data_9URX # _entry.id 9URX # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9URX pdb_00009urx 10.2210/pdb9urx/pdb WWPDB D_1300058983 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-11-04 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9URX _pdbx_database_status.recvd_initial_deposition_date 2025-04-30 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 5 _pdbx_contact_author.email huanglin36@mail.sysu.edu.cn _pdbx_contact_author.name_first Lin _pdbx_contact_author.name_last Huang _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-2121-365X # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Chen, X.' 1 0000-0002-4502-0633 'Luo, Y.' 2 0009-0006-3449-7088 'Ren, Y.' 3 0009-0006-0959-2008 'Huang, L.' 4 0000-0002-2121-365X # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of adenosine and ATP-binding DNA aptamer' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Chen, X.' 1 0000-0002-4502-0633 primary 'Luo, Y.' 2 0009-0006-3449-7088 primary 'Ren, Y.' 3 0009-0006-0959-2008 primary 'Huang, L.' 4 0000-0002-2121-365X # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer syn 'DNA (44-MER)' 13618.746 1 ? ? ? ? 2 non-polymer syn "ADENOSINE-5'-TRIPHOSPHATE" 507.181 1 ? ? ? ? 3 non-polymer syn 'CALCIUM ION' 40.078 3 ? ? ? ? 4 water nat water 18.015 84 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polydeoxyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;(DT)(DG)(DT)(DA)(DC)(DG)(DA)(DC)(DA)(DC)(DG)(DG)(DA)(DG)(DG)(DC)(DT)(DT)(DA)(DG) (DT)(DT)(DT)(DG)(DC)(DT)(DA)(DA)(DA)(DT)(DG)(DG)(DT)(DC)(DA)(DT)(DG)(DT)(DC)(DG) (DT)(DA)(DC)(DA) ; _entity_poly.pdbx_seq_one_letter_code_can TGTACGACACGGAGGCTTAGTTTGCTAAATGGTCATGTCGTACA _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 "ADENOSINE-5'-TRIPHOSPHATE" ATP 3 'CALCIUM ION' CA 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 DT n 1 2 DG n 1 3 DT n 1 4 DA n 1 5 DC n 1 6 DG n 1 7 DA n 1 8 DC n 1 9 DA n 1 10 DC n 1 11 DG n 1 12 DG n 1 13 DA n 1 14 DG n 1 15 DG n 1 16 DC n 1 17 DT n 1 18 DT n 1 19 DA n 1 20 DG n 1 21 DT n 1 22 DT n 1 23 DT n 1 24 DG n 1 25 DC n 1 26 DT n 1 27 DA n 1 28 DA n 1 29 DA n 1 30 DT n 1 31 DG n 1 32 DG n 1 33 DT n 1 34 DC n 1 35 DA n 1 36 DT n 1 37 DG n 1 38 DT n 1 39 DC n 1 40 DG n 1 41 DT n 1 42 DA n 1 43 DC n 1 44 DA n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 44 _pdbx_entity_src_syn.organism_scientific 'synthetic construct' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 32630 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight ATP non-polymer . "ADENOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O13 P3' 507.181 CA non-polymer . 'CALCIUM ION' ? 'Ca 2' 40.078 DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O7 P' 307.197 DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE" ? 'C10 H15 N2 O8 P' 322.208 HOH non-polymer . WATER ? 'H2 O' 18.015 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 DT 1 -2 -2 DT DT A . n A 1 2 DG 2 -1 -1 DG DG A . n A 1 3 DT 3 0 0 DT DT A . n A 1 4 DA 4 1 1 DA DA A . n A 1 5 DC 5 2 2 DC DC A . n A 1 6 DG 6 3 3 DG DG A . n A 1 7 DA 7 4 4 DA DA A . n A 1 8 DC 8 5 5 DC DC A . n A 1 9 DA 9 6 6 DA DA A . n A 1 10 DC 10 7 7 DC DC A . n A 1 11 DG 11 8 8 DG DG A . n A 1 12 DG 12 9 9 DG DG A . n A 1 13 DA 13 10 10 DA DA A . n A 1 14 DG 14 11 11 DG DG A . n A 1 15 DG 15 12 12 DG DG A . n A 1 16 DC 16 13 13 DC DC A . n A 1 17 DT 17 14 14 DT DT A . n A 1 18 DT 18 15 15 DT DT A . n A 1 19 DA 19 16 16 DA DA A . n A 1 20 DG 20 17 17 DG DG A . n A 1 21 DT 21 18 18 DT DT A . n A 1 22 DT 22 19 19 DT DT A . n A 1 23 DT 23 20 20 DT DT A . n A 1 24 DG 24 21 21 DG DG A . n A 1 25 DC 25 22 22 DC DC A . n A 1 26 DT 26 23 23 DT DT A . n A 1 27 DA 27 24 24 DA DA A . n A 1 28 DA 28 25 25 DA DA A . n A 1 29 DA 29 26 26 DA DA A . n A 1 30 DT 30 27 27 DT DT A . n A 1 31 DG 31 28 28 DG DG A . n A 1 32 DG 32 29 29 DG DG A . n A 1 33 DT 33 30 30 DT DT A . n A 1 34 DC 34 31 31 DC DC A . n A 1 35 DA 35 32 32 DA DA A . n A 1 36 DT 36 33 33 DT DT A . n A 1 37 DG 37 34 34 DG DG A . n A 1 38 DT 38 35 35 DT DT A . n A 1 39 DC 39 36 36 DC DC A . n A 1 40 DG 40 37 37 DG DG A . n A 1 41 DT 41 38 38 DT DT A . n A 1 42 DA 42 39 39 DA DA A . n A 1 43 DC 43 40 40 DC DC A . n A 1 44 DA 44 41 41 DA DA A . n # loop_ _pdbx_entity_instance_feature.ordinal _pdbx_entity_instance_feature.comp_id _pdbx_entity_instance_feature.asym_id _pdbx_entity_instance_feature.seq_num _pdbx_entity_instance_feature.auth_comp_id _pdbx_entity_instance_feature.auth_asym_id _pdbx_entity_instance_feature.auth_seq_num _pdbx_entity_instance_feature.feature_type _pdbx_entity_instance_feature.details 1 ATP ? ? ATP ? ? 'SUBJECT OF INVESTIGATION' ? 2 CA ? ? CA ? ? 'SUBJECT OF INVESTIGATION' ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 ATP 1 101 1 ATP ATP A . C 3 CA 1 102 1 CA CA A . D 3 CA 1 103 2 CA CA A . E 3 CA 1 104 3 CA CA A . F 4 HOH 1 201 1 HOH HOH A . F 4 HOH 2 202 25 HOH HOH A . F 4 HOH 3 203 2 HOH HOH A . F 4 HOH 4 204 20 HOH HOH A . F 4 HOH 5 205 42 HOH HOH A . F 4 HOH 6 206 46 HOH HOH A . F 4 HOH 7 207 34 HOH HOH A . F 4 HOH 8 208 66 HOH HOH A . F 4 HOH 9 209 40 HOH HOH A . F 4 HOH 10 210 39 HOH HOH A . F 4 HOH 11 211 3 HOH HOH A . F 4 HOH 12 212 21 HOH HOH A . F 4 HOH 13 213 13 HOH HOH A . F 4 HOH 14 214 41 HOH HOH A . F 4 HOH 15 215 58 HOH HOH A . F 4 HOH 16 216 9 HOH HOH A . F 4 HOH 17 217 29 HOH HOH A . F 4 HOH 18 218 24 HOH HOH A . F 4 HOH 19 219 69 HOH HOH A . F 4 HOH 20 220 35 HOH HOH A . F 4 HOH 21 221 11 HOH HOH A . F 4 HOH 22 222 14 HOH HOH A . F 4 HOH 23 223 64 HOH HOH A . F 4 HOH 24 224 53 HOH HOH A . F 4 HOH 25 225 50 HOH HOH A . F 4 HOH 26 226 8 HOH HOH A . F 4 HOH 27 227 27 HOH HOH A . F 4 HOH 28 228 5 HOH HOH A . F 4 HOH 29 229 78 HOH HOH A . F 4 HOH 30 230 56 HOH HOH A . F 4 HOH 31 231 23 HOH HOH A . F 4 HOH 32 232 80 HOH HOH A . F 4 HOH 33 233 12 HOH HOH A . F 4 HOH 34 234 48 HOH HOH A . F 4 HOH 35 235 76 HOH HOH A . F 4 HOH 36 236 77 HOH HOH A . F 4 HOH 37 237 44 HOH HOH A . F 4 HOH 38 238 33 HOH HOH A . F 4 HOH 39 239 59 HOH HOH A . F 4 HOH 40 240 54 HOH HOH A . F 4 HOH 41 241 79 HOH HOH A . F 4 HOH 42 242 32 HOH HOH A . F 4 HOH 43 243 17 HOH HOH A . F 4 HOH 44 244 83 HOH HOH A . F 4 HOH 45 245 18 HOH HOH A . F 4 HOH 46 246 61 HOH HOH A . F 4 HOH 47 247 26 HOH HOH A . F 4 HOH 48 248 62 HOH HOH A . F 4 HOH 49 249 38 HOH HOH A . F 4 HOH 50 250 19 HOH HOH A . F 4 HOH 51 251 15 HOH HOH A . F 4 HOH 52 252 67 HOH HOH A . F 4 HOH 53 253 6 HOH HOH A . F 4 HOH 54 254 10 HOH HOH A . F 4 HOH 55 255 52 HOH HOH A . F 4 HOH 56 256 45 HOH HOH A . F 4 HOH 57 257 36 HOH HOH A . F 4 HOH 58 258 60 HOH HOH A . F 4 HOH 59 259 30 HOH HOH A . F 4 HOH 60 260 71 HOH HOH A . F 4 HOH 61 261 28 HOH HOH A . F 4 HOH 62 262 7 HOH HOH A . F 4 HOH 63 263 43 HOH HOH A . F 4 HOH 64 264 72 HOH HOH A . F 4 HOH 65 265 84 HOH HOH A . F 4 HOH 66 266 57 HOH HOH A . F 4 HOH 67 267 75 HOH HOH A . F 4 HOH 68 268 16 HOH HOH A . F 4 HOH 69 269 73 HOH HOH A . F 4 HOH 70 270 22 HOH HOH A . F 4 HOH 71 271 31 HOH HOH A . F 4 HOH 72 272 37 HOH HOH A . F 4 HOH 73 273 4 HOH HOH A . F 4 HOH 74 274 51 HOH HOH A . F 4 HOH 75 275 82 HOH HOH A . F 4 HOH 76 276 47 HOH HOH A . F 4 HOH 77 277 49 HOH HOH A . F 4 HOH 78 278 74 HOH HOH A . F 4 HOH 79 279 70 HOH HOH A . F 4 HOH 80 280 63 HOH HOH A . F 4 HOH 81 281 68 HOH HOH A . F 4 HOH 82 282 55 HOH HOH A . F 4 HOH 83 283 65 HOH HOH A . F 4 HOH 84 284 81 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 ? 1 ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 ? 2 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . ? 3 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? xia2 ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.000 _cell.angle_alpha_esd ? _cell.angle_beta 90.000 _cell.angle_beta_esd ? _cell.angle_gamma 120.000 _cell.angle_gamma_esd ? _cell.entry_id 9URX _cell.details ? _cell.formula_units_Z ? _cell.length_a 57.840 _cell.length_a_esd ? _cell.length_b 57.840 _cell.length_b_esd ? _cell.length_c 122.340 _cell.length_c_esd ? _cell.volume 354450.568 _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9URX _symmetry.cell_setting ? _symmetry.Int_Tables_number 180 _symmetry.space_group_name_Hall 'P 62 2 (x,y,z+1/3)' _symmetry.space_group_name_H-M 'P 62 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9URX _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.17 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 43.29 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, HANGING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH 7.5 _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.2 M Calcium chloride dihydrate, 0.05 M HEPES sodium pH 7.5, 30% v/v Polyethylene glycol 400, 0.002 M Spermine, 0.01 M barium chloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 291 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS EIGER X 16M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2023-12-07 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97861 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97861 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate 31.91 _reflns.entry_id 9URX _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 1.66 _reflns.d_resolution_low 30.58 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 15076 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 100.0 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 36.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 32.7 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all 0.013 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 1.000 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.056 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 1.66 _reflns_shell.d_res_low 1.70 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 1096 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all 0.537 _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.798 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs 2.389 _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean 44.79 _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9URX _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 1.66 _refine.ls_d_res_low 28.92 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 15024 _refine.ls_number_reflns_R_free 1500 _refine.ls_number_reflns_R_work 13524 _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.96 _refine.ls_percent_reflns_R_free 9.98 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2281 _refine.ls_R_factor_R_free 0.2537 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2253 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method 'FREE R-VALUE' _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values 'GeoStd + Monomer Library + CDL v1.2' _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.1000 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.9000 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.9105 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.2261 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 1.66 _refine_hist.d_res_low 28.92 _refine_hist.number_atoms_solvent 84 _refine_hist.number_atoms_total 1022 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 904 _refine_hist.pdbx_number_atoms_ligand 34 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.0077 ? 1047 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.0261 ? 1617 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.0475 ? 179 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.0094 ? 45 ? f_plane_restr ? ? ? 'X-RAY DIFFRACTION' ? 34.1513 ? 439 ? f_dihedral_angle_d ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 1.66 1.71 . . 131 1192 99.85 . . . . 0.2879 . . . . . . . . . . . . . . . 0.3357 'X-RAY DIFFRACTION' 1.71 1.77 . . 131 1187 100.00 . . . . 0.2730 . . . . . . . . . . . . . . . 0.2821 'X-RAY DIFFRACTION' 1.77 1.85 . . 133 1202 100.00 . . . . 0.2986 . . . . . . . . . . . . . . . 0.3517 'X-RAY DIFFRACTION' 1.85 1.93 . . 135 1210 99.93 . . . . 0.3047 . . . . . . . . . . . . . . . 0.3800 'X-RAY DIFFRACTION' 1.93 2.03 . . 133 1187 100.00 . . . . 0.2912 . . . . . . . . . . . . . . . 0.3280 'X-RAY DIFFRACTION' 2.03 2.16 . . 134 1214 100.00 . . . . 0.2857 . . . . . . . . . . . . . . . 0.3519 'X-RAY DIFFRACTION' 2.16 2.33 . . 136 1227 100.00 . . . . 0.3006 . . . . . . . . . . . . . . . 0.3511 'X-RAY DIFFRACTION' 2.33 2.56 . . 136 1218 100.00 . . . . 0.3069 . . . . . . . . . . . . . . . 0.3478 'X-RAY DIFFRACTION' 2.56 2.93 . . 138 1246 100.00 . . . . 0.2870 . . . . . . . . . . . . . . . 0.2806 'X-RAY DIFFRACTION' 2.93 3.69 . . 140 1264 99.79 . . . . 0.1928 . . . . . . . . . . . . . . . 0.2032 'X-RAY DIFFRACTION' 3.69 28.92 . . 153 1377 100.00 . . . . 0.1751 . . . . . . . . . . . . . . . 0.2093 # _struct.entry_id 9URX _struct.title 'Crystal structure of Ade1304 DNA aptamer (1304b9) bound to ATP' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9URX _struct_keywords.text 'Adenosine/ATP DNA aptamer, ATP, DNA' _struct_keywords.pdbx_keywords DNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 3 ? F N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9URX _struct_ref.pdbx_db_accession 9URX _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9URX _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 44 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9URX _struct_ref_seq.db_align_beg -2 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 41 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg -2 _struct_ref_seq.pdbx_auth_seq_align_end 41 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details tetrameric _pdbx_struct_assembly.oligomeric_count 4 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 2830 ? 1 MORE -180 ? 1 'SSA (A^2)' 31460 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2,3,4 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E,F # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 4_555 -x,-y,z -1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 3 'crystal symmetry operation' 9_555 -x,-x+y,-z+1/3 -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 -0.8660254038 0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 40.7800000000 4 'crystal symmetry operation' 12_555 x,x-y,-z+1/3 0.5000000000 0.8660254038 0.0000000000 0.0000000000 0.8660254038 -0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 40.7800000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A DG 2 OP1 ? ? ? 1_555 D CA . CA ? ? A DG -1 A CA 103 1_445 ? ? ? ? ? ? ? 2.855 ? ? metalc2 metalc ? ? A DA 7 OP1 ? ? ? 1_555 C CA . CA ? ? A DA 4 A CA 102 9_555 ? ? ? ? ? ? ? 2.374 ? ? metalc3 metalc ? ? A DA 7 OP2 ? ? ? 1_555 E CA . CA ? ? A DA 4 A CA 104 1_555 ? ? ? ? ? ? ? 2.302 ? ? metalc4 metalc ? ? A DC 10 O2 ? ? ? 1_555 C CA . CA ? ? A DC 7 A CA 102 1_555 ? ? ? ? ? ? ? 2.294 ? ? metalc5 metalc ? ? A DG 11 O6 ? ? ? 1_555 C CA . CA ? ? A DG 8 A CA 102 1_555 ? ? ? ? ? ? ? 2.273 ? ? metalc6 metalc ? ? A DT 22 OP2 ? ? ? 1_555 D CA . CA ? ? A DT 19 A CA 103 1_555 ? ? ? ? ? ? ? 2.161 ? ? metalc7 metalc ? ? A DT 23 OP2 ? ? ? 1_555 D CA . CA ? ? A DT 20 A CA 103 1_555 ? ? ? ? ? ? ? 2.266 ? ? metalc8 metalc ? ? A DG 32 OP2 ? ? ? 1_555 C CA . CA ? ? A DG 29 A CA 102 1_555 ? ? ? ? ? ? ? 2.312 ? ? metalc9 metalc ? ? A DG 32 OP1 ? ? ? 1_555 E CA . CA ? ? A DG 29 A CA 104 9_555 ? ? ? ? ? ? ? 2.240 ? ? metalc10 metalc ? ? C CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 102 A HOH 253 1_555 ? ? ? ? ? ? ? 2.302 ? ? metalc11 metalc ? ? C CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 102 A HOH 268 9_555 ? ? ? ? ? ? ? 2.465 ? ? metalc12 metalc ? ? D CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 103 A HOH 237 1_665 ? ? ? ? ? ? ? 2.481 ? ? metalc13 metalc ? ? D CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 103 A HOH 240 1_665 ? ? ? ? ? ? ? 2.456 ? ? metalc14 metalc ? ? D CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 103 A HOH 263 1_555 ? ? ? ? ? ? ? 2.356 ? ? metalc15 metalc ? ? E CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 104 A HOH 220 1_555 ? ? ? ? ? ? ? 2.326 ? ? metalc16 metalc ? ? E CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 104 A HOH 243 9_555 ? ? ? ? ? ? ? 2.133 ? ? metalc17 metalc ? ? E CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 104 A HOH 261 1_555 ? ? ? ? ? ? ? 2.287 ? ? metalc18 metalc ? ? E CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 104 A HOH 262 1_555 ? ? ? ? ? ? ? 2.471 ? ? metalc19 metalc ? ? E CA . CA ? ? ? 1_555 F HOH . O ? ? A CA 104 A HOH 270 9_555 ? ? ? ? ? ? ? 2.219 ? ? hydrog1 hydrog ? ? A DG 2 N1 ? ? ? 1_555 A DC 43 N3 ? ? A DG -1 A DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A DG 2 N2 ? ? ? 1_555 A DC 43 O2 ? ? A DG -1 A DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A DG 2 O6 ? ? ? 1_555 A DC 43 N4 ? ? A DG -1 A DC 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A DT 3 N3 ? ? ? 1_555 A DA 42 N1 ? ? A DT 0 A DA 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A DT 3 O4 ? ? ? 1_555 A DA 42 N6 ? ? A DT 0 A DA 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A DA 4 N1 ? ? ? 1_555 A DT 41 N3 ? ? A DA 1 A DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A DA 4 N6 ? ? ? 1_555 A DT 41 O4 ? ? A DA 1 A DT 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A DC 5 N3 ? ? ? 1_555 A DG 40 N1 ? ? A DC 2 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A DC 5 N4 ? ? ? 1_555 A DG 40 O6 ? ? A DC 2 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A DC 5 O2 ? ? ? 1_555 A DG 40 N2 ? ? A DC 2 A DG 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A DG 6 N1 ? ? ? 1_555 A DC 39 N3 ? ? A DG 3 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A DG 6 N2 ? ? ? 1_555 A DC 39 O2 ? ? A DG 3 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A DG 6 O6 ? ? ? 1_555 A DC 39 N4 ? ? A DG 3 A DC 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A DA 7 N1 ? ? ? 1_555 A DT 38 N3 ? ? A DA 4 A DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A DA 7 N6 ? ? ? 1_555 A DT 38 O4 ? ? A DA 4 A DT 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A DC 8 N3 ? ? ? 1_555 A DG 37 N1 ? ? A DC 5 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A DC 8 N4 ? ? ? 1_555 A DG 37 O6 ? ? A DC 5 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A DC 8 O2 ? ? ? 1_555 A DG 37 N2 ? ? A DC 5 A DG 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A DA 9 N1 ? ? ? 1_555 A DT 36 N3 ? ? A DA 6 A DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A DA 9 N6 ? ? ? 1_555 A DT 36 O4 ? ? A DA 6 A DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A DG 11 N1 ? ? ? 1_555 A DG 32 N7 ? ? A DG 8 A DG 29 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog22 hydrog ? ? A DG 11 N2 ? ? ? 1_555 A DG 32 O6 ? ? A DG 8 A DG 29 1_555 ? ? ? ? ? ? TYPE_7_PAIR ? ? ? hydrog23 hydrog ? ? A DA 13 N6 ? ? ? 1_555 A DG 31 N3 ? ? A DA 10 A DG 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog24 hydrog ? ? A DA 13 N7 ? ? ? 1_555 A DG 31 N2 ? ? A DA 10 A DG 28 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog25 hydrog ? ? A DA 13 N1 ? ? ? 1_555 A DT 33 N3 ? ? A DA 10 A DT 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A DA 13 N6 ? ? ? 1_555 A DT 33 O4 ? ? A DA 10 A DT 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A DG 14 N2 ? ? ? 1_555 A DC 16 N3 ? ? A DG 11 A DC 13 1_555 ? ? ? ? ? ? 'DG-DC PAIR' ? ? ? hydrog28 hydrog ? ? A DG 14 N1 ? ? ? 1_555 A DT 30 O2 ? ? A DG 11 A DT 27 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog29 hydrog ? ? A DG 14 O6 ? ? ? 1_555 A DT 30 N3 ? ? A DG 11 A DT 27 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog30 hydrog ? ? A DG 15 N1 ? ? ? 1_555 A DA 29 N1 ? ? A DG 12 A DA 26 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog31 hydrog ? ? A DG 15 O6 ? ? ? 1_555 A DA 29 N6 ? ? A DG 12 A DA 26 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog32 hydrog ? ? A DT 17 N3 ? ? ? 1_555 A DA 28 N1 ? ? A DT 14 A DA 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A DT 17 O4 ? ? ? 1_555 A DA 28 N6 ? ? A DT 14 A DA 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A DT 18 N3 ? ? ? 1_555 A DA 27 N1 ? ? A DT 15 A DA 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A DT 18 O4 ? ? ? 1_555 A DA 27 N6 ? ? A DT 15 A DA 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A DA 19 N1 ? ? ? 1_555 A DT 26 N3 ? ? A DA 16 A DT 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A DA 19 N6 ? ? ? 1_555 A DT 26 O4 ? ? A DA 16 A DT 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A DG 20 N1 ? ? ? 1_555 A DC 25 N3 ? ? A DG 17 A DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A DG 20 N2 ? ? ? 1_555 A DC 25 O2 ? ? A DG 17 A DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A DG 20 O6 ? ? ? 1_555 A DC 25 N4 ? ? A DG 17 A DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A DG 32 N2 ? ? ? 1_555 A DA 35 N7 ? ? A DG 29 A DA 32 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog42 hydrog ? ? A DG 32 N3 ? ? ? 1_555 A DA 35 N6 ? ? A DG 29 A DA 32 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 OP1 ? A DG 2 ? A DG -1 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 OP2 ? A DT 22 ? A DT 19 ? 1_555 85.9 ? 2 OP1 ? A DG 2 ? A DG -1 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 OP2 ? A DT 23 ? A DT 20 ? 1_555 83.5 ? 3 OP2 ? A DT 22 ? A DT 19 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 OP2 ? A DT 23 ? A DT 20 ? 1_555 2.9 ? 4 OP1 ? A DG 2 ? A DG -1 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 237 ? 1_665 83.0 ? 5 OP2 ? A DT 22 ? A DT 19 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 237 ? 1_665 3.0 ? 6 OP2 ? A DT 23 ? A DT 20 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 237 ? 1_665 2.4 ? 7 OP1 ? A DG 2 ? A DG -1 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 240 ? 1_665 83.0 ? 8 OP2 ? A DT 22 ? A DT 19 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 240 ? 1_665 3.5 ? 9 OP2 ? A DT 23 ? A DT 20 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 240 ? 1_665 3.6 ? 10 O ? F HOH . ? A HOH 237 ? 1_665 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 240 ? 1_665 1.2 ? 11 OP1 ? A DG 2 ? A DG -1 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 263 ? 1_555 83.8 ? 12 OP2 ? A DT 22 ? A DT 19 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 263 ? 1_555 3.0 ? 13 OP2 ? A DT 23 ? A DT 20 ? 1_555 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 263 ? 1_555 0.5 ? 14 O ? F HOH . ? A HOH 237 ? 1_665 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 263 ? 1_555 3.0 ? 15 O ? F HOH . ? A HOH 240 ? 1_665 CA ? D CA . ? A CA 103 ? 1_445 O ? F HOH . ? A HOH 263 ? 1_555 4.1 ? 16 OP1 ? A DA 7 ? A DA 4 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O2 ? A DC 10 ? A DC 7 ? 1_555 82.2 ? 17 OP1 ? A DA 7 ? A DA 4 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O6 ? A DG 11 ? A DG 8 ? 1_555 74.7 ? 18 O2 ? A DC 10 ? A DC 7 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O6 ? A DG 11 ? A DG 8 ? 1_555 7.6 ? 19 OP1 ? A DA 7 ? A DA 4 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 OP2 ? A DG 32 ? A DG 29 ? 1_555 75.8 ? 20 O2 ? A DC 10 ? A DC 7 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 OP2 ? A DG 32 ? A DG 29 ? 1_555 12.0 ? 21 O6 ? A DG 11 ? A DG 8 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 OP2 ? A DG 32 ? A DG 29 ? 1_555 8.9 ? 22 OP1 ? A DA 7 ? A DA 4 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 253 ? 1_555 82.5 ? 23 O2 ? A DC 10 ? A DC 7 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 253 ? 1_555 4.1 ? 24 O6 ? A DG 11 ? A DG 8 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 253 ? 1_555 8.3 ? 25 OP2 ? A DG 32 ? A DG 29 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 253 ? 1_555 9.1 ? 26 OP1 ? A DA 7 ? A DA 4 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 268 ? 9_555 76.0 ? 27 O2 ? A DC 10 ? A DC 7 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 268 ? 9_555 11.6 ? 28 O6 ? A DG 11 ? A DG 8 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 268 ? 9_555 8.5 ? 29 OP2 ? A DG 32 ? A DG 29 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 268 ? 9_555 0.5 ? 30 O ? F HOH . ? A HOH 253 ? 1_555 CA ? C CA . ? A CA 102 ? 9_555 O ? F HOH . ? A HOH 268 ? 9_555 8.7 ? 31 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 OP1 ? A DG 32 ? A DG 29 ? 1_555 61.4 ? 32 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 220 ? 1_555 69.9 ? 33 OP1 ? A DG 32 ? A DG 29 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 220 ? 1_555 20.7 ? 34 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 243 ? 9_555 132.9 ? 35 OP1 ? A DG 32 ? A DG 29 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 243 ? 9_555 71.6 ? 36 O ? F HOH . ? A HOH 220 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 243 ? 9_555 64.9 ? 37 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 261 ? 1_555 85.4 ? 38 OP1 ? A DG 32 ? A DG 29 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 261 ? 1_555 80.1 ? 39 O ? F HOH . ? A HOH 220 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 261 ? 1_555 99.6 ? 40 O ? F HOH . ? A HOH 243 ? 9_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 261 ? 1_555 89.7 ? 41 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 262 ? 1_555 83.5 ? 42 OP1 ? A DG 32 ? A DG 29 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 262 ? 1_555 143.7 ? 43 O ? F HOH . ? A HOH 220 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 262 ? 1_555 151.2 ? 44 O ? F HOH . ? A HOH 243 ? 9_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 262 ? 1_555 143.3 ? 45 O ? F HOH . ? A HOH 261 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 262 ? 1_555 88.6 ? 46 OP2 ? A DA 7 ? A DA 4 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 146.7 ? 47 OP1 ? A DG 32 ? A DG 29 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 141.0 ? 48 O ? F HOH . ? A HOH 220 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 141.2 ? 49 O ? F HOH . ? A HOH 243 ? 9_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 76.3 ? 50 O ? F HOH . ? A HOH 261 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 78.2 ? 51 O ? F HOH . ? A HOH 262 ? 1_555 CA ? E CA . ? A CA 104 ? 1_555 O ? F HOH . ? A HOH 270 ? 9_555 67.5 ? # _pdbx_entry_details.entry_id 9URX _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 O A HOH 236 ? ? O A HOH 269 ? ? 2.00 2 1 OP1 A DA 16 ? ? O A HOH 202 ? ? 2.09 3 1 O2 A DT 20 ? ? O A HOH 204 ? ? 2.15 # loop_ _pdbx_validate_symm_contact.id _pdbx_validate_symm_contact.PDB_model_num _pdbx_validate_symm_contact.auth_atom_id_1 _pdbx_validate_symm_contact.auth_asym_id_1 _pdbx_validate_symm_contact.auth_comp_id_1 _pdbx_validate_symm_contact.auth_seq_id_1 _pdbx_validate_symm_contact.PDB_ins_code_1 _pdbx_validate_symm_contact.label_alt_id_1 _pdbx_validate_symm_contact.site_symmetry_1 _pdbx_validate_symm_contact.auth_atom_id_2 _pdbx_validate_symm_contact.auth_asym_id_2 _pdbx_validate_symm_contact.auth_comp_id_2 _pdbx_validate_symm_contact.auth_seq_id_2 _pdbx_validate_symm_contact.PDB_ins_code_2 _pdbx_validate_symm_contact.label_alt_id_2 _pdbx_validate_symm_contact.site_symmetry_2 _pdbx_validate_symm_contact.dist 1 1 O A HOH 209 ? ? 1_555 O A HOH 210 ? ? 11_545 1.70 2 1 O A HOH 207 ? ? 1_555 O A HOH 210 ? ? 11_655 2.13 # loop_ _pdbx_validate_rmsd_bond.id _pdbx_validate_rmsd_bond.PDB_model_num _pdbx_validate_rmsd_bond.auth_atom_id_1 _pdbx_validate_rmsd_bond.auth_asym_id_1 _pdbx_validate_rmsd_bond.auth_comp_id_1 _pdbx_validate_rmsd_bond.auth_seq_id_1 _pdbx_validate_rmsd_bond.PDB_ins_code_1 _pdbx_validate_rmsd_bond.label_alt_id_1 _pdbx_validate_rmsd_bond.auth_atom_id_2 _pdbx_validate_rmsd_bond.auth_asym_id_2 _pdbx_validate_rmsd_bond.auth_comp_id_2 _pdbx_validate_rmsd_bond.auth_seq_id_2 _pdbx_validate_rmsd_bond.PDB_ins_code_2 _pdbx_validate_rmsd_bond.label_alt_id_2 _pdbx_validate_rmsd_bond.bond_value _pdbx_validate_rmsd_bond.bond_target_value _pdbx_validate_rmsd_bond.bond_deviation _pdbx_validate_rmsd_bond.bond_standard_deviation _pdbx_validate_rmsd_bond.linker_flag 1 1 "O3'" A DC 5 ? ? "C3'" A DC 5 ? ? 1.376 1.419 -0.043 0.006 N 2 1 "O3'" A DC 36 ? ? "C3'" A DC 36 ? ? 1.383 1.419 -0.036 0.006 N # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O4'" A DC 2 ? ? "C1'" A DC 2 ? ? N1 A DC 2 ? ? 111.55 108.30 3.25 0.30 N 2 1 "O4'" A DA 4 ? ? "C1'" A DA 4 ? ? N9 A DA 4 ? ? 110.66 108.30 2.36 0.30 N 3 1 "O4'" A DG 21 ? ? "C1'" A DG 21 ? ? N9 A DG 21 ? ? 110.43 108.30 2.13 0.30 N 4 1 "O4'" A DA 32 ? ? "C1'" A DA 32 ? ? N9 A DA 32 ? ? 110.87 108.30 2.57 0.30 N # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 A HOH 201 ? F HOH . 2 1 A HOH 203 ? F HOH . 3 1 A HOH 211 ? F HOH . 4 1 A HOH 278 ? F HOH . 5 1 A HOH 279 ? F HOH . # loop_ _space_group_symop.id _space_group_symop.operation_xyz 1 x,y,z 2 x-y,x,z+1/3 3 y,-x+y,z+2/3 4 -y,x-y,z+2/3 5 -x+y,-x,z+1/3 6 x-y,-y,-z 7 -x,-x+y,-z+1/3 8 -x,-y,z 9 y,x,-z+2/3 10 -y,-x,-z+2/3 11 -x+y,y,-z 12 x,x-y,-z+1/3 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 10.2329977439 _pdbx_refine_tls.origin_y -4.7911766473 _pdbx_refine_tls.origin_z 9.43553654287 _pdbx_refine_tls.T[1][1] 0.446187469535 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.104301585019 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] 0.0507909364379 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.31967224228 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0100871124701 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.302867047447 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 0.811146207189 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.446903196566 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.521952769559 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.593621614639 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.09976084934 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.17125356437 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.334115852319 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.123426137937 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.174948176356 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] -0.568912393511 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.148666380006 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.181926951177 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.0148686560505 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.000986138422437 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0133286433587 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id A _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id B _pdbx_refine_tls_group.beg_auth_seq_id 1 _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id E _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id C _pdbx_refine_tls_group.end_auth_seq_id 3 _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal ATP PG P N N 1 ATP O1G O N N 2 ATP O2G O N N 3 ATP O3G O N N 4 ATP PB P N R 5 ATP O1B O N N 6 ATP O2B O N N 7 ATP O3B O N N 8 ATP PA P N R 9 ATP O1A O N N 10 ATP O2A O N N 11 ATP O3A O N N 12 ATP "O5'" O N N 13 ATP "C5'" C N N 14 ATP "C4'" C N R 15 ATP "O4'" O N N 16 ATP "C3'" C N S 17 ATP "O3'" O N N 18 ATP "C2'" C N R 19 ATP "O2'" O N N 20 ATP "C1'" C N R 21 ATP N9 N Y N 22 ATP C8 C Y N 23 ATP N7 N Y N 24 ATP C5 C Y N 25 ATP C6 C Y N 26 ATP N6 N N N 27 ATP N1 N Y N 28 ATP C2 C Y N 29 ATP N3 N Y N 30 ATP C4 C Y N 31 ATP HOG2 H N N 32 ATP HOG3 H N N 33 ATP HOB2 H N N 34 ATP HOA2 H N N 35 ATP "H5'1" H N N 36 ATP "H5'2" H N N 37 ATP "H4'" H N N 38 ATP "H3'" H N N 39 ATP "HO3'" H N N 40 ATP "H2'" H N N 41 ATP "HO2'" H N N 42 ATP "H1'" H N N 43 ATP H8 H N N 44 ATP HN61 H N N 45 ATP HN62 H N N 46 ATP H2 H N N 47 CA CA CA N N 48 DA OP3 O N N 49 DA P P N N 50 DA OP1 O N N 51 DA OP2 O N N 52 DA "O5'" O N N 53 DA "C5'" C N N 54 DA "C4'" C N R 55 DA "O4'" O N N 56 DA "C3'" C N S 57 DA "O3'" O N N 58 DA "C2'" C N N 59 DA "C1'" C N R 60 DA N9 N Y N 61 DA C8 C Y N 62 DA N7 N Y N 63 DA C5 C Y N 64 DA C6 C Y N 65 DA N6 N N N 66 DA N1 N Y N 67 DA C2 C Y N 68 DA N3 N Y N 69 DA C4 C Y N 70 DA HOP3 H N N 71 DA HOP2 H N N 72 DA "H5'" H N N 73 DA "H5''" H N N 74 DA "H4'" H N N 75 DA "H3'" H N N 76 DA "HO3'" H N N 77 DA "H2'" H N N 78 DA "H2''" H N N 79 DA "H1'" H N N 80 DA H8 H N N 81 DA H61 H N N 82 DA H62 H N N 83 DA H2 H N N 84 DC OP3 O N N 85 DC P P N N 86 DC OP1 O N N 87 DC OP2 O N N 88 DC "O5'" O N N 89 DC "C5'" C N N 90 DC "C4'" C N R 91 DC "O4'" O N N 92 DC "C3'" C N S 93 DC "O3'" O N N 94 DC "C2'" C N N 95 DC "C1'" C N R 96 DC N1 N N N 97 DC C2 C N N 98 DC O2 O N N 99 DC N3 N N N 100 DC C4 C N N 101 DC N4 N N N 102 DC C5 C N N 103 DC C6 C N N 104 DC HOP3 H N N 105 DC HOP2 H N N 106 DC "H5'" H N N 107 DC "H5''" H N N 108 DC "H4'" H N N 109 DC "H3'" H N N 110 DC "HO3'" H N N 111 DC "H2'" H N N 112 DC "H2''" H N N 113 DC "H1'" H N N 114 DC H41 H N N 115 DC H42 H N N 116 DC H5 H N N 117 DC H6 H N N 118 DG OP3 O N N 119 DG P P N N 120 DG OP1 O N N 121 DG OP2 O N N 122 DG "O5'" O N N 123 DG "C5'" C N N 124 DG "C4'" C N R 125 DG "O4'" O N N 126 DG "C3'" C N S 127 DG "O3'" O N N 128 DG "C2'" C N N 129 DG "C1'" C N R 130 DG N9 N Y N 131 DG C8 C Y N 132 DG N7 N Y N 133 DG C5 C Y N 134 DG C6 C N N 135 DG O6 O N N 136 DG N1 N N N 137 DG C2 C N N 138 DG N2 N N N 139 DG N3 N N N 140 DG C4 C Y N 141 DG HOP3 H N N 142 DG HOP2 H N N 143 DG "H5'" H N N 144 DG "H5''" H N N 145 DG "H4'" H N N 146 DG "H3'" H N N 147 DG "HO3'" H N N 148 DG "H2'" H N N 149 DG "H2''" H N N 150 DG "H1'" H N N 151 DG H8 H N N 152 DG H1 H N N 153 DG H21 H N N 154 DG H22 H N N 155 DT OP3 O N N 156 DT P P N N 157 DT OP1 O N N 158 DT OP2 O N N 159 DT "O5'" O N N 160 DT "C5'" C N N 161 DT "C4'" C N R 162 DT "O4'" O N N 163 DT "C3'" C N S 164 DT "O3'" O N N 165 DT "C2'" C N N 166 DT "C1'" C N R 167 DT N1 N N N 168 DT C2 C N N 169 DT O2 O N N 170 DT N3 N N N 171 DT C4 C N N 172 DT O4 O N N 173 DT C5 C N N 174 DT C7 C N N 175 DT C6 C N N 176 DT HOP3 H N N 177 DT HOP2 H N N 178 DT "H5'" H N N 179 DT "H5''" H N N 180 DT "H4'" H N N 181 DT "H3'" H N N 182 DT "HO3'" H N N 183 DT "H2'" H N N 184 DT "H2''" H N N 185 DT "H1'" H N N 186 DT H3 H N N 187 DT H71 H N N 188 DT H72 H N N 189 DT H73 H N N 190 DT H6 H N N 191 HOH O O N N 192 HOH H1 H N N 193 HOH H2 H N N 194 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal ATP PG O1G doub N N 1 ATP PG O2G sing N N 2 ATP PG O3G sing N N 3 ATP PG O3B sing N N 4 ATP O2G HOG2 sing N N 5 ATP O3G HOG3 sing N N 6 ATP PB O1B doub N N 7 ATP PB O2B sing N N 8 ATP PB O3B sing N N 9 ATP PB O3A sing N N 10 ATP O2B HOB2 sing N N 11 ATP PA O1A doub N N 12 ATP PA O2A sing N N 13 ATP PA O3A sing N N 14 ATP PA "O5'" sing N N 15 ATP O2A HOA2 sing N N 16 ATP "O5'" "C5'" sing N N 17 ATP "C5'" "C4'" sing N N 18 ATP "C5'" "H5'1" sing N N 19 ATP "C5'" "H5'2" sing N N 20 ATP "C4'" "O4'" sing N N 21 ATP "C4'" "C3'" sing N N 22 ATP "C4'" "H4'" sing N N 23 ATP "O4'" "C1'" sing N N 24 ATP "C3'" "O3'" sing N N 25 ATP "C3'" "C2'" sing N N 26 ATP "C3'" "H3'" sing N N 27 ATP "O3'" "HO3'" sing N N 28 ATP "C2'" "O2'" sing N N 29 ATP "C2'" "C1'" sing N N 30 ATP "C2'" "H2'" sing N N 31 ATP "O2'" "HO2'" sing N N 32 ATP "C1'" N9 sing N N 33 ATP "C1'" "H1'" sing N N 34 ATP N9 C8 sing Y N 35 ATP N9 C4 sing Y N 36 ATP C8 N7 doub Y N 37 ATP C8 H8 sing N N 38 ATP N7 C5 sing Y N 39 ATP C5 C6 sing Y N 40 ATP C5 C4 doub Y N 41 ATP C6 N6 sing N N 42 ATP C6 N1 doub Y N 43 ATP N6 HN61 sing N N 44 ATP N6 HN62 sing N N 45 ATP N1 C2 sing Y N 46 ATP C2 N3 doub Y N 47 ATP C2 H2 sing N N 48 ATP N3 C4 sing Y N 49 DA OP3 P sing N N 50 DA OP3 HOP3 sing N N 51 DA P OP1 doub N N 52 DA P OP2 sing N N 53 DA P "O5'" sing N N 54 DA OP2 HOP2 sing N N 55 DA "O5'" "C5'" sing N N 56 DA "C5'" "C4'" sing N N 57 DA "C5'" "H5'" sing N N 58 DA "C5'" "H5''" sing N N 59 DA "C4'" "O4'" sing N N 60 DA "C4'" "C3'" sing N N 61 DA "C4'" "H4'" sing N N 62 DA "O4'" "C1'" sing N N 63 DA "C3'" "O3'" sing N N 64 DA "C3'" "C2'" sing N N 65 DA "C3'" "H3'" sing N N 66 DA "O3'" "HO3'" sing N N 67 DA "C2'" "C1'" sing N N 68 DA "C2'" "H2'" sing N N 69 DA "C2'" "H2''" sing N N 70 DA "C1'" N9 sing N N 71 DA "C1'" "H1'" sing N N 72 DA N9 C8 sing Y N 73 DA N9 C4 sing Y N 74 DA C8 N7 doub Y N 75 DA C8 H8 sing N N 76 DA N7 C5 sing Y N 77 DA C5 C6 sing Y N 78 DA C5 C4 doub Y N 79 DA C6 N6 sing N N 80 DA C6 N1 doub Y N 81 DA N6 H61 sing N N 82 DA N6 H62 sing N N 83 DA N1 C2 sing Y N 84 DA C2 N3 doub Y N 85 DA C2 H2 sing N N 86 DA N3 C4 sing Y N 87 DC OP3 P sing N N 88 DC OP3 HOP3 sing N N 89 DC P OP1 doub N N 90 DC P OP2 sing N N 91 DC P "O5'" sing N N 92 DC OP2 HOP2 sing N N 93 DC "O5'" "C5'" sing N N 94 DC "C5'" "C4'" sing N N 95 DC "C5'" "H5'" sing N N 96 DC "C5'" "H5''" sing N N 97 DC "C4'" "O4'" sing N N 98 DC "C4'" "C3'" sing N N 99 DC "C4'" "H4'" sing N N 100 DC "O4'" "C1'" sing N N 101 DC "C3'" "O3'" sing N N 102 DC "C3'" "C2'" sing N N 103 DC "C3'" "H3'" sing N N 104 DC "O3'" "HO3'" sing N N 105 DC "C2'" "C1'" sing N N 106 DC "C2'" "H2'" sing N N 107 DC "C2'" "H2''" sing N N 108 DC "C1'" N1 sing N N 109 DC "C1'" "H1'" sing N N 110 DC N1 C2 sing N N 111 DC N1 C6 sing N N 112 DC C2 O2 doub N N 113 DC C2 N3 sing N N 114 DC N3 C4 doub N N 115 DC C4 N4 sing N N 116 DC C4 C5 sing N N 117 DC N4 H41 sing N N 118 DC N4 H42 sing N N 119 DC C5 C6 doub N N 120 DC C5 H5 sing N N 121 DC C6 H6 sing N N 122 DG OP3 P sing N N 123 DG OP3 HOP3 sing N N 124 DG P OP1 doub N N 125 DG P OP2 sing N N 126 DG P "O5'" sing N N 127 DG OP2 HOP2 sing N N 128 DG "O5'" "C5'" sing N N 129 DG "C5'" "C4'" sing N N 130 DG "C5'" "H5'" sing N N 131 DG "C5'" "H5''" sing N N 132 DG "C4'" "O4'" sing N N 133 DG "C4'" "C3'" sing N N 134 DG "C4'" "H4'" sing N N 135 DG "O4'" "C1'" sing N N 136 DG "C3'" "O3'" sing N N 137 DG "C3'" "C2'" sing N N 138 DG "C3'" "H3'" sing N N 139 DG "O3'" "HO3'" sing N N 140 DG "C2'" "C1'" sing N N 141 DG "C2'" "H2'" sing N N 142 DG "C2'" "H2''" sing N N 143 DG "C1'" N9 sing N N 144 DG "C1'" "H1'" sing N N 145 DG N9 C8 sing Y N 146 DG N9 C4 sing Y N 147 DG C8 N7 doub Y N 148 DG C8 H8 sing N N 149 DG N7 C5 sing Y N 150 DG C5 C6 sing N N 151 DG C5 C4 doub Y N 152 DG C6 O6 doub N N 153 DG C6 N1 sing N N 154 DG N1 C2 sing N N 155 DG N1 H1 sing N N 156 DG C2 N2 sing N N 157 DG C2 N3 doub N N 158 DG N2 H21 sing N N 159 DG N2 H22 sing N N 160 DG N3 C4 sing N N 161 DT OP3 P sing N N 162 DT OP3 HOP3 sing N N 163 DT P OP1 doub N N 164 DT P OP2 sing N N 165 DT P "O5'" sing N N 166 DT OP2 HOP2 sing N N 167 DT "O5'" "C5'" sing N N 168 DT "C5'" "C4'" sing N N 169 DT "C5'" "H5'" sing N N 170 DT "C5'" "H5''" sing N N 171 DT "C4'" "O4'" sing N N 172 DT "C4'" "C3'" sing N N 173 DT "C4'" "H4'" sing N N 174 DT "O4'" "C1'" sing N N 175 DT "C3'" "O3'" sing N N 176 DT "C3'" "C2'" sing N N 177 DT "C3'" "H3'" sing N N 178 DT "O3'" "HO3'" sing N N 179 DT "C2'" "C1'" sing N N 180 DT "C2'" "H2'" sing N N 181 DT "C2'" "H2''" sing N N 182 DT "C1'" N1 sing N N 183 DT "C1'" "H1'" sing N N 184 DT N1 C2 sing N N 185 DT N1 C6 sing N N 186 DT C2 O2 doub N N 187 DT C2 N3 sing N N 188 DT N3 C4 sing N N 189 DT N3 H3 sing N N 190 DT C4 O4 doub N N 191 DT C4 C5 sing N N 192 DT C5 C7 sing N N 193 DT C5 C6 doub N N 194 DT C7 H71 sing N N 195 DT C7 H72 sing N N 196 DT C7 H73 sing N N 197 DT C6 H6 sing N N 198 HOH O H1 sing N N 199 HOH O H2 sing N N 200 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9URX 'double helix' 9URX 'b-form double helix' 9URX 'hairpin loop' 9URX 'bulge loop' 9URX 'mismatched base pair' 9URX 'internal loop' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A DG 2 1_555 A DC 43 1_555 -0.561 -0.077 -0.065 -17.761 -10.070 1.843 1 A_DG-1:DC40_A A -1 ? A 40 ? 19 1 1 A DT 3 1_555 A DA 42 1_555 -0.102 -0.163 -0.051 -3.160 -2.200 0.827 2 A_DT0:DA39_A A 0 ? A 39 ? 20 1 1 A DA 4 1_555 A DT 41 1_555 -0.011 -0.070 0.187 -1.816 -7.629 4.266 3 A_DA1:DT38_A A 1 ? A 38 ? 20 1 1 A DC 5 1_555 A DG 40 1_555 0.250 -0.152 -0.134 12.014 -1.930 -2.260 4 A_DC2:DG37_A A 2 ? A 37 ? 19 1 1 A DG 6 1_555 A DC 39 1_555 -0.288 -0.232 0.076 1.178 -10.881 0.994 5 A_DG3:DC36_A A 3 ? A 36 ? 19 1 1 A DA 7 1_555 A DT 38 1_555 0.054 -0.133 0.194 9.773 -6.432 0.603 6 A_DA4:DT35_A A 4 ? A 35 ? 20 1 1 A DC 8 1_555 A DG 37 1_555 0.221 -0.138 0.148 7.901 -9.813 2.790 7 A_DC5:DG34_A A 5 ? A 34 ? 19 1 1 A DA 9 1_555 A DT 36 1_555 0.398 0.094 0.025 21.697 -20.726 -6.058 8 A_DA6:DT33_A A 6 ? A 33 ? 20 1 1 A DG 11 1_555 A DG 32 1_555 5.571 -0.552 -0.277 23.666 -16.593 -107.692 9 A_DG8:DG29_A A 8 ? A 29 ? 7 4 1 A DA 13 1_555 A DT 33 1_555 0.075 -0.011 -0.118 20.398 30.984 3.238 10 A_DA10:DT30_A A 10 ? A 30 ? 20 1 1 A DG 14 1_555 A DT 30 1_555 -2.090 -0.449 -0.184 9.322 0.339 -6.057 11 A_DG11:DT27_A A 11 ? A 27 ? 28 1 1 A DG 15 1_555 A DA 29 1_555 -0.045 1.560 -0.181 12.897 -13.980 -19.127 12 A_DG12:DA26_A A 12 ? A 26 ? 8 1 1 A DT 17 1_555 A DA 28 1_555 -0.194 -0.131 0.283 -13.530 -19.713 3.658 13 A_DT14:DA25_A A 14 ? A 25 ? 20 1 1 A DT 18 1_555 A DA 27 1_555 -0.188 -0.052 0.015 -10.314 -15.430 3.724 14 A_DT15:DA24_A A 15 ? A 24 ? 20 1 1 A DA 19 1_555 A DT 26 1_555 0.050 -0.129 -0.219 -5.603 -3.545 3.591 15 A_DA16:DT23_A A 16 ? A 23 ? 20 1 1 A DG 20 1_555 A DC 25 1_555 -0.238 -0.085 0.121 5.539 -2.091 3.608 16 A_DG17:DC22_A A 17 ? A 22 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A DG 2 1_555 A DC 43 1_555 A DT 3 1_555 A DA 42 1_555 -0.370 -0.699 2.950 2.752 6.595 32.316 -2.205 1.058 2.719 11.671 -4.871 33.076 1 AA_DG-1DT0:DA39DC40_AA A -1 ? A 40 ? A 0 ? A 39 ? 1 A DT 3 1_555 A DA 42 1_555 A DA 4 1_555 A DT 41 1_555 0.717 -0.754 3.168 -0.501 7.683 32.004 -2.568 -1.347 2.903 13.689 0.892 32.893 2 AA_DT0DA1:DT38DA39_AA A 0 ? A 39 ? A 1 ? A 38 ? 1 A DA 4 1_555 A DT 41 1_555 A DC 5 1_555 A DG 40 1_555 0.116 -0.289 3.064 4.133 4.361 29.540 -1.386 0.564 2.980 8.443 -8.002 30.131 3 AA_DA1DC2:DG37DT38_AA A 1 ? A 38 ? A 2 ? A 37 ? 1 A DC 5 1_555 A DG 40 1_555 A DG 6 1_555 A DC 39 1_555 -0.018 0.880 3.568 -0.467 3.882 41.106 0.788 -0.030 3.632 5.514 0.663 41.284 4 AA_DC2DG3:DC36DG37_AA A 2 ? A 37 ? A 3 ? A 36 ? 1 A DG 6 1_555 A DC 39 1_555 A DA 7 1_555 A DT 38 1_555 0.160 0.076 3.090 -0.645 3.302 29.961 -0.490 -0.432 3.077 6.362 1.244 30.145 5 AA_DG3DA4:DT35DC36_AA A 3 ? A 36 ? A 4 ? A 35 ? 1 A DA 7 1_555 A DT 38 1_555 A DC 8 1_555 A DG 37 1_555 1.333 -1.011 3.314 0.144 -1.654 29.369 -1.630 -2.593 3.371 -3.259 -0.283 29.415 6 AA_DA4DC5:DG34DT35_AA A 4 ? A 35 ? A 5 ? A 34 ? 1 A DC 8 1_555 A DG 37 1_555 A DA 9 1_555 A DT 36 1_555 -0.341 1.198 3.163 7.329 0.488 39.116 1.707 1.318 3.067 0.721 -10.829 39.773 7 AA_DC5DA6:DT33DG34_AA A 5 ? A 34 ? A 6 ? A 33 ? 1 A DA 9 1_555 A DT 36 1_555 A DG 11 1_555 A DG 32 1_555 1.326 5.058 3.112 14.585 -19.896 77.377 4.340 -0.709 2.158 -15.550 -11.399 80.624 8 AA_DA6DG8:DG29DT33_AA A 6 ? A 33 ? A 8 ? A 29 ? 1 A DA 13 1_555 A DT 33 1_555 A DG 14 1_555 A DT 30 1_555 3.842 1.807 3.073 24.727 13.424 53.218 0.968 -2.299 4.615 13.944 -25.685 59.714 9 AA_DA10DG11:DT27DT30_AA A 10 ? A 30 ? A 11 ? A 27 ? 1 A DG 14 1_555 A DT 30 1_555 A DG 15 1_555 A DA 29 1_555 -1.840 0.703 3.258 -2.446 2.759 41.083 0.695 2.344 3.396 3.922 3.478 41.241 10 AA_DG11DG12:DA26DT27_AA A 11 ? A 27 ? A 12 ? A 26 ? 1 A DG 15 1_555 A DA 29 1_555 A DT 17 1_555 A DA 28 1_555 -0.504 -0.097 3.638 -6.001 -7.240 54.224 0.378 0.145 3.655 -7.876 6.529 54.973 11 AA_DG12DT14:DA25DA26_AA A 12 ? A 26 ? A 14 ? A 25 ? 1 A DT 17 1_555 A DA 28 1_555 A DT 18 1_555 A DA 27 1_555 -0.386 -0.027 3.162 -0.179 -3.795 35.031 0.501 0.613 3.150 -6.282 0.295 35.230 12 AA_DT14DT15:DA24DA25_AA A 14 ? A 25 ? A 15 ? A 24 ? 1 A DT 18 1_555 A DA 27 1_555 A DA 19 1_555 A DT 26 1_555 0.543 1.410 3.210 0.635 -1.129 42.742 2.044 -0.682 3.181 -1.548 -0.871 42.761 13 AA_DT15DA16:DT23DA24_AA A 15 ? A 24 ? A 16 ? A 23 ? 1 A DA 19 1_555 A DT 26 1_555 A DG 20 1_555 A DC 25 1_555 0.313 -0.438 3.083 -4.839 4.864 28.839 -1.806 -1.557 2.882 9.595 9.546 29.627 14 AA_DA16DG17:DC22DT23_AA A 16 ? A 23 ? A 17 ? A 22 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number 32171191 _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name Other _pdbx_initial_refinement_model.accession_code ? _pdbx_initial_refinement_model.details BA-SAD # _space_group.name_H-M_alt 'P 62 2 2' _space_group.name_Hall 'P 62 2 (x,y,z+1/3)' _space_group.IT_number 180 _space_group.crystal_system hexagonal _space_group.id 1 # _atom_sites.entry_id 9URX _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.017289 _atom_sites.fract_transf_matrix[1][2] 0.009982 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019964 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.008174 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol _atom_type.scat_dispersion_real _atom_type.scat_dispersion_imag _atom_type.scat_Cromer_Mann_a1 _atom_type.scat_Cromer_Mann_a2 _atom_type.scat_Cromer_Mann_a3 _atom_type.scat_Cromer_Mann_a4 _atom_type.scat_Cromer_Mann_b1 _atom_type.scat_Cromer_Mann_b2 _atom_type.scat_Cromer_Mann_b3 _atom_type.scat_Cromer_Mann_b4 _atom_type.scat_Cromer_Mann_c _atom_type.scat_source _atom_type.scat_dispersion_source C ? ? 3.54356 2.42580 ? ? 25.62398 1.50364 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? CA ? ? 16.26893 3.65395 ? ? 3.58509 77.28589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? H ? ? 0.51345 0.48472 ? ? 24.73122 6.32584 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? N ? ? 4.01032 2.96436 ? ? 19.97189 1.75589 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O ? ? 4.49882 3.47563 ? ? 15.80542 1.70748 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? O1- ? ? 5.12366 3.84317 ? ? 3.49406 27.47979 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? P ? ? 9.51135 5.44231 ? ? 1.42069 35.72801 ? ? 0.0 ;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31. ; ? # loop_ # loop_ #