 A U 42 1_555 A G 96 1_555 3.195 -1.092 -0.918 -93.645 -149.160 -101.879 0.374 1.706 -0.225 74.947 -47.053 -177.555 6 AA_C41U42:G96G97_AA A 41 ? A 97 ? A 42 ? A 96 ? 1 A U 42 1_555 A G 96 1_555 A C 70 1_555 A G 95 1_555 -2.000 2.912 -1.944 -158.840 -57.884 -149.484 -1.549 -0.746 -2.107 29.008 -79.600 -177.124 7 AA_U42C70:G95G96_AA A 42 ? A 96 ? A 70 ? A 95 ? 1 A C 70 1_555 A G 95 1_555 A A 71 1_555 A A 43 1_555 2.656 1.634 2.598 24.266 1.082 -34.176 -2.356 5.119 0.604 -1.614 36.183 -41.717 8 AA_C70A71:A43G95_AA A 70 ? A 95 ? A 71 ? A 43 ? 1 A A 71 1_555 A A 43 1_555 A A 72 1_555 A U 44 1_555 0.297 2.143 4.623 -49.327 -1.861 23.130 2.515 -4.647 1.695 -2.504 66.384 54.204 9 AA_A71A72:U44A43_AA A 71 ? A 43 ? A 72 ? A 44 ? 1 A G 48 1_555 A C 64 1_555 A C 49 1_555 A G 63 1_555 2.991 -2.522 3.161 12.424 15.844 43.821 -4.307 -2.729 2.843 20.022 -15.700 48.018 10 AA_G48C49:G63C64_AA A 48 ? A 64 ? A 49 ? A 63 ? 1 A C 49 1_555 A G 63 1_555 A G 50 1_555 A C 62 1_555 -0.547 -1.548 2.508 1.139 23.718 31.134 -4.091 0.905 1.084 38.031 -1.827 38.977 11 AA_C49G50:C62G63_AA A 49 ? A 63 ? A 50 ? A 62 ? 1 A G 50 1_555 A C 62 1_555 A U 51 1_555 A A 61 1_555 -1.349 -2.357 3.257 -1.490 -1.451 19.465 -6.199 3.215 3.513 -4.277 4.391 19.574 12 AA_G50U51:A61C62_AA A 50 ? A 62 ? A 51 ? A 61 ? 1 A U 51 1_555 A A 61 1_555 A G 52 1_555 A C 60 1_555 0.065 -1.833 2.848 3.159 7.693 31.663 -4.329 0.324 2.345 13.804 -5.668 32.710 13 AA_U51G52:C60A61_AA A 51 ? A 61 ? A 52 ? A 60 ? 1 A G 73 1_555 A C 94 1_555 A A 74 1_555 A U 93 1_555 0.041 -1.553 3.049 -0.767 4.351 32.214 -3.459 -0.195 2.819 7.795 1.375 32.508 14 AA_G73A74:U93C94_AA A 73 ? A 94 ? A 74 ? A 93 ? 1 A A 74 1_555 A U 93 1_555 A G 76 1_555 A C 92 1_555 -1.998 -1.250 5.487 21.360 21.727 45.775 -3.351 4.134 3.447 24.959 -24.537 54.530 15 AA_A74G76:C92U93_AA A 74 ? A 93 ? A 76 ? A 92 ? 1 A G 76 1_555 A C 92 1_555 A G 77 1_555 A C 91 1_555 0.873 -2.115 3.309 -1.155 6.903 23.392 -6.976 -2.395 2.543 16.557 2.771 24.402 16 AA_G76G77:C91C92_AA A 76 ? A 92 ? A 77 ? A 91 ? 1 A C 79 1_555 A G 89 1_555 A A 80 1_555 A U 88 1_555 0.488 -1.319 2.793 -7.488 6.531 35.225 -2.828 -1.609 2.370 10.536 12.079 36.557 17 AA_C79A80:U88G89_AA A 79 ? A 89 ? A 80 ? A 88 ? 1 A A 80 1_555 A U 88 1_555 A C 81 1_555 A G 59 1_555 2.215 -1.154 3.183 4.251 0.877 50.319 -1.415 -2.296 3.329 1.029 -4.989 50.493 18 AA_A80C81:G59U88_AA A 80 ? A 88 ? A 81 ? A 59 ? 1 A C 81 1_555 A G 59 1_555 A C 82 1_555 A G 58 1_555 -0.042 -1.867 3.301 -5.511 0.944 28.496 -3.933 -1.130 3.190 1.896 11.061 29.028 19 AA_C81C82:G58G59_AA A 81 ? A 59 ? A 82 ? A 58 ? 1 A C 82 1_555 A G 58 1_555 A G 83 1_555 A A 85 1_555 -2.931 3.002 2.220 15.189 37.813 -21.173 -5.135 -3.263 -0.442 -59.091 23.737 -45.714 20 AA_C82G83:A85G58_AA A 82 ? A 58 ? A 83 ? A 85 ? # _pdbx_audit_support.funding_organization 'National Institutes of Health/National Heart, Lung, and Blood Institute (NIH/NHLBI)' _pdbx_audit_support.country 'United States' _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _atom_sites.entry_id 9NDV _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 1.000000 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 1.000000 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 1.000000 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C K MG N O P # loop_ #