data_9V4V # _entry.id 9V4V # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.407 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9V4V pdb_00009v4v 10.2210/pdb9v4v/pdb WWPDB D_1300059805 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-11-26 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9V4V _pdbx_database_status.recvd_initial_deposition_date 2025-05-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, H.C.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Ligand specificity and adaptability revealed by the first Guanine-II riboswitch tertiary structure.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf884 _citation.pdbx_database_id_PubMed 40966503 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, H.' 1 ? primary 'Shen, X.' 2 ? primary 'Xu, X.' 3 ? primary 'Tai, X.' 4 ? primary 'He, M.' 5 ? primary 'Zhang, J.' 6 ? primary 'Ren, A.' 7 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (71-MER)' 22962.490 1 ? ? ? ? 2 non-polymer syn '2-aminopteridine-4,7(3H,8H)-dione' 179.136 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 4 water nat water 18.015 18 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC' _entity_poly.pdbx_seq_one_letter_code_can GGGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 '2-aminopteridine-4,7(3H,8H)-dione' 7PD 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 U n 1 5 U n 1 6 G n 1 7 U n 1 8 A n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 U n 1 19 A n 1 20 A n 1 21 U n 1 22 U n 1 23 U n 1 24 G n 1 25 G n 1 26 A n 1 27 A n 1 28 U n 1 29 G n 1 30 A n 1 31 G n 1 32 C n 1 33 G n 1 34 U n 1 35 A n 1 36 U n 1 37 C n 1 38 U n 1 39 A n 1 40 C n 1 41 A n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 A n 1 47 C n 1 48 C n 1 49 G n 1 50 U n 1 51 A n 1 52 A n 1 53 A n 1 54 U n 1 55 U n 1 56 G n 1 57 C n 1 58 C n 1 59 C n 1 60 C n 1 61 A n 1 62 G n 1 63 G n 1 64 C n 1 65 U n 1 66 A n 1 67 C n 1 68 A n 1 69 A n 1 70 U n 1 71 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 71 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Staphylococcus aureus' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1280 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight 7PD non-polymer . '2-aminopteridine-4,7(3H,8H)-dione' isoxanthopterin 'C6 H5 N5 O2' 179.136 A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 A 35 35 35 A A A . n A 1 36 U 36 36 36 U U A . n A 1 37 C 37 37 37 C C A . n A 1 38 U 38 38 38 U U A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 A 46 46 46 A A A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 G 49 49 49 G G A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 U 54 54 54 U U A . n A 1 55 U 55 55 55 U U A . n A 1 56 G 56 56 56 G G A . n A 1 57 C 57 57 57 C C A . n A 1 58 C 58 58 58 C C A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 U 65 65 65 U U A . n A 1 66 A 66 66 66 A A A . n A 1 67 C 67 67 67 C C A . n A 1 68 A 68 68 68 A A A . n A 1 69 A 69 69 69 A A A . n A 1 70 U 70 70 70 U U A . n A 1 71 C 71 71 71 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id 7PD _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id 7PD _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 7PD 1 101 101 7PD 7PD A . C 3 MG 1 102 1 MG MG A . D 4 HOH 1 201 22 HOH HOH A . D 4 HOH 2 202 12 HOH HOH A . D 4 HOH 3 203 10 HOH HOH A . D 4 HOH 4 204 21 HOH HOH A . D 4 HOH 5 205 15 HOH HOH A . D 4 HOH 6 206 19 HOH HOH A . D 4 HOH 7 207 2 HOH HOH A . D 4 HOH 8 208 3 HOH HOH A . D 4 HOH 9 209 18 HOH HOH A . D 4 HOH 10 210 1 HOH HOH A . D 4 HOH 11 211 5 HOH HOH A . D 4 HOH 12 212 20 HOH HOH A . D 4 HOH 13 213 9 HOH HOH A . D 4 HOH 14 214 8 HOH HOH A . D 4 HOH 15 215 16 HOH HOH A . D 4 HOH 16 216 4 HOH HOH A . D 4 HOH 17 217 17 HOH HOH A . D 4 HOH 18 218 6 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.20.1_4487 ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9V4V _cell.details ? _cell.formula_units_Z ? _cell.length_a 37.967 _cell.length_a_esd ? _cell.length_b 48.962 _cell.length_b_esd ? _cell.length_c 120.526 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 4 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9V4V _symmetry.cell_setting ? _symmetry.Int_Tables_number 16 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 2 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9V4V _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.54 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 51.5 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.08 M sodium chloride, 0.04 M sodium cacodylate trihydrate (pH 7.0), 30% v/v (+/-)-2-methyl-2,4-pentanediol, and 0.012 M spermine tetrahydrochloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-04-23 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.10213 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.10213 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9V4V _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.12 _reflns.d_resolution_low 60.26 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4140 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 94.3 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.9 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 7.2 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.977 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.12 _reflns_shell.d_res_low 3.29 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 610 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.981 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9V4V _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.12 _refine.ls_d_res_low 60.26 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4043 _refine.ls_number_reflns_R_free 404 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 92.22 _refine.ls_percent_reflns_R_free 9.99 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2473 _refine.ls_R_factor_R_free 0.2963 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2422 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 31.87 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.34 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.12 _refine_hist.d_res_low 60.26 _refine_hist.number_atoms_solvent 18 _refine_hist.number_atoms_total 1552 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1520 _refine_hist.pdbx_number_atoms_ligand 14 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.002 ? 1711 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.727 ? 2662 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 20.391 ? 851 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.037 ? 354 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.004 ? 72 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.12 3.57 . . 124 1127 89.00 . . . . 0.3215 . . . . . . . . . . . . . . . 0.3937 'X-RAY DIFFRACTION' 3.57 4.50 . . 127 1138 88.00 . . . . 0.2636 . . . . . . . . . . . . . . . 0.3225 'X-RAY DIFFRACTION' 4.50 60.26 . . 153 1374 99.00 . . . . 0.2089 . . . . . . . . . . . . . . . 0.2527 # _struct.entry_id 9V4V _struct.title 'Crystal structure of Guanine-II riboswitch in complex with isoxanthopterin' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9V4V _struct_keywords.text 'guanine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9V4V _struct_ref.pdbx_db_accession 9V4V _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9V4V _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 71 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9V4V _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 71 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 71 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.557 ? ? metalc1 metalc ? ? A C 71 "O2'" ? ? ? 1_555 C MG . MG ? ? A C 71 A MG 102 1_555 ? ? ? ? ? ? ? 2.056 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 70 O2 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 70 N3 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 66 N1 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 66 N6 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 65 O4 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 10 N1 ? ? ? 1_555 A G 33 N2 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog20 hydrog ? ? A A 10 N6 ? ? ? 1_555 A G 33 N3 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog21 hydrog ? ? A A 11 N6 ? ? ? 1_555 A A 61 N1 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog22 hydrog ? ? A A 11 N7 ? ? ? 1_555 A A 61 N6 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A G 16 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A A 20 N1 ? ? ? 1_555 A A 53 N6 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog41 hydrog ? ? A A 20 N6 ? ? ? 1_555 A A 53 N7 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 24 N2 ? ? A U 21 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog43 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 52 N1 ? ? A U 21 A A 52 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog44 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 25 N2 ? ? ? 1_555 A A 53 N1 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog51 hydrog ? ? A G 25 N3 ? ? ? 1_555 A A 53 N6 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog52 hydrog ? ? A G 33 O6 ? ? ? 1_555 A A 39 N6 ? ? A G 33 A A 39 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog53 hydrog ? ? A U 34 N3 ? ? ? 1_555 A U 38 O4 ? ? A U 34 A U 38 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog54 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 66 N3 ? ? A U 36 A A 66 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog55 hydrog ? ? A C 37 N4 ? ? ? 1_555 A U 65 O2 ? ? A C 37 A U 65 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog56 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A A 41 N1 ? ? ? 1_555 A C 59 N4 ? ? A A 41 A C 59 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog60 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 58 N3 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 58 O2 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 58 N4 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 57 N3 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 57 O2 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 57 N4 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 45 N1 ? ? ? 1_555 A U 55 N3 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 45 N6 ? ? ? 1_555 A U 55 O4 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 46 N1 ? ? ? 1_555 A U 54 N3 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 46 N6 ? ? ? 1_555 A U 54 O4 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 48 O2 ? ? ? 1_555 A A 52 N6 ? ? A C 48 A A 52 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9V4V _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 OP2 _pdbx_validate_close_contact.auth_asym_id_1 A _pdbx_validate_close_contact.auth_comp_id_1 U _pdbx_validate_close_contact.auth_seq_id_1 28 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 O _pdbx_validate_close_contact.auth_asym_id_2 A _pdbx_validate_close_contact.auth_comp_id_2 HOH _pdbx_validate_close_contact.auth_seq_id_2 201 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.18 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "C3'" A GTP 1 ? ? "O3'" A GTP 1 ? ? P A G 2 ? ? 103.31 119.70 -16.39 1.20 Y 2 1 C2 A U 65 ? ? N1 A U 65 ? ? "C1'" A U 65 ? ? 125.20 117.70 7.50 1.20 N # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 A HOH 203 ? D HOH . 2 1 A HOH 210 ? D HOH . # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 10.9744 _pdbx_refine_tls.origin_y 11.0585 _pdbx_refine_tls.origin_z 29.0069 _pdbx_refine_tls.T[1][1] 0.4893 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0575 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.1832 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.4172 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0592 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.5285 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 4.5731 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.5601 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.4025 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 2.7881 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.1418 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 1.7497 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.2095 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.4451 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.2579 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.6445 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.3911 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.2697 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.5374 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.2043 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.1245 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal 7PD C1 C N N 1 7PD C2 C N N 2 7PD C3 C N N 3 7PD C4 C N N 4 7PD C5 C N N 5 7PD C6 C N N 6 7PD N7 N N N 7 7PD N8 N N N 8 7PD N9 N N N 9 7PD N10 N N N 10 7PD N11 N N N 11 7PD O12 O N N 12 7PD O13 O N N 13 7PD H1 H N N 14 7PD H2 H N N 15 7PD H3 H N N 16 7PD H4 H N N 17 7PD H5 H N N 18 A OP3 O N N 19 A P P N N 20 A OP1 O N N 21 A OP2 O N N 22 A "O5'" O N N 23 A "C5'" C N N 24 A "C4'" C N R 25 A "O4'" O N N 26 A "C3'" C N S 27 A "O3'" O N N 28 A "C2'" C N R 29 A "O2'" O N N 30 A "C1'" C N R 31 A N9 N Y N 32 A C8 C Y N 33 A N7 N Y N 34 A C5 C Y N 35 A C6 C Y N 36 A N6 N N N 37 A N1 N Y N 38 A C2 C Y N 39 A N3 N Y N 40 A C4 C Y N 41 A HOP3 H N N 42 A HOP2 H N N 43 A "H5'" H N N 44 A "H5''" H N N 45 A "H4'" H N N 46 A "H3'" H N N 47 A "HO3'" H N N 48 A "H2'" H N N 49 A "HO2'" H N N 50 A "H1'" H N N 51 A H8 H N N 52 A H61 H N N 53 A H62 H N N 54 A H2 H N N 55 C OP3 O N N 56 C P P N N 57 C OP1 O N N 58 C OP2 O N N 59 C "O5'" O N N 60 C "C5'" C N N 61 C "C4'" C N R 62 C "O4'" O N N 63 C "C3'" C N S 64 C "O3'" O N N 65 C "C2'" C N R 66 C "O2'" O N N 67 C "C1'" C N R 68 C N1 N N N 69 C C2 C N N 70 C O2 O N N 71 C N3 N N N 72 C C4 C N N 73 C N4 N N N 74 C C5 C N N 75 C C6 C N N 76 C HOP3 H N N 77 C HOP2 H N N 78 C "H5'" H N N 79 C "H5''" H N N 80 C "H4'" H N N 81 C "H3'" H N N 82 C "HO3'" H N N 83 C "H2'" H N N 84 C "HO2'" H N N 85 C "H1'" H N N 86 C H41 H N N 87 C H42 H N N 88 C H5 H N N 89 C H6 H N N 90 G OP3 O N N 91 G P P N N 92 G OP1 O N N 93 G OP2 O N N 94 G "O5'" O N N 95 G "C5'" C N N 96 G "C4'" C N R 97 G "O4'" O N N 98 G "C3'" C N S 99 G "O3'" O N N 100 G "C2'" C N R 101 G "O2'" O N N 102 G "C1'" C N R 103 G N9 N Y N 104 G C8 C Y N 105 G N7 N Y N 106 G C5 C Y N 107 G C6 C N N 108 G O6 O N N 109 G N1 N N N 110 G C2 C N N 111 G N2 N N N 112 G N3 N N N 113 G C4 C Y N 114 G HOP3 H N N 115 G HOP2 H N N 116 G "H5'" H N N 117 G "H5''" H N N 118 G "H4'" H N N 119 G "H3'" H N N 120 G "HO3'" H N N 121 G "H2'" H N N 122 G "HO2'" H N N 123 G "H1'" H N N 124 G H8 H N N 125 G H1 H N N 126 G H21 H N N 127 G H22 H N N 128 GTP PG P N N 129 GTP O1G O N N 130 GTP O2G O N N 131 GTP O3G O N N 132 GTP O3B O N N 133 GTP PB P N N 134 GTP O1B O N N 135 GTP O2B O N N 136 GTP O3A O N N 137 GTP PA P N N 138 GTP O1A O N N 139 GTP O2A O N N 140 GTP "O5'" O N N 141 GTP "C5'" C N N 142 GTP "C4'" C N R 143 GTP "O4'" O N N 144 GTP "C3'" C N S 145 GTP "O3'" O N N 146 GTP "C2'" C N R 147 GTP "O2'" O N N 148 GTP "C1'" C N R 149 GTP N9 N Y N 150 GTP C8 C Y N 151 GTP N7 N Y N 152 GTP C5 C Y N 153 GTP C6 C N N 154 GTP O6 O N N 155 GTP N1 N N N 156 GTP C2 C N N 157 GTP N2 N N N 158 GTP N3 N N N 159 GTP C4 C Y N 160 GTP HOG2 H N N 161 GTP HOG3 H N N 162 GTP HOB2 H N N 163 GTP HOA2 H N N 164 GTP "H5'" H N N 165 GTP "H5''" H N N 166 GTP "H4'" H N N 167 GTP "H3'" H N N 168 GTP "HO3'" H N N 169 GTP "H2'" H N N 170 GTP "HO2'" H N N 171 GTP "H1'" H N N 172 GTP H8 H N N 173 GTP HN1 H N N 174 GTP HN21 H N N 175 GTP HN22 H N N 176 HOH O O N N 177 HOH H1 H N N 178 HOH H2 H N N 179 MG MG MG N N 180 U OP3 O N N 181 U P P N N 182 U OP1 O N N 183 U OP2 O N N 184 U "O5'" O N N 185 U "C5'" C N N 186 U "C4'" C N R 187 U "O4'" O N N 188 U "C3'" C N S 189 U "O3'" O N N 190 U "C2'" C N R 191 U "O2'" O N N 192 U "C1'" C N R 193 U N1 N N N 194 U C2 C N N 195 U O2 O N N 196 U N3 N N N 197 U C4 C N N 198 U O4 O N N 199 U C5 C N N 200 U C6 C N N 201 U HOP3 H N N 202 U HOP2 H N N 203 U "H5'" H N N 204 U "H5''" H N N 205 U "H4'" H N N 206 U "H3'" H N N 207 U "HO3'" H N N 208 U "H2'" H N N 209 U "HO2'" H N N 210 U "H1'" H N N 211 U H3 H N N 212 U H5 H N N 213 U H6 H N N 214 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal 7PD N11 C6 sing N N 1 7PD N8 C6 doub N N 2 7PD N8 C3 sing N N 3 7PD N9 C4 sing N N 4 7PD N9 C3 sing N N 5 7PD O12 C4 doub N N 6 7PD C6 N10 sing N N 7 7PD C4 C1 sing N N 8 7PD C3 C2 doub N N 9 7PD N10 C5 sing N N 10 7PD C2 C5 sing N N 11 7PD C2 N7 sing N N 12 7PD C1 N7 doub N N 13 7PD C5 O13 doub N N 14 7PD C1 H1 sing N N 15 7PD N9 H2 sing N N 16 7PD N10 H3 sing N N 17 7PD N11 H4 sing N N 18 7PD N11 H5 sing N N 19 A OP3 P sing N N 20 A OP3 HOP3 sing N N 21 A P OP1 doub N N 22 A P OP2 sing N N 23 A P "O5'" sing N N 24 A OP2 HOP2 sing N N 25 A "O5'" "C5'" sing N N 26 A "C5'" "C4'" sing N N 27 A "C5'" "H5'" sing N N 28 A "C5'" "H5''" sing N N 29 A "C4'" "O4'" sing N N 30 A "C4'" "C3'" sing N N 31 A "C4'" "H4'" sing N N 32 A "O4'" "C1'" sing N N 33 A "C3'" "O3'" sing N N 34 A "C3'" "C2'" sing N N 35 A "C3'" "H3'" sing N N 36 A "O3'" "HO3'" sing N N 37 A "C2'" "O2'" sing N N 38 A "C2'" "C1'" sing N N 39 A "C2'" "H2'" sing N N 40 A "O2'" "HO2'" sing N N 41 A "C1'" N9 sing N N 42 A "C1'" "H1'" sing N N 43 A N9 C8 sing Y N 44 A N9 C4 sing Y N 45 A C8 N7 doub Y N 46 A C8 H8 sing N N 47 A N7 C5 sing Y N 48 A C5 C6 sing Y N 49 A C5 C4 doub Y N 50 A C6 N6 sing N N 51 A C6 N1 doub Y N 52 A N6 H61 sing N N 53 A N6 H62 sing N N 54 A N1 C2 sing Y N 55 A C2 N3 doub Y N 56 A C2 H2 sing N N 57 A N3 C4 sing Y N 58 C OP3 P sing N N 59 C OP3 HOP3 sing N N 60 C P OP1 doub N N 61 C P OP2 sing N N 62 C P "O5'" sing N N 63 C OP2 HOP2 sing N N 64 C "O5'" "C5'" sing N N 65 C "C5'" "C4'" sing N N 66 C "C5'" "H5'" sing N N 67 C "C5'" "H5''" sing N N 68 C "C4'" "O4'" sing N N 69 C "C4'" "C3'" sing N N 70 C "C4'" "H4'" sing N N 71 C "O4'" "C1'" sing N N 72 C "C3'" "O3'" sing N N 73 C "C3'" "C2'" sing N N 74 C "C3'" "H3'" sing N N 75 C "O3'" "HO3'" sing N N 76 C "C2'" "O2'" sing N N 77 C "C2'" "C1'" sing N N 78 C "C2'" "H2'" sing N N 79 C "O2'" "HO2'" sing N N 80 C "C1'" N1 sing N N 81 C "C1'" "H1'" sing N N 82 C N1 C2 sing N N 83 C N1 C6 sing N N 84 C C2 O2 doub N N 85 C C2 N3 sing N N 86 C N3 C4 doub N N 87 C C4 N4 sing N N 88 C C4 C5 sing N N 89 C N4 H41 sing N N 90 C N4 H42 sing N N 91 C C5 C6 doub N N 92 C C5 H5 sing N N 93 C C6 H6 sing N N 94 G OP3 P sing N N 95 G OP3 HOP3 sing N N 96 G P OP1 doub N N 97 G P OP2 sing N N 98 G P "O5'" sing N N 99 G OP2 HOP2 sing N N 100 G "O5'" "C5'" sing N N 101 G "C5'" "C4'" sing N N 102 G "C5'" "H5'" sing N N 103 G "C5'" "H5''" sing N N 104 G "C4'" "O4'" sing N N 105 G "C4'" "C3'" sing N N 106 G "C4'" "H4'" sing N N 107 G "O4'" "C1'" sing N N 108 G "C3'" "O3'" sing N N 109 G "C3'" "C2'" sing N N 110 G "C3'" "H3'" sing N N 111 G "O3'" "HO3'" sing N N 112 G "C2'" "O2'" sing N N 113 G "C2'" "C1'" sing N N 114 G "C2'" "H2'" sing N N 115 G "O2'" "HO2'" sing N N 116 G "C1'" N9 sing N N 117 G "C1'" "H1'" sing N N 118 G N9 C8 sing Y N 119 G N9 C4 sing Y N 120 G C8 N7 doub Y N 121 G C8 H8 sing N N 122 G N7 C5 sing Y N 123 G C5 C6 sing N N 124 G C5 C4 doub Y N 125 G C6 O6 doub N N 126 G C6 N1 sing N N 127 G N1 C2 sing N N 128 G N1 H1 sing N N 129 G C2 N2 sing N N 130 G C2 N3 doub N N 131 G N2 H21 sing N N 132 G N2 H22 sing N N 133 G N3 C4 sing N N 134 GTP PG O1G doub N N 135 GTP PG O2G sing N N 136 GTP PG O3G sing N N 137 GTP PG O3B sing N N 138 GTP O2G HOG2 sing N N 139 GTP O3G HOG3 sing N N 140 GTP O3B PB sing N N 141 GTP PB O1B doub N N 142 GTP PB O2B sing N N 143 GTP PB O3A sing N N 144 GTP O2B HOB2 sing N N 145 GTP O3A PA sing N N 146 GTP PA O1A doub N N 147 GTP PA O2A sing N N 148 GTP PA "O5'" sing N N 149 GTP O2A HOA2 sing N N 150 GTP "O5'" "C5'" sing N N 151 GTP "C5'" "C4'" sing N N 152 GTP "C5'" "H5'" sing N N 153 GTP "C5'" "H5''" sing N N 154 GTP "C4'" "O4'" sing N N 155 GTP "C4'" "C3'" sing N N 156 GTP "C4'" "H4'" sing N N 157 GTP "O4'" "C1'" sing N N 158 GTP "C3'" "O3'" sing N N 159 GTP "C3'" "C2'" sing N N 160 GTP "C3'" "H3'" sing N N 161 GTP "O3'" "HO3'" sing N N 162 GTP "C2'" "O2'" sing N N 163 GTP "C2'" "C1'" sing N N 164 GTP "C2'" "H2'" sing N N 165 GTP "O2'" "HO2'" sing N N 166 GTP "C1'" N9 sing N N 167 GTP "C1'" "H1'" sing N N 168 GTP N9 C8 sing Y N 169 GTP N9 C4 sing Y N 170 GTP C8 N7 doub Y N 171 GTP C8 H8 sing N N 172 GTP N7 C5 sing Y N 173 GTP C5 C6 sing N N 174 GTP C5 C4 doub Y N 175 GTP C6 O6 doub N N 176 GTP C6 N1 sing N N 177 GTP N1 C2 sing N N 178 GTP N1 HN1 sing N N 179 GTP C2 N2 sing N N 180 GTP C2 N3 doub N N 181 GTP N2 HN21 sing N N 182 GTP N2 HN22 sing N N 183 GTP N3 C4 sing N N 184 HOH O H1 sing N N 185 HOH O H2 sing N N 186 U OP3 P sing N N 187 U OP3 HOP3 sing N N 188 U P OP1 doub N N 189 U P OP2 sing N N 190 U P "O5'" sing N N 191 U OP2 HOP2 sing N N 192 U "O5'" "C5'" sing N N 193 U "C5'" "C4'" sing N N 194 U "C5'" "H5'" sing N N 195 U "C5'" "H5''" sing N N 196 U "C4'" "O4'" sing N N 197 U "C4'" "C3'" sing N N 198 U "C4'" "H4'" sing N N 199 U "O4'" "C1'" sing N N 200 U "C3'" "O3'" sing N N 201 U "C3'" "C2'" sing N N 202 U "C3'" "H3'" sing N N 203 U "O3'" "HO3'" sing N N 204 U "C2'" "O2'" sing N N 205 U "C2'" "C1'" sing N N 206 U "C2'" "H2'" sing N N 207 U "O2'" "HO2'" sing N N 208 U "C1'" N1 sing N N 209 U "C1'" "H1'" sing N N 210 U N1 C2 sing N N 211 U N1 C6 sing N N 212 U C2 O2 doub N N 213 U C2 N3 sing N N 214 U N3 C4 sing N N 215 U N3 H3 sing N N 216 U C4 O4 doub N N 217 U C4 C5 sing N N 218 U C5 C6 doub N N 219 U C5 H5 sing N N 220 U C6 H6 sing N N 221 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9V4V 'double helix' 9V4V 'a-form double helix' 9V4V 'hairpin loop' 9V4V 'mismatched base pair' 9V4V 'triple helix' 9V4V 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 71 1_555 -0.151 -0.180 -0.800 -7.115 -4.808 -0.186 1 A_G2:C71_A A 2 ? A 71 ? 19 1 1 A G 3 1_555 A U 70 1_555 -2.347 -0.474 -1.088 -7.643 -1.516 14.088 2 A_G3:U70_A A 3 ? A 70 ? 28 1 1 A U 4 1_555 A A 69 1_555 -0.061 -0.131 -0.515 -0.118 2.959 1.290 3 A_U4:A69_A A 4 ? A 69 ? 20 1 1 A U 5 1_555 A A 68 1_555 -0.043 -0.099 -0.329 2.785 2.146 1.794 4 A_U5:A68_A A 5 ? A 68 ? 20 1 1 A G 6 1_555 A C 67 1_555 -0.243 -0.107 -0.410 -12.530 -6.648 2.491 5 A_G6:C67_A A 6 ? A 67 ? 19 1 1 A U 7 1_555 A A 66 1_555 -0.131 -0.028 0.005 -4.773 -0.465 0.691 6 A_U7:A66_A A 7 ? A 66 ? 20 1 1 A A 8 1_555 A U 65 1_555 0.235 -0.193 0.860 2.813 -4.766 -10.411 7 A_A8:U65_A A 8 ? A 65 ? 20 1 1 A U 38 1_555 A U 34 1_555 -4.500 -0.923 1.714 -22.759 54.094 -62.416 8 A_U38:U34_A A 38 ? A 34 ? ? ? 1 A U 9 1_555 A A 39 1_555 0.452 0.480 0.457 -2.009 -2.314 7.227 9 A_U9:A39_A A 9 ? A 39 ? 20 1 1 A A 10 1_555 A G 33 1_555 -3.710 3.449 0.246 2.610 -1.718 64.067 10 A_A10:G33_A A 10 ? A 33 ? 10 6 1 A G 12 1_555 A C 32 1_555 -0.155 -0.132 -0.238 1.150 -1.669 0.480 11 A_G12:C32_A A 12 ? A 32 ? 19 1 1 A C 13 1_555 A G 31 1_555 0.167 -0.137 -0.452 0.333 -2.301 1.701 12 A_C13:G31_A A 13 ? A 31 ? 19 1 1 A U 14 1_555 A A 30 1_555 -0.065 -0.074 -0.268 -0.172 4.284 0.376 13 A_U14:A30_A A 14 ? A 30 ? 20 1 1 A C 15 1_555 A G 29 1_555 0.217 -0.131 -0.106 0.295 0.373 1.072 14 A_C15:G29_A A 15 ? A 29 ? 19 1 1 A G 16 1_555 A U 28 1_555 -0.869 -0.511 -0.546 -12.518 -0.179 0.509 15 A_G16:U28_A A 16 ? A 28 ? 28 1 1 A U 17 1_555 A A 27 1_555 -0.005 -0.071 -0.050 -4.177 6.180 0.820 16 A_U17:A27_A A 17 ? A 27 ? 20 1 1 A U 18 1_555 A A 26 1_555 0.026 -0.066 0.186 0.715 1.046 1.468 17 A_U18:A26_A A 18 ? A 26 ? 20 1 1 A C 47 1_555 A G 25 1_555 0.098 -0.103 0.490 -13.885 -1.976 1.430 18 A_C47:G25_A A 47 ? A 25 ? 19 1 1 A A 20 1_555 A A 53 1_555 4.151 2.132 0.533 -9.423 0.640 -114.233 19 A_A20:A53_A A 20 ? A 53 ? 5 4 1 A U 21 1_555 A A 52 1_555 0.306 3.076 -0.243 1.815 -5.480 155.631 20 A_U21:A52_A A 21 ? A 52 ? ? 2 1 A C 40 1_555 A G 62 1_555 0.119 -0.151 -0.072 -3.151 -5.004 0.060 21 A_C40:G62_A A 40 ? A 62 ? 19 1 1 A A 11 1_555 A A 61 1_555 -3.666 2.088 -0.088 1.570 -8.778 -123.118 22 A_A11:A61_A A 11 ? A 61 ? 5 4 1 A A 41 1_555 A C 59 1_555 4.215 1.728 -0.149 -6.178 -7.071 -95.662 23 A_A41:C59_A A 41 ? A 59 ? ? ? 1 A G 42 1_555 A C 58 1_555 -0.236 -0.116 -0.053 -5.564 -8.513 -0.115 24 A_G42:C58_A A 42 ? A 58 ? 19 1 1 A G 43 1_555 A C 57 1_555 -0.235 -0.206 -0.377 -1.653 -5.211 2.085 25 A_G43:C57_A A 43 ? A 57 ? 19 1 1 A C 44 1_555 A G 56 1_555 0.174 -0.146 -0.229 1.999 -4.147 1.498 26 A_C44:G56_A A 44 ? A 56 ? 19 1 1 A A 45 1_555 A U 55 1_555 0.033 -0.141 0.143 -0.929 -3.139 4.646 27 A_A45:U55_A A 45 ? A 55 ? 20 1 1 A A 46 1_555 A U 54 1_555 0.074 -0.109 -0.099 -4.798 -4.766 3.697 28 A_A46:U54_A A 46 ? A 54 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 71 1_555 A G 3 1_555 A U 70 1_555 0.717 -0.914 3.318 -6.392 9.012 26.533 -3.766 -2.810 2.633 18.642 13.221 28.703 1 AA_G2G3:U70C71_AA A 2 ? A 71 ? A 3 ? A 70 ? 1 A G 3 1_555 A U 70 1_555 A U 4 1_555 A A 69 1_555 -0.608 -1.068 3.237 -6.795 3.930 44.049 -1.760 0.184 3.190 5.190 8.974 44.709 2 AA_G3U4:A69U70_AA A 3 ? A 70 ? A 4 ? A 69 ? 1 A U 4 1_555 A A 69 1_555 A U 5 1_555 A A 68 1_555 -0.084 -1.694 3.195 -0.196 3.125 30.273 -3.822 0.124 3.009 5.964 0.375 30.431 3 AA_U4U5:A68A69_AA A 4 ? A 69 ? A 5 ? A 68 ? 1 A U 5 1_555 A A 68 1_555 A G 6 1_555 A C 67 1_555 0.109 -1.670 3.443 3.518 18.263 34.341 -4.586 0.238 2.300 28.491 -5.489 38.920 4 AA_U5G6:C67A68_AA A 5 ? A 68 ? A 6 ? A 67 ? 1 A G 6 1_555 A C 67 1_555 A U 7 1_555 A A 66 1_555 -0.675 -1.404 3.195 -4.589 3.274 32.346 -3.030 0.430 3.105 5.822 8.160 32.820 5 AA_G6U7:A66C67_AA A 6 ? A 67 ? A 7 ? A 66 ? 1 A U 7 1_555 A A 66 1_555 A A 8 1_555 A U 65 1_555 0.223 -1.467 3.019 -0.511 7.373 28.194 -4.313 -0.539 2.556 14.816 1.027 29.128 6 AA_U7A8:U65A66_AA A 7 ? A 66 ? A 8 ? A 65 ? 1 A A 8 1_555 A U 65 1_555 A U 38 1_555 A U 34 1_555 -2.640 6.191 1.871 27.183 -1.649 154.060 3.175 1.402 1.705 -0.845 -13.934 154.801 7 AA_A8U38:U34U65_AA A 8 ? A 65 ? A 38 ? A 34 ? 1 A U 38 1_555 A U 34 1_555 A U 9 1_555 A A 39 1_555 1.595 3.122 0.505 147.974 12.147 -147.769 -1.568 0.833 -0.008 -6.122 74.575 -171.350 8 AA_U38U9:A39U34_AA A 38 ? A 34 ? A 9 ? A 39 ? 1 A U 9 1_555 A A 39 1_555 A A 10 1_555 A G 33 1_555 0.701 2.014 -2.639 -8.007 -3.925 -18.028 -7.041 4.599 -1.702 11.646 -23.758 -20.096 9 AA_U9A10:G33A39_AA A 9 ? A 39 ? A 10 ? A 33 ? 1 A A 10 1_555 A G 33 1_555 A G 12 1_555 A C 32 1_555 -1.368 -3.803 -0.950 130.891 -121.957 130.167 -1.987 0.592 -0.191 -61.013 -65.483 179.537 10 AA_A10G12:C32G33_AA A 10 ? A 33 ? A 12 ? A 32 ? 1 A G 12 1_555 A C 32 1_555 A C 13 1_555 A G 31 1_555 -0.180 -1.900 3.302 1.350 -0.429 34.930 -3.098 0.506 3.316 -0.715 -2.248 34.957 11 AA_G12C13:G31C32_AA A 12 ? A 32 ? A 13 ? A 31 ? 1 A C 13 1_555 A G 31 1_555 A U 14 1_555 A A 30 1_555 -0.519 -1.907 3.255 -2.351 5.641 27.553 -5.154 0.547 2.850 11.663 4.861 28.210 12 AA_C13U14:A30G31_AA A 13 ? A 31 ? A 14 ? A 30 ? 1 A U 14 1_555 A A 30 1_555 A C 15 1_555 A G 29 1_555 0.401 -1.837 3.181 1.453 4.445 31.603 -4.094 -0.482 2.917 8.105 -2.650 31.939 13 AA_U14C15:G29A30_AA A 14 ? A 30 ? A 15 ? A 29 ? 1 A C 15 1_555 A G 29 1_555 A G 16 1_555 A U 28 1_555 0.913 -2.126 3.582 6.450 13.661 27.412 -6.496 -0.494 2.426 26.434 -12.481 31.229 14 AA_C15G16:U28G29_AA A 15 ? A 29 ? A 16 ? A 28 ? 1 A G 16 1_555 A U 28 1_555 A U 17 1_555 A A 27 1_555 -0.368 -1.854 3.115 -4.454 3.128 30.511 -4.033 -0.112 2.937 5.885 8.380 30.982 15 AA_G16U17:A27U28_AA A 16 ? A 28 ? A 17 ? A 27 ? 1 A U 17 1_555 A A 27 1_555 A U 18 1_555 A A 26 1_555 0.124 -2.101 3.049 -1.152 8.559 28.484 -5.601 -0.445 2.326 16.910 2.276 29.739 16 AA_U17U18:A26A27_AA A 17 ? A 27 ? A 18 ? A 26 ? 1 A C 47 1_555 A G 25 1_555 A A 20 1_555 A A 53 1_555 0.837 -6.511 1.646 1.731 -12.664 -123.906 3.730 0.480 1.255 7.166 0.979 -124.285 17 AA_C47A20:A53G25_AA A 47 ? A 25 ? A 20 ? A 53 ? 1 A A 20 1_555 A A 53 1_555 A U 21 1_555 A A 52 1_555 0.614 0.633 3.487 3.066 6.800 -91.564 -0.579 0.490 3.427 -4.738 2.136 -91.799 18 AA_A20U21:A52A53_AA A 20 ? A 53 ? A 21 ? A 52 ? 1 A C 40 1_555 A G 62 1_555 A A 11 1_555 A A 61 1_555 -1.147 -1.210 3.221 -0.124 4.216 -21.944 1.521 -3.006 3.384 -10.946 -0.321 -22.341 19 AA_C40A11:A61G62_AA A 40 ? A 62 ? A 11 ? A 61 ? 1 A A 11 1_555 A A 61 1_555 A A 41 1_555 A C 59 1_555 -0.877 -2.536 3.300 -1.659 -2.834 81.453 -1.869 0.628 3.386 -2.171 1.271 81.508 20 AA_A11A41:C59A61_AA A 11 ? A 61 ? A 41 ? A 59 ? 1 A A 41 1_555 A C 59 1_555 A G 42 1_555 A C 58 1_555 0.837 0.603 3.388 -4.322 3.854 -21.464 -3.084 0.468 3.331 -10.114 -11.341 -22.223 21 AA_A41G42:C58C59_AA A 41 ? A 59 ? A 42 ? A 58 ? 1 A G 42 1_555 A C 58 1_555 A G 43 1_555 A C 57 1_555 -0.595 -1.076 3.257 -4.447 5.167 33.627 -2.623 0.323 3.113 8.818 7.590 34.291 22 AA_G42G43:C57C58_AA A 42 ? A 58 ? A 43 ? A 57 ? 1 A G 43 1_555 A C 57 1_555 A C 44 1_555 A G 56 1_555 0.120 -1.274 3.111 -1.980 4.117 34.911 -2.675 -0.473 2.935 6.827 3.284 35.200 23 AA_G43C44:G56C57_AA A 43 ? A 57 ? A 44 ? A 56 ? 1 A C 44 1_555 A G 56 1_555 A A 45 1_555 A U 55 1_555 0.406 -1.975 3.198 -3.140 6.350 27.023 -5.459 -1.516 2.611 13.301 6.576 27.919 24 AA_C44A45:U55G56_AA A 44 ? A 56 ? A 45 ? A 55 ? 1 A A 45 1_555 A U 55 1_555 A A 46 1_555 A U 54 1_555 0.427 -2.293 3.376 1.617 -0.872 33.096 -3.867 -0.464 3.450 -1.529 -2.836 33.146 25 AA_A45A46:U54U55_AA A 45 ? A 55 ? A 46 ? A 54 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9LJN _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9V4V _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.026339 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.020424 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.008297 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #