data_9V4Y # _entry.id 9V4Y # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.407 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9V4Y pdb_00009v4y 10.2210/pdb9v4y/pdb WWPDB D_1300059809 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-11-26 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9V4Y _pdbx_database_status.recvd_initial_deposition_date 2025-05-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, H.C.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Ligand specificity and adaptability revealed by the first Guanine-II riboswitch tertiary structure.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf884 _citation.pdbx_database_id_PubMed 40966503 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, H.' 1 ? primary 'Shen, X.' 2 ? primary 'Xu, X.' 3 ? primary 'Tai, X.' 4 ? primary 'He, M.' 5 ? primary 'Zhang, J.' 6 ? primary 'Ren, A.' 7 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (71-MER)' 22802.533 1 ? ? ? ? 2 non-polymer syn 8-AMINOGUANINE 166.141 2 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 4 water nat water 18.015 32 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC _entity_poly.pdbx_seq_one_letter_code_can GGGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 8-AMINOGUANINE ANG 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 G n 1 4 U n 1 5 U n 1 6 G n 1 7 U n 1 8 A n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 U n 1 19 A n 1 20 A n 1 21 U n 1 22 U n 1 23 U n 1 24 G n 1 25 G n 1 26 A n 1 27 A n 1 28 U n 1 29 G n 1 30 A n 1 31 G n 1 32 C n 1 33 G n 1 34 U n 1 35 A n 1 36 U n 1 37 C n 1 38 U n 1 39 A n 1 40 C n 1 41 A n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 A n 1 47 C n 1 48 C n 1 49 G n 1 50 U n 1 51 A n 1 52 A n 1 53 A n 1 54 U n 1 55 U n 1 56 G n 1 57 C n 1 58 C n 1 59 C n 1 60 C n 1 61 A n 1 62 G n 1 63 G n 1 64 C n 1 65 U n 1 66 A n 1 67 C n 1 68 A n 1 69 A n 1 70 U n 1 71 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 71 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Staphylococcus aureus' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1280 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 ANG non-polymer . 8-AMINOGUANINE ? 'C5 H6 N6 O' 166.141 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 A 35 35 35 A A A . n A 1 36 U 36 36 36 U U A . n A 1 37 C 37 37 37 C C A . n A 1 38 U 38 38 38 U U A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 A 46 46 46 A A A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 G 49 49 49 G G A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 U 54 54 54 U U A . n A 1 55 U 55 55 55 U U A . n A 1 56 G 56 56 56 G G A . n A 1 57 C 57 57 57 C C A . n A 1 58 C 58 58 58 C C A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 U 65 65 65 U U A . n A 1 66 A 66 66 66 A A A . n A 1 67 C 67 67 67 C C A . n A 1 68 A 68 68 68 A A A . n A 1 69 A 69 69 69 A A A . n A 1 70 U 70 70 70 U U A . n A 1 71 C 71 71 71 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id ANG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id ANG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 ANG 1 101 101 ANG ANG A . C 2 ANG 1 102 102 ANG ANG A . D 3 MG 1 103 1 MG MG A . E 4 HOH 1 201 32 HOH HOH A . E 4 HOH 2 202 27 HOH HOH A . E 4 HOH 3 203 2 HOH HOH A . E 4 HOH 4 204 38 HOH HOH A . E 4 HOH 5 205 12 HOH HOH A . E 4 HOH 6 206 13 HOH HOH A . E 4 HOH 7 207 28 HOH HOH A . E 4 HOH 8 208 22 HOH HOH A . E 4 HOH 9 209 6 HOH HOH A . E 4 HOH 10 210 37 HOH HOH A . E 4 HOH 11 211 18 HOH HOH A . E 4 HOH 12 212 11 HOH HOH A . E 4 HOH 13 213 33 HOH HOH A . E 4 HOH 14 214 23 HOH HOH A . E 4 HOH 15 215 15 HOH HOH A . E 4 HOH 16 216 16 HOH HOH A . E 4 HOH 17 217 19 HOH HOH A . E 4 HOH 18 218 29 HOH HOH A . E 4 HOH 19 219 31 HOH HOH A . E 4 HOH 20 220 20 HOH HOH A . E 4 HOH 21 221 34 HOH HOH A . E 4 HOH 22 222 36 HOH HOH A . E 4 HOH 23 223 21 HOH HOH A . E 4 HOH 24 224 5 HOH HOH A . E 4 HOH 25 225 30 HOH HOH A . E 4 HOH 26 226 14 HOH HOH A . E 4 HOH 27 227 24 HOH HOH A . E 4 HOH 28 228 26 HOH HOH A . E 4 HOH 29 229 7 HOH HOH A . E 4 HOH 30 230 3 HOH HOH A . E 4 HOH 31 231 8 HOH HOH A . E 4 HOH 32 232 25 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9V4Y _cell.details ? _cell.formula_units_Z ? _cell.length_a 38.123 _cell.length_a_esd ? _cell.length_b 51.870 _cell.length_b_esd ? _cell.length_c 221.523 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9V4Y _symmetry.cell_setting ? _symmetry.Int_Tables_number 20 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 2 2 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9V4Y _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.40 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 48.78 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.08 M sodium chloride, 0.04 M sodium cacodylate trihydrate (pH 7.0), 30% v/v (+/-)-2-methyl-2,4-pentanediol, and 0.012 M spermine tetrahydrochloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-04-23 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.10213 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.10213 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9V4Y _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.79 _reflns.d_resolution_low 55.38 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5601 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 95 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 11.4 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 9.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.996 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.195 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.79 _reflns_shell.d_res_low 2.94 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 860 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.803 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9V4Y _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.79 _refine.ls_d_res_low 55.38 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5513 _refine.ls_number_reflns_R_free 549 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 94.13 _refine.ls_percent_reflns_R_free 9.96 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2328 _refine.ls_R_factor_R_free 0.2864 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2269 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 27.63 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.39 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.79 _refine_hist.d_res_low 55.38 _refine_hist.number_atoms_solvent 32 _refine_hist.number_atoms_total 1568 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1511 _refine_hist.pdbx_number_atoms_ligand 25 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.002 ? 1715 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.517 ? 2667 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 19.938 ? 849 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.026 ? 355 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.002 ? 73 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.79 3.07 . . 140 1280 100.00 . . . . 0.3150 . . . . . . . . . . . . . . . 0.3598 'X-RAY DIFFRACTION' 3.07 3.51 . . 134 1204 92.00 . . . . 0.2728 . . . . . . . . . . . . . . . 0.3412 'X-RAY DIFFRACTION' 3.51 4.42 . . 123 1104 85.00 . . . . 0.2319 . . . . . . . . . . . . . . . 0.2687 'X-RAY DIFFRACTION' 4.42 55.38 . . 152 1376 99.00 . . . . 0.1823 . . . . . . . . . . . . . . . 0.2474 # _struct.entry_id 9V4Y _struct.title 'Crystal structure of Guanine-II riboswitch in complex with 8-aminoguanine' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9V4Y _struct_keywords.text 'guanine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 2 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9V4Y _struct_ref.pdbx_db_accession 9V4Y _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9V4Y _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 71 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9V4Y _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 71 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 71 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A C 71 "O3'" ? ? ? 1_555 D MG . MG ? ? A C 71 A MG 103 1_555 ? ? ? ? ? ? ? 1.975 ? ? metalc2 metalc ? ? A C 71 "O2'" ? ? ? 1_555 D MG . MG ? ? A C 71 A MG 103 1_555 ? ? ? ? ? ? ? 1.870 ? ? metalc3 metalc ? ? D MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 103 A HOH 207 1_555 ? ? ? ? ? ? ? 1.982 ? ? metalc4 metalc ? ? D MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 103 A HOH 217 1_555 ? ? ? ? ? ? ? 2.140 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 70 O2 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 70 N3 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 66 N1 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 66 N6 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 65 O4 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 O4 ? ? ? 1_555 A G 33 N1 ? ? A U 9 A G 33 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 10 N1 ? ? ? 1_555 A G 33 N2 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog21 hydrog ? ? A A 10 N6 ? ? ? 1_555 A G 33 N3 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 A A 61 N1 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog23 hydrog ? ? A A 11 N7 ? ? ? 1_555 A A 61 N6 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 16 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 20 N1 ? ? ? 1_555 A A 53 N6 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A A 20 N6 ? ? ? 1_555 A A 53 N7 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog43 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 24 N2 ? ? A U 21 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog44 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 52 N1 ? ? A U 21 A A 52 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog45 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 25 N2 ? ? ? 1_555 A A 53 N1 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog52 hydrog ? ? A G 25 N3 ? ? ? 1_555 A A 53 N6 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog53 hydrog ? ? A U 34 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 34 A A 39 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog54 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 66 N3 ? ? A U 36 A A 66 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog55 hydrog ? ? A C 37 N4 ? ? ? 1_555 A U 65 O2 ? ? A C 37 A U 65 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog56 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A A 41 N1 ? ? ? 1_555 A C 59 N4 ? ? A A 41 A C 59 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog60 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 58 N3 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 58 O2 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 58 N4 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 57 N3 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 57 O2 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 57 N4 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 45 N1 ? ? ? 1_555 A U 55 N3 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 45 N6 ? ? ? 1_555 A U 55 O4 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 46 N1 ? ? ? 1_555 A U 54 N3 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 46 N6 ? ? ? 1_555 A U 54 O4 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 48 O2 ? ? ? 1_555 A A 52 N6 ? ? A C 48 A A 52 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O3'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 "O2'" ? A C 71 ? A C 71 ? 1_555 92.4 ? 2 "O3'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 207 ? 1_555 91.0 ? 3 "O2'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 207 ? 1_555 94.3 ? 4 "O3'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 217 ? 1_555 161.5 ? 5 "O2'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 217 ? 1_555 96.6 ? 6 O ? E HOH . ? A HOH 207 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 217 ? 1_555 104.4 ? # _pdbx_entry_details.entry_id 9V4Y _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -7.3561 _pdbx_refine_tls.origin_y -8.4185 _pdbx_refine_tls.origin_z -26.3179 _pdbx_refine_tls.T[1][1] 0.4412 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0528 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0696 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.7541 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0689 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.4085 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 1.4182 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 1.0581 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.5253 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.9754 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.0905 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 2.1609 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.2107 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.9356 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.0974 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] -0.4809 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.2373 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.1905 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.0876 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0627 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0397 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # _pdbx_distant_solvent_atoms.id 1 _pdbx_distant_solvent_atoms.PDB_model_num 1 _pdbx_distant_solvent_atoms.auth_atom_id O _pdbx_distant_solvent_atoms.label_alt_id ? _pdbx_distant_solvent_atoms.auth_asym_id A _pdbx_distant_solvent_atoms.auth_comp_id HOH _pdbx_distant_solvent_atoms.auth_seq_id 232 _pdbx_distant_solvent_atoms.PDB_ins_code ? _pdbx_distant_solvent_atoms.neighbor_macromolecule_distance 6.97 _pdbx_distant_solvent_atoms.neighbor_ligand_distance . # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 ANG N9 N Y N 38 ANG C4 C Y N 39 ANG N3 N N N 40 ANG C2 C N N 41 ANG N2 N N N 42 ANG N1 N N N 43 ANG C6 C N N 44 ANG O6 O N N 45 ANG C5 C Y N 46 ANG N7 N Y N 47 ANG C8 C Y N 48 ANG N8 N N N 49 ANG H9 H N N 50 ANG H21 H N N 51 ANG H22 H N N 52 ANG H1 H N N 53 ANG H81 H N N 54 ANG H82 H N N 55 C OP3 O N N 56 C P P N N 57 C OP1 O N N 58 C OP2 O N N 59 C "O5'" O N N 60 C "C5'" C N N 61 C "C4'" C N R 62 C "O4'" O N N 63 C "C3'" C N S 64 C "O3'" O N N 65 C "C2'" C N R 66 C "O2'" O N N 67 C "C1'" C N R 68 C N1 N N N 69 C C2 C N N 70 C O2 O N N 71 C N3 N N N 72 C C4 C N N 73 C N4 N N N 74 C C5 C N N 75 C C6 C N N 76 C HOP3 H N N 77 C HOP2 H N N 78 C "H5'" H N N 79 C "H5''" H N N 80 C "H4'" H N N 81 C "H3'" H N N 82 C "HO3'" H N N 83 C "H2'" H N N 84 C "HO2'" H N N 85 C "H1'" H N N 86 C H41 H N N 87 C H42 H N N 88 C H5 H N N 89 C H6 H N N 90 G OP3 O N N 91 G P P N N 92 G OP1 O N N 93 G OP2 O N N 94 G "O5'" O N N 95 G "C5'" C N N 96 G "C4'" C N R 97 G "O4'" O N N 98 G "C3'" C N S 99 G "O3'" O N N 100 G "C2'" C N R 101 G "O2'" O N N 102 G "C1'" C N R 103 G N9 N Y N 104 G C8 C Y N 105 G N7 N Y N 106 G C5 C Y N 107 G C6 C N N 108 G O6 O N N 109 G N1 N N N 110 G C2 C N N 111 G N2 N N N 112 G N3 N N N 113 G C4 C Y N 114 G HOP3 H N N 115 G HOP2 H N N 116 G "H5'" H N N 117 G "H5''" H N N 118 G "H4'" H N N 119 G "H3'" H N N 120 G "HO3'" H N N 121 G "H2'" H N N 122 G "HO2'" H N N 123 G "H1'" H N N 124 G H8 H N N 125 G H1 H N N 126 G H21 H N N 127 G H22 H N N 128 HOH O O N N 129 HOH H1 H N N 130 HOH H2 H N N 131 MG MG MG N N 132 U OP3 O N N 133 U P P N N 134 U OP1 O N N 135 U OP2 O N N 136 U "O5'" O N N 137 U "C5'" C N N 138 U "C4'" C N R 139 U "O4'" O N N 140 U "C3'" C N S 141 U "O3'" O N N 142 U "C2'" C N R 143 U "O2'" O N N 144 U "C1'" C N R 145 U N1 N N N 146 U C2 C N N 147 U O2 O N N 148 U N3 N N N 149 U C4 C N N 150 U O4 O N N 151 U C5 C N N 152 U C6 C N N 153 U HOP3 H N N 154 U HOP2 H N N 155 U "H5'" H N N 156 U "H5''" H N N 157 U "H4'" H N N 158 U "H3'" H N N 159 U "HO3'" H N N 160 U "H2'" H N N 161 U "HO2'" H N N 162 U "H1'" H N N 163 U H3 H N N 164 U H5 H N N 165 U H6 H N N 166 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 ANG N9 C4 sing Y N 40 ANG N9 C8 sing Y N 41 ANG N9 H9 sing N N 42 ANG C4 N3 sing N N 43 ANG C4 C5 doub Y N 44 ANG N3 C2 doub N N 45 ANG C2 N2 sing N N 46 ANG C2 N1 sing N N 47 ANG N2 H21 sing N N 48 ANG N2 H22 sing N N 49 ANG N1 C6 sing N N 50 ANG N1 H1 sing N N 51 ANG C6 O6 doub N N 52 ANG C6 C5 sing N N 53 ANG C5 N7 sing Y N 54 ANG N7 C8 doub Y N 55 ANG C8 N8 sing N N 56 ANG N8 H81 sing N N 57 ANG N8 H82 sing N N 58 C OP3 P sing N N 59 C OP3 HOP3 sing N N 60 C P OP1 doub N N 61 C P OP2 sing N N 62 C P "O5'" sing N N 63 C OP2 HOP2 sing N N 64 C "O5'" "C5'" sing N N 65 C "C5'" "C4'" sing N N 66 C "C5'" "H5'" sing N N 67 C "C5'" "H5''" sing N N 68 C "C4'" "O4'" sing N N 69 C "C4'" "C3'" sing N N 70 C "C4'" "H4'" sing N N 71 C "O4'" "C1'" sing N N 72 C "C3'" "O3'" sing N N 73 C "C3'" "C2'" sing N N 74 C "C3'" "H3'" sing N N 75 C "O3'" "HO3'" sing N N 76 C "C2'" "O2'" sing N N 77 C "C2'" "C1'" sing N N 78 C "C2'" "H2'" sing N N 79 C "O2'" "HO2'" sing N N 80 C "C1'" N1 sing N N 81 C "C1'" "H1'" sing N N 82 C N1 C2 sing N N 83 C N1 C6 sing N N 84 C C2 O2 doub N N 85 C C2 N3 sing N N 86 C N3 C4 doub N N 87 C C4 N4 sing N N 88 C C4 C5 sing N N 89 C N4 H41 sing N N 90 C N4 H42 sing N N 91 C C5 C6 doub N N 92 C C5 H5 sing N N 93 C C6 H6 sing N N 94 G OP3 P sing N N 95 G OP3 HOP3 sing N N 96 G P OP1 doub N N 97 G P OP2 sing N N 98 G P "O5'" sing N N 99 G OP2 HOP2 sing N N 100 G "O5'" "C5'" sing N N 101 G "C5'" "C4'" sing N N 102 G "C5'" "H5'" sing N N 103 G "C5'" "H5''" sing N N 104 G "C4'" "O4'" sing N N 105 G "C4'" "C3'" sing N N 106 G "C4'" "H4'" sing N N 107 G "O4'" "C1'" sing N N 108 G "C3'" "O3'" sing N N 109 G "C3'" "C2'" sing N N 110 G "C3'" "H3'" sing N N 111 G "O3'" "HO3'" sing N N 112 G "C2'" "O2'" sing N N 113 G "C2'" "C1'" sing N N 114 G "C2'" "H2'" sing N N 115 G "O2'" "HO2'" sing N N 116 G "C1'" N9 sing N N 117 G "C1'" "H1'" sing N N 118 G N9 C8 sing Y N 119 G N9 C4 sing Y N 120 G C8 N7 doub Y N 121 G C8 H8 sing N N 122 G N7 C5 sing Y N 123 G C5 C6 sing N N 124 G C5 C4 doub Y N 125 G C6 O6 doub N N 126 G C6 N1 sing N N 127 G N1 C2 sing N N 128 G N1 H1 sing N N 129 G C2 N2 sing N N 130 G C2 N3 doub N N 131 G N2 H21 sing N N 132 G N2 H22 sing N N 133 G N3 C4 sing N N 134 HOH O H1 sing N N 135 HOH O H2 sing N N 136 U OP3 P sing N N 137 U OP3 HOP3 sing N N 138 U P OP1 doub N N 139 U P OP2 sing N N 140 U P "O5'" sing N N 141 U OP2 HOP2 sing N N 142 U "O5'" "C5'" sing N N 143 U "C5'" "C4'" sing N N 144 U "C5'" "H5'" sing N N 145 U "C5'" "H5''" sing N N 146 U "C4'" "O4'" sing N N 147 U "C4'" "C3'" sing N N 148 U "C4'" "H4'" sing N N 149 U "O4'" "C1'" sing N N 150 U "C3'" "O3'" sing N N 151 U "C3'" "C2'" sing N N 152 U "C3'" "H3'" sing N N 153 U "O3'" "HO3'" sing N N 154 U "C2'" "O2'" sing N N 155 U "C2'" "C1'" sing N N 156 U "C2'" "H2'" sing N N 157 U "O2'" "HO2'" sing N N 158 U "C1'" N1 sing N N 159 U "C1'" "H1'" sing N N 160 U N1 C2 sing N N 161 U N1 C6 sing N N 162 U C2 O2 doub N N 163 U C2 N3 sing N N 164 U N3 C4 sing N N 165 U N3 H3 sing N N 166 U C4 O4 doub N N 167 U C4 C5 sing N N 168 U C5 C6 doub N N 169 U C5 H5 sing N N 170 U C6 H6 sing N N 171 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9V4Y 'double helix' 9V4Y 'a-form double helix' 9V4Y 'hairpin loop' 9V4Y 'mismatched base pair' 9V4Y 'internal loop' 9V4Y 'triple helix' 9V4Y 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 71 1_555 0.045 -0.178 0.024 -7.948 -0.137 2.176 1 A_G2:C71_A A 2 ? A 71 ? 19 1 1 A G 3 1_555 A U 70 1_555 -2.385 -0.354 0.517 0.248 -6.148 3.843 2 A_G3:U70_A A 3 ? A 70 ? 28 1 1 A U 4 1_555 A A 69 1_555 0.091 -0.066 0.271 5.043 -12.476 3.436 3 A_U4:A69_A A 4 ? A 69 ? 20 1 1 A U 5 1_555 A A 68 1_555 0.108 -0.132 -0.051 3.101 -12.358 4.210 4 A_U5:A68_A A 5 ? A 68 ? 20 1 1 A G 6 1_555 A C 67 1_555 -0.419 -0.167 -0.207 -14.845 -13.192 1.850 5 A_G6:C67_A A 6 ? A 67 ? 19 1 1 A U 7 1_555 A A 66 1_555 0.065 -0.094 0.291 -10.998 -13.084 6.695 6 A_U7:A66_A A 7 ? A 66 ? 20 1 1 A A 8 1_555 A U 65 1_555 0.400 0.098 -0.065 -7.899 -15.643 -11.660 7 A_A8:U65_A A 8 ? A 65 ? 20 1 1 A U 9 1_555 A A 39 1_555 0.356 -0.053 -0.633 15.127 0.046 -0.141 8 A_U9:A39_A A 9 ? A 39 ? 20 1 1 A A 10 1_555 A G 33 1_555 -3.839 3.603 0.584 6.888 -4.060 59.982 9 A_A10:G33_A A 10 ? A 33 ? 10 6 1 A G 12 1_555 A C 32 1_555 -0.354 -0.033 -0.402 2.791 -15.979 7.158 10 A_G12:C32_A A 12 ? A 32 ? 19 1 1 A C 13 1_555 A G 31 1_555 0.022 -0.157 -0.422 -1.495 -6.291 8.517 11 A_C13:G31_A A 13 ? A 31 ? 19 1 1 A U 14 1_555 A A 30 1_555 0.173 -0.132 0.078 -1.691 -3.080 4.274 12 A_U14:A30_A A 14 ? A 30 ? 20 1 1 A C 15 1_555 A G 29 1_555 0.367 -0.039 -0.430 5.191 1.098 2.422 13 A_C15:G29_A A 15 ? A 29 ? 19 1 1 A G 16 1_555 A U 28 1_555 -1.988 -0.043 -0.618 -14.305 -10.335 8.664 14 A_G16:U28_A A 16 ? A 28 ? 28 1 1 A U 17 1_555 A A 27 1_555 0.090 0.207 -0.369 0.246 -6.021 0.394 15 A_U17:A27_A A 17 ? A 27 ? 20 1 1 A U 18 1_555 A A 26 1_555 0.534 -0.180 -0.319 11.006 -0.264 9.027 16 A_U18:A26_A A 18 ? A 26 ? 20 1 1 A C 47 1_555 A G 25 1_555 -0.310 0.038 0.293 -13.350 -11.139 3.649 17 A_C47:G25_A A 47 ? A 25 ? 19 1 1 A A 20 1_555 A A 53 1_555 4.601 1.833 0.479 -18.183 6.284 -119.257 18 A_A20:A53_A A 20 ? A 53 ? 5 4 1 A U 21 1_555 A A 52 1_555 0.128 1.971 -0.582 1.208 -9.206 166.335 19 A_U21:A52_A A 21 ? A 52 ? ? 2 1 A G 24 1_555 A C 48 1_555 0.015 -0.186 0.393 5.480 -3.604 -3.380 20 A_G24:C48_A A 24 ? A 48 ? 19 1 1 A C 40 1_555 A G 62 1_555 0.416 -0.128 0.403 -1.668 -6.908 10.627 21 A_C40:G62_A A 40 ? A 62 ? 19 1 1 A A 11 1_555 A A 61 1_555 -4.181 1.251 -1.057 8.253 -16.724 -119.458 22 A_A11:A61_A A 11 ? A 61 ? 5 4 1 A A 41 1_555 A C 59 1_555 3.950 1.179 -0.231 -2.578 -0.330 -90.114 23 A_A41:C59_A A 41 ? A 59 ? ? ? 1 A G 42 1_555 A C 58 1_555 -0.324 -0.261 0.481 -0.169 -17.865 -1.719 24 A_G42:C58_A A 42 ? A 58 ? 19 1 1 A G 43 1_555 A C 57 1_555 -0.486 -0.237 0.075 1.337 -14.686 7.088 25 A_G43:C57_A A 43 ? A 57 ? 19 1 1 A C 44 1_555 A G 56 1_555 0.449 -0.136 -0.059 5.655 -12.331 9.007 26 A_C44:G56_A A 44 ? A 56 ? 19 1 1 A A 45 1_555 A U 55 1_555 -0.230 -0.123 0.362 1.183 -8.325 9.998 27 A_A45:U55_A A 45 ? A 55 ? 20 1 1 A A 46 1_555 A U 54 1_555 0.365 -0.328 -0.183 -7.844 -12.242 2.770 28 A_A46:U54_A A 46 ? A 54 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 71 1_555 A G 3 1_555 A U 70 1_555 0.101 -1.705 2.818 -6.392 6.473 23.705 -5.362 -1.691 2.182 15.066 14.876 25.367 1 AA_G2G3:U70C71_AA A 2 ? A 71 ? A 3 ? A 70 ? 1 A G 3 1_555 A U 70 1_555 A U 4 1_555 A A 69 1_555 -0.082 -1.131 3.105 0.180 5.053 40.130 -2.162 0.137 2.947 7.328 -0.260 40.434 2 AA_G3U4:A69U70_AA A 3 ? A 70 ? A 4 ? A 69 ? 1 A U 4 1_555 A A 69 1_555 A U 5 1_555 A A 68 1_555 0.207 -1.794 3.148 1.193 6.944 32.717 -4.159 -0.181 2.727 12.152 -2.088 33.446 3 AA_U4U5:A68A69_AA A 4 ? A 69 ? A 5 ? A 68 ? 1 A U 5 1_555 A A 68 1_555 A G 6 1_555 A C 67 1_555 -0.013 -1.522 3.658 0.363 11.757 29.785 -4.965 0.091 2.866 21.831 -0.673 31.975 4 AA_U5G6:C67A68_AA A 5 ? A 68 ? A 6 ? A 67 ? 1 A G 6 1_555 A C 67 1_555 A U 7 1_555 A A 66 1_555 0.337 -1.467 3.208 -0.867 8.516 34.126 -3.608 -0.677 2.764 14.234 1.449 35.152 5 AA_G6U7:A66C67_AA A 6 ? A 67 ? A 7 ? A 66 ? 1 A U 7 1_555 A A 66 1_555 A A 8 1_555 A U 65 1_555 0.031 -1.675 3.092 6.510 17.297 32.133 -4.575 0.678 1.943 28.498 -10.726 36.947 6 AA_U7A8:U65A66_AA A 7 ? A 66 ? A 8 ? A 65 ? 1 A U 9 1_555 A A 39 1_555 A A 10 1_555 A G 33 1_555 0.923 1.388 -2.608 -8.843 -8.770 -12.824 -7.541 6.069 -0.743 31.220 -31.479 -17.859 7 AA_U9A10:G33A39_AA A 9 ? A 39 ? A 10 ? A 33 ? 1 A A 10 1_555 A G 33 1_555 A G 12 1_555 A C 32 1_555 -2.398 -2.624 -1.338 124.574 -116.480 44.832 -1.731 0.759 -0.474 -60.235 -64.420 171.263 8 AA_A10G12:C32G33_AA A 10 ? A 33 ? A 12 ? A 32 ? 1 A G 12 1_555 A C 32 1_555 A C 13 1_555 A G 31 1_555 -0.305 -1.778 3.314 -2.717 3.014 35.092 -3.373 0.103 3.169 4.978 4.487 35.319 9 AA_G12C13:G31C32_AA A 12 ? A 32 ? A 13 ? A 31 ? 1 A C 13 1_555 A G 31 1_555 A U 14 1_555 A A 30 1_555 -0.242 -1.548 3.387 -2.337 4.329 29.469 -3.908 -0.019 3.142 8.436 4.554 29.868 10 AA_C13U14:A30G31_AA A 13 ? A 31 ? A 14 ? A 30 ? 1 A U 14 1_555 A A 30 1_555 A C 15 1_555 A G 29 1_555 -0.175 -1.520 2.993 4.088 8.986 30.738 -4.092 0.933 2.422 16.429 -7.474 32.248 11 AA_U14C15:G29A30_AA A 14 ? A 30 ? A 15 ? A 29 ? 1 A C 15 1_555 A G 29 1_555 A G 16 1_555 A U 28 1_555 1.294 -2.175 3.818 3.621 14.292 21.346 -8.831 -1.880 2.149 33.868 -8.581 25.894 12 AA_C15G16:U28G29_AA A 15 ? A 29 ? A 16 ? A 28 ? 1 A G 16 1_555 A U 28 1_555 A U 17 1_555 A A 27 1_555 -0.530 -1.285 3.069 -3.144 0.008 36.640 -2.037 0.436 3.102 0.013 4.990 36.770 13 AA_G16U17:A27U28_AA A 16 ? A 28 ? A 17 ? A 27 ? 1 A U 17 1_555 A A 27 1_555 A U 18 1_555 A A 26 1_555 0.564 -1.552 3.070 -2.809 7.904 29.245 -4.338 -1.566 2.510 15.262 5.423 30.399 14 AA_U17U18:A26A27_AA A 17 ? A 27 ? A 18 ? A 26 ? 1 A C 47 1_555 A G 25 1_555 A A 20 1_555 A A 53 1_555 0.279 -6.519 1.437 -6.922 -16.517 -117.685 3.851 0.138 0.878 9.622 -4.033 -118.527 15 AA_C47A20:A53G25_AA A 47 ? A 25 ? A 20 ? A 53 ? 1 A A 20 1_555 A A 53 1_555 A U 21 1_555 A A 52 1_555 1.365 1.662 3.419 4.348 8.284 -99.640 -1.218 0.961 3.266 -5.413 2.841 -99.962 16 AA_A20U21:A52A53_AA A 20 ? A 53 ? A 21 ? A 52 ? 1 A C 40 1_555 A G 62 1_555 A A 11 1_555 A A 61 1_555 -1.467 -0.970 3.159 7.504 7.161 -30.002 0.385 -1.228 3.547 -13.342 13.979 -31.706 17 AA_C40A11:A61G62_AA A 40 ? A 62 ? A 11 ? A 61 ? 1 A A 11 1_555 A A 61 1_555 A A 41 1_555 A C 59 1_555 -0.855 -2.210 3.419 -4.387 -0.132 86.869 -1.603 0.520 3.454 -0.096 3.188 86.957 18 AA_A11A41:C59A61_AA A 11 ? A 61 ? A 41 ? A 59 ? 1 A A 41 1_555 A C 59 1_555 A G 42 1_555 A C 58 1_555 0.780 0.884 3.326 -8.763 -1.707 -22.722 -1.521 -1.092 3.439 4.133 -21.219 -24.392 19 AA_A41G42:C58C59_AA A 41 ? A 59 ? A 42 ? A 58 ? 1 A G 42 1_555 A C 58 1_555 A G 43 1_555 A C 57 1_555 -0.290 -1.338 3.150 -3.315 8.610 34.207 -3.366 0.029 2.758 14.317 5.512 35.393 20 AA_G42G43:C57C58_AA A 42 ? A 58 ? A 43 ? A 57 ? 1 A G 43 1_555 A C 57 1_555 A C 44 1_555 A G 56 1_555 0.259 -1.022 3.118 0.023 6.329 36.166 -2.427 -0.408 2.904 10.100 -0.036 36.697 21 AA_G43C44:G56C57_AA A 43 ? A 57 ? A 44 ? A 56 ? 1 A C 44 1_555 A G 56 1_555 A A 45 1_555 A U 55 1_555 0.263 -1.497 3.213 -4.778 6.674 29.223 -4.107 -1.396 2.735 12.910 9.243 30.330 22 AA_C44A45:U55G56_AA A 44 ? A 56 ? A 45 ? A 55 ? 1 A A 45 1_555 A U 55 1_555 A A 46 1_555 A U 54 1_555 0.044 -2.133 3.602 3.239 0.157 33.194 -3.746 0.515 3.580 0.274 -5.653 33.348 23 AA_A45A46:U54U55_AA A 45 ? A 55 ? A 46 ? A 54 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9LJN _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9V4Y _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.026231 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019279 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004514 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #