data_9V4Z # _entry.id 9V4Z # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.407 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9V4Z pdb_00009v4z 10.2210/pdb9v4z/pdb WWPDB D_1300059810 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-11-26 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9V4Z _pdbx_database_status.recvd_initial_deposition_date 2025-05-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, H.C.' 1 0009-0002-2998-6881 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Ligand specificity and adaptability revealed by the first Guanine-II riboswitch tertiary structure.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf884 _citation.pdbx_database_id_PubMed 40966503 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, H.' 1 ? primary 'Shen, X.' 2 ? primary 'Xu, X.' 3 ? primary 'Tai, X.' 4 ? primary 'He, M.' 5 ? primary 'Zhang, J.' 6 ? primary 'Ren, A.' 7 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (71-MER)' 22962.490 1 ? ? ? ? 2 non-polymer syn 8-OXOGUANINE 165.110 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 4 water nat water 18.015 19 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC' _entity_poly.pdbx_seq_one_letter_code_can GGGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 8-OXOGUANINE OXG 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 U n 1 5 U n 1 6 G n 1 7 U n 1 8 A n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 U n 1 19 A n 1 20 A n 1 21 U n 1 22 U n 1 23 U n 1 24 G n 1 25 G n 1 26 A n 1 27 A n 1 28 U n 1 29 G n 1 30 A n 1 31 G n 1 32 C n 1 33 G n 1 34 U n 1 35 A n 1 36 U n 1 37 C n 1 38 U n 1 39 A n 1 40 C n 1 41 A n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 A n 1 47 C n 1 48 C n 1 49 G n 1 50 U n 1 51 A n 1 52 A n 1 53 A n 1 54 U n 1 55 U n 1 56 G n 1 57 C n 1 58 C n 1 59 C n 1 60 C n 1 61 A n 1 62 G n 1 63 G n 1 64 C n 1 65 U n 1 66 A n 1 67 C n 1 68 A n 1 69 A n 1 70 U n 1 71 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 71 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Staphylococcus aureus' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1280 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 OXG non-polymer . 8-OXOGUANINE ? 'C5 H3 N5 O2' 165.110 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 A 35 35 35 A A A . n A 1 36 U 36 36 36 U U A . n A 1 37 C 37 37 37 C C A . n A 1 38 U 38 38 38 U U A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 A 46 46 46 A A A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 G 49 49 49 G G A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 U 54 54 54 U U A . n A 1 55 U 55 55 55 U U A . n A 1 56 G 56 56 56 G G A . n A 1 57 C 57 57 57 C C A . n A 1 58 C 58 58 58 C C A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 U 65 65 65 U U A . n A 1 66 A 66 66 66 A A A . n A 1 67 C 67 67 67 C C A . n A 1 68 A 68 68 68 A A A . n A 1 69 A 69 69 69 A A A . n A 1 70 U 70 70 70 U U A . n A 1 71 C 71 71 71 C C A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id OXG _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id OXG _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 OXG 1 101 101 OXG OXG A . C 3 MG 1 102 1 MG MG A . D 3 MG 1 103 2 MG MG A . E 4 HOH 1 201 15 HOH HOH A . E 4 HOH 2 202 3 HOH HOH A . E 4 HOH 3 203 2 HOH HOH A . E 4 HOH 4 204 22 HOH HOH A . E 4 HOH 5 205 16 HOH HOH A . E 4 HOH 6 206 1 HOH HOH A . E 4 HOH 7 207 21 HOH HOH A . E 4 HOH 8 208 18 HOH HOH A . E 4 HOH 9 209 14 HOH HOH A . E 4 HOH 10 210 19 HOH HOH A . E 4 HOH 11 211 13 HOH HOH A . E 4 HOH 12 212 11 HOH HOH A . E 4 HOH 13 213 4 HOH HOH A . E 4 HOH 14 214 12 HOH HOH A . E 4 HOH 15 215 20 HOH HOH A . E 4 HOH 16 216 5 HOH HOH A . E 4 HOH 17 217 9 HOH HOH A . E 4 HOH 18 218 8 HOH HOH A . E 4 HOH 19 219 6 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 'PHENIX 1.18.2-3874' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9V4Z _cell.details ? _cell.formula_units_Z ? _cell.length_a 37.820 _cell.length_a_esd ? _cell.length_b 50.408 _cell.length_b_esd ? _cell.length_c 219.758 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9V4Z _symmetry.cell_setting ? _symmetry.Int_Tables_number 20 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 2 2 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9V4Z _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.28 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 46.07 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.08 M sodium chloride, 0.04 M sodium cacodylate trihydrate (pH 7.0), 30% v/v (+/-)-2-methyl-2,4-pentanediol, and 0.012 M spermine tetrahydrochloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-04-23 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.10213 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.10213 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9V4Z _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.74 _reflns.d_resolution_low 109.88 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 5897 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 12.0 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 11.9 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.149 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.74 _reflns_shell.d_res_low 2.89 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 862 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.904 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all 100 _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9V4Z _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.74 _refine.ls_d_res_low 54.94 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 5805 _refine.ls_number_reflns_R_free 578 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 98.99 _refine.ls_percent_reflns_R_free 9.96 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2111 _refine.ls_R_factor_R_free 0.2565 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2059 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 30.01 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.48 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 2.74 _refine_hist.d_res_low 54.94 _refine_hist.number_atoms_solvent 19 _refine_hist.number_atoms_total 1553 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1520 _refine_hist.pdbx_number_atoms_ligand 14 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1710 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.208 ? 2661 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 21.105 ? 851 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.056 ? 354 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 72 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.74 3.02 . . 139 1272 99.00 . . . . 0.3596 . . . . . . . . . . . . . . . 0.4067 'X-RAY DIFFRACTION' 3.02 3.46 . . 143 1293 98.00 . . . . 0.2531 . . . . . . . . . . . . . . . 0.3168 'X-RAY DIFFRACTION' 3.46 4.36 . . 142 1280 99.00 . . . . 0.1979 . . . . . . . . . . . . . . . 0.2537 'X-RAY DIFFRACTION' 4.36 54.94 . . 154 1382 100.00 . . . . 0.1525 . . . . . . . . . . . . . . . 0.1962 # _struct.entry_id 9V4Z _struct.title 'Crystal structure of Guanine-II riboswitch in complex with 8-oxoguanine' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9V4Z _struct_keywords.text 'guanine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9V4Z _struct_ref.pdbx_db_accession 9V4Z _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9V4Z _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 71 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9V4Z _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 71 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 71 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.561 ? ? metalc1 metalc ? ? A U 7 "O2'" ? ? ? 1_555 C MG . MG ? ? A U 7 A MG 102 1_555 ? ? ? ? ? ? ? 2.767 ? ? metalc2 metalc ? ? A A 8 "O4'" ? ? ? 1_555 C MG . MG ? ? A A 8 A MG 102 1_555 ? ? ? ? ? ? ? 2.657 ? ? metalc3 metalc ? ? A U 36 O4 ? ? ? 1_555 C MG . MG ? ? A U 36 A MG 102 1_555 ? ? ? ? ? ? ? 2.109 ? ? metalc4 metalc ? ? A C 71 "O2'" ? ? ? 1_555 D MG . MG ? ? A C 71 A MG 103 1_555 ? ? ? ? ? ? ? 1.988 ? ? metalc5 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 211 1_555 ? ? ? ? ? ? ? 2.800 ? ? metalc6 metalc ? ? C MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 102 A HOH 215 8_545 ? ? ? ? ? ? ? 2.929 ? ? metalc7 metalc ? ? D MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 103 A HOH 204 1_555 ? ? ? ? ? ? ? 2.523 ? ? metalc8 metalc ? ? D MG . MG ? ? ? 1_555 E HOH . O ? ? A MG 103 A HOH 215 1_555 ? ? ? ? ? ? ? 1.816 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 71 N3 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 71 O2 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 71 N4 ? ? A G 2 A C 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 70 O2 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 70 N3 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 66 N1 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 66 N6 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 65 O4 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 O4 ? ? ? 1_555 A G 33 N2 ? ? A U 9 A G 33 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog18 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A A 10 N1 ? ? ? 1_555 A G 33 N2 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog21 hydrog ? ? A A 10 N6 ? ? ? 1_555 A G 33 N3 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog22 hydrog ? ? A A 11 N6 ? ? ? 1_555 A A 61 N1 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog23 hydrog ? ? A A 11 N7 ? ? ? 1_555 A A 61 N6 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog24 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 16 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A G 16 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog37 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 20 N1 ? ? ? 1_555 A A 53 N6 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A A 20 N6 ? ? ? 1_555 A A 53 N7 ? ? A A 20 A A 53 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog43 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 24 N2 ? ? A U 21 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog44 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 52 N1 ? ? A U 21 A A 52 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog45 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 25 N2 ? ? ? 1_555 A A 53 N1 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog52 hydrog ? ? A G 25 N3 ? ? ? 1_555 A A 53 N6 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog53 hydrog ? ? A U 34 N3 ? ? ? 1_555 A U 38 O4 ? ? A U 34 A U 38 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog54 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 66 N3 ? ? A U 36 A A 66 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog55 hydrog ? ? A C 37 N4 ? ? ? 1_555 A U 65 O2 ? ? A C 37 A U 65 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog56 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A A 41 N1 ? ? ? 1_555 A C 59 N4 ? ? A A 41 A C 59 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog60 hydrog ? ? A G 42 N1 ? ? ? 1_555 A C 58 N3 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 58 O2 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 42 O6 ? ? ? 1_555 A C 58 N4 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 57 N3 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 57 O2 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 57 N4 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A A 45 N1 ? ? ? 1_555 A U 55 N3 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A A 45 N6 ? ? ? 1_555 A U 55 O4 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 46 N1 ? ? ? 1_555 A U 54 N3 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 46 N6 ? ? ? 1_555 A U 54 O4 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 48 O2 ? ? ? 1_555 A A 52 N6 ? ? A C 48 A A 52 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 "O2'" ? A U 7 ? A U 7 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 "O4'" ? A A 8 ? A A 8 ? 1_555 84.0 ? 2 "O2'" ? A U 7 ? A U 7 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O4 ? A U 36 ? A U 36 ? 1_555 160.1 ? 3 "O4'" ? A A 8 ? A A 8 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O4 ? A U 36 ? A U 36 ? 1_555 88.9 ? 4 "O2'" ? A U 7 ? A U 7 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 211 ? 1_555 87.0 ? 5 "O4'" ? A A 8 ? A A 8 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 211 ? 1_555 143.2 ? 6 O4 ? A U 36 ? A U 36 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 211 ? 1_555 87.6 ? 7 "O2'" ? A U 7 ? A U 7 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 215 ? 8_545 99.0 ? 8 "O4'" ? A A 8 ? A A 8 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 215 ? 8_545 160.4 ? 9 O4 ? A U 36 ? A U 36 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 215 ? 8_545 93.9 ? 10 O ? E HOH . ? A HOH 211 ? 1_555 MG ? C MG . ? A MG 102 ? 1_555 O ? E HOH . ? A HOH 215 ? 8_545 56.4 ? 11 "O2'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 204 ? 1_555 95.7 ? 12 "O2'" ? A C 71 ? A C 71 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 215 ? 1_555 129.0 ? 13 O ? E HOH . ? A HOH 204 ? 1_555 MG ? D MG . ? A MG 103 ? 1_555 O ? E HOH . ? A HOH 215 ? 1_555 73.7 ? # _pdbx_entry_details.entry_id 9V4Z _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 "O3'" A C 71 ? ? MG A MG 103 ? ? 1.56 2 1 MG A MG 103 ? ? O A HOH 207 ? ? 1.69 3 1 O A HOH 216 ? ? O A HOH 219 ? ? 2.09 4 1 O A HOH 214 ? ? O A HOH 217 ? ? 2.13 5 1 O2 A U 23 ? ? O A HOH 201 ? ? 2.16 # loop_ _pdbx_validate_rmsd_angle.id _pdbx_validate_rmsd_angle.PDB_model_num _pdbx_validate_rmsd_angle.auth_atom_id_1 _pdbx_validate_rmsd_angle.auth_asym_id_1 _pdbx_validate_rmsd_angle.auth_comp_id_1 _pdbx_validate_rmsd_angle.auth_seq_id_1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 _pdbx_validate_rmsd_angle.label_alt_id_1 _pdbx_validate_rmsd_angle.auth_atom_id_2 _pdbx_validate_rmsd_angle.auth_asym_id_2 _pdbx_validate_rmsd_angle.auth_comp_id_2 _pdbx_validate_rmsd_angle.auth_seq_id_2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 _pdbx_validate_rmsd_angle.label_alt_id_2 _pdbx_validate_rmsd_angle.auth_atom_id_3 _pdbx_validate_rmsd_angle.auth_asym_id_3 _pdbx_validate_rmsd_angle.auth_comp_id_3 _pdbx_validate_rmsd_angle.auth_seq_id_3 _pdbx_validate_rmsd_angle.PDB_ins_code_3 _pdbx_validate_rmsd_angle.label_alt_id_3 _pdbx_validate_rmsd_angle.angle_value _pdbx_validate_rmsd_angle.angle_target_value _pdbx_validate_rmsd_angle.angle_deviation _pdbx_validate_rmsd_angle.angle_standard_deviation _pdbx_validate_rmsd_angle.linker_flag 1 1 "O3'" A GTP 1 ? ? P A G 2 ? ? OP2 A G 2 ? ? 121.50 110.50 11.00 1.10 Y 2 1 N3 A U 22 ? ? C2 A U 22 ? ? O2 A U 22 ? ? 117.59 122.20 -4.61 0.70 N 3 1 "C3'" A A 35 ? ? "O3'" A A 35 ? ? P A U 36 ? ? 127.41 119.70 7.71 1.20 Y # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -7.0734 _pdbx_refine_tls.origin_y -8.6812 _pdbx_refine_tls.origin_z -26.3015 _pdbx_refine_tls.T[1][1] 0.4477 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0108 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0955 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.6003 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.0557 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.4167 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 2.3009 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.2799 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.8747 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 1.3181 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.6303 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 5.8221 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.1916 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.6223 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.0863 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] -0.4276 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.0747 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.1185 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.3869 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.0414 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] 0.0742 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 MG MG MG N N 162 OXG N9 N N N 163 OXG C8 C N N 164 OXG N7 N N N 165 OXG C5 C N N 166 OXG C6 C N N 167 OXG O6 O N N 168 OXG N1 N N N 169 OXG C2 C N N 170 OXG N2 N N N 171 OXG N3 N N N 172 OXG C4 C N N 173 OXG O8 O N N 174 OXG H1 H N N 175 OXG H21 H N N 176 OXG H22 H N N 177 U OP3 O N N 178 U P P N N 179 U OP1 O N N 180 U OP2 O N N 181 U "O5'" O N N 182 U "C5'" C N N 183 U "C4'" C N R 184 U "O4'" O N N 185 U "C3'" C N S 186 U "O3'" O N N 187 U "C2'" C N R 188 U "O2'" O N N 189 U "C1'" C N R 190 U N1 N N N 191 U C2 C N N 192 U O2 O N N 193 U N3 N N N 194 U C4 C N N 195 U O4 O N N 196 U C5 C N N 197 U C6 C N N 198 U HOP3 H N N 199 U HOP2 H N N 200 U "H5'" H N N 201 U "H5''" H N N 202 U "H4'" H N N 203 U "H3'" H N N 204 U "HO3'" H N N 205 U "H2'" H N N 206 U "HO2'" H N N 207 U "H1'" H N N 208 U H3 H N N 209 U H5 H N N 210 U H6 H N N 211 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 OXG N9 C8 sing N N 168 OXG N9 C4 doub N N 169 OXG C8 N7 sing N N 170 OXG C8 O8 doub N N 171 OXG N7 C5 doub N N 172 OXG C5 C6 sing N N 173 OXG C5 C4 sing N N 174 OXG C6 O6 doub N N 175 OXG C6 N1 sing N N 176 OXG N1 C2 sing N N 177 OXG N1 H1 sing N N 178 OXG C2 N2 sing N N 179 OXG C2 N3 doub N N 180 OXG N2 H21 sing N N 181 OXG N2 H22 sing N N 182 OXG N3 C4 sing N N 183 U OP3 P sing N N 184 U OP3 HOP3 sing N N 185 U P OP1 doub N N 186 U P OP2 sing N N 187 U P "O5'" sing N N 188 U OP2 HOP2 sing N N 189 U "O5'" "C5'" sing N N 190 U "C5'" "C4'" sing N N 191 U "C5'" "H5'" sing N N 192 U "C5'" "H5''" sing N N 193 U "C4'" "O4'" sing N N 194 U "C4'" "C3'" sing N N 195 U "C4'" "H4'" sing N N 196 U "O4'" "C1'" sing N N 197 U "C3'" "O3'" sing N N 198 U "C3'" "C2'" sing N N 199 U "C3'" "H3'" sing N N 200 U "O3'" "HO3'" sing N N 201 U "C2'" "O2'" sing N N 202 U "C2'" "C1'" sing N N 203 U "C2'" "H2'" sing N N 204 U "O2'" "HO2'" sing N N 205 U "C1'" N1 sing N N 206 U "C1'" "H1'" sing N N 207 U N1 C2 sing N N 208 U N1 C6 sing N N 209 U C2 O2 doub N N 210 U C2 N3 sing N N 211 U N3 C4 sing N N 212 U N3 H3 sing N N 213 U C4 O4 doub N N 214 U C4 C5 sing N N 215 U C5 C6 doub N N 216 U C5 H5 sing N N 217 U C6 H6 sing N N 218 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9V4Z 'double helix' 9V4Z 'a-form double helix' 9V4Z 'hairpin loop' 9V4Z 'mismatched base pair' 9V4Z 'internal loop' 9V4Z 'triple helix' 9V4Z 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A C 71 1_555 0.735 -0.157 -0.199 -2.804 -11.248 -2.392 1 A_G2:C71_A A 2 ? A 71 ? 19 1 1 A G 3 1_555 A U 70 1_555 -2.230 -0.749 0.366 -1.519 -10.896 4.099 2 A_G3:U70_A A 3 ? A 70 ? 28 1 1 A U 4 1_555 A A 69 1_555 0.028 0.008 0.473 0.497 -11.954 6.435 3 A_U4:A69_A A 4 ? A 69 ? 20 1 1 A U 5 1_555 A A 68 1_555 -0.054 -0.234 -0.183 -0.600 -12.596 3.661 4 A_U5:A68_A A 5 ? A 68 ? 20 1 1 A G 6 1_555 A C 67 1_555 0.120 -0.487 -0.041 -8.145 -11.500 -0.611 5 A_G6:C67_A A 6 ? A 67 ? 19 1 1 A U 7 1_555 A A 66 1_555 0.327 -0.246 0.458 -8.749 -7.716 6.384 6 A_U7:A66_A A 7 ? A 66 ? 20 1 1 A A 8 1_555 A U 65 1_555 0.170 -0.077 0.253 3.798 -8.717 -0.571 7 A_A8:U65_A A 8 ? A 65 ? 20 1 1 A U 38 1_555 A U 34 1_555 -3.282 -0.831 1.310 -35.135 52.205 -71.478 8 A_U38:U34_A A 38 ? A 34 ? ? ? 1 A U 9 1_555 A A 39 1_555 -0.050 -0.347 -0.704 21.196 -4.294 -0.303 9 A_U9:A39_A A 9 ? A 39 ? 20 1 1 A A 10 1_555 A G 33 1_555 -3.587 3.858 0.463 0.620 -0.450 64.767 10 A_A10:G33_A A 10 ? A 33 ? 10 6 1 A G 12 1_555 A C 32 1_555 -0.429 0.318 0.321 8.120 -5.812 11.371 11 A_G12:C32_A A 12 ? A 32 ? 19 1 1 A C 13 1_555 A G 31 1_555 0.756 0.016 -0.466 0.158 -6.080 9.244 12 A_C13:G31_A A 13 ? A 31 ? 19 1 1 A U 14 1_555 A A 30 1_555 -0.463 0.191 0.089 -2.386 4.401 1.232 13 A_U14:A30_A A 14 ? A 30 ? 20 1 1 A C 15 1_555 A G 29 1_555 0.282 0.093 -0.368 2.675 -2.394 0.291 14 A_C15:G29_A A 15 ? A 29 ? 19 1 1 A G 16 1_555 A U 28 1_555 -1.633 -0.668 -0.143 -1.957 -4.311 -2.176 15 A_G16:U28_A A 16 ? A 28 ? 28 1 1 A U 17 1_555 A A 27 1_555 -0.509 -0.206 -0.543 5.966 -2.157 2.560 16 A_U17:A27_A A 17 ? A 27 ? 20 1 1 A U 18 1_555 A A 26 1_555 0.246 -0.237 -0.305 17.615 0.971 4.881 17 A_U18:A26_A A 18 ? A 26 ? 20 1 1 A C 47 1_555 A G 25 1_555 0.045 -0.216 0.164 -18.460 -3.521 3.367 18 A_C47:G25_A A 47 ? A 25 ? 19 1 1 A A 20 1_555 A A 53 1_555 4.050 1.955 -0.090 -13.454 -1.601 -113.783 19 A_A20:A53_A A 20 ? A 53 ? 5 4 1 A U 21 1_555 A A 52 1_555 0.320 1.919 -0.270 -3.046 -2.896 165.535 20 A_U21:A52_A A 21 ? A 52 ? ? 2 1 A G 24 1_555 A C 48 1_555 -0.858 -0.603 0.278 1.201 -8.984 2.873 21 A_G24:C48_A A 24 ? A 48 ? 19 1 1 A C 40 1_555 A G 62 1_555 -0.372 -0.209 0.797 -7.913 -0.206 7.457 22 A_C40:G62_A A 40 ? A 62 ? 19 1 1 A A 11 1_555 A A 61 1_555 -4.369 1.280 -0.978 5.680 -16.513 -116.956 23 A_A11:A61_A A 11 ? A 61 ? 5 4 1 A A 41 1_555 A C 59 1_555 4.227 0.967 -0.278 -10.039 -6.351 -102.574 24 A_A41:C59_A A 41 ? A 59 ? ? 4 1 A G 42 1_555 A C 58 1_555 -0.311 -0.023 0.966 3.102 -7.429 1.358 25 A_G42:C58_A A 42 ? A 58 ? 19 1 1 A G 43 1_555 A C 57 1_555 -0.637 -0.014 0.615 10.436 -14.642 5.200 26 A_G43:C57_A A 43 ? A 57 ? 19 1 1 A C 44 1_555 A G 56 1_555 -0.026 -0.204 0.031 12.231 -12.296 4.742 27 A_C44:G56_A A 44 ? A 56 ? 19 1 1 A A 45 1_555 A U 55 1_555 -0.536 -0.055 -0.133 6.267 -3.638 9.216 28 A_A45:U55_A A 45 ? A 55 ? 20 1 1 A A 46 1_555 A U 54 1_555 -0.283 0.222 -0.390 -3.523 2.242 9.051 29 A_A46:U54_A A 46 ? A 54 ? 20 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A C 71 1_555 A G 3 1_555 A U 70 1_555 0.446 -1.979 2.815 -11.433 13.229 20.071 -6.617 -2.966 0.970 31.345 27.089 26.560 1 AA_G2G3:U70C71_AA A 2 ? A 71 ? A 3 ? A 70 ? 1 A G 3 1_555 A U 70 1_555 A U 4 1_555 A A 69 1_555 -0.180 -1.272 3.072 -3.193 4.298 40.895 -2.234 -0.061 2.934 6.119 4.547 41.229 2 AA_G3U4:A69U70_AA A 3 ? A 70 ? A 4 ? A 69 ? 1 A U 4 1_555 A A 69 1_555 A U 5 1_555 A A 68 1_555 -0.121 -1.767 3.136 3.540 4.634 30.871 -4.063 0.832 2.816 8.609 -6.576 31.404 3 AA_U4U5:A68A69_AA A 4 ? A 69 ? A 5 ? A 68 ? 1 A U 5 1_555 A A 68 1_555 A G 6 1_555 A C 67 1_555 -0.374 -1.506 3.432 -1.364 10.803 33.964 -4.008 0.417 2.848 17.931 2.264 35.618 4 AA_U5G6:C67A68_AA A 5 ? A 68 ? A 6 ? A 67 ? 1 A G 6 1_555 A C 67 1_555 A U 7 1_555 A A 66 1_555 0.583 -1.417 3.192 -3.115 8.320 33.091 -3.610 -1.441 2.702 14.290 5.351 34.231 5 AA_G6U7:A66C67_AA A 6 ? A 67 ? A 7 ? A 66 ? 1 A U 7 1_555 A A 66 1_555 A A 8 1_555 A U 65 1_555 0.122 -1.605 2.805 6.314 10.974 29.540 -4.440 0.663 2.075 20.383 -11.728 32.083 6 AA_U7A8:U65A66_AA A 7 ? A 66 ? A 8 ? A 65 ? 1 A A 8 1_555 A U 65 1_555 A U 38 1_555 A U 34 1_555 -1.796 6.390 2.061 20.105 1.638 158.563 3.247 0.948 2.018 0.833 -10.227 158.898 7 AA_A8U38:U34U65_AA A 8 ? A 65 ? A 38 ? A 34 ? 1 A U 38 1_555 A U 34 1_555 A U 9 1_555 A A 39 1_555 -1.135 -3.485 0.084 -148.154 -3.240 176.551 -1.742 0.566 0.119 -1.620 74.084 179.055 8 AA_U38U9:A39U34_AA A 38 ? A 34 ? A 9 ? A 39 ? 1 A U 9 1_555 A A 39 1_555 A A 10 1_555 A G 33 1_555 1.164 1.212 -2.490 -12.632 -1.272 -9.576 -4.920 9.530 -0.483 5.321 -52.854 -15.891 9 AA_U9A10:G33A39_AA A 9 ? A 39 ? A 10 ? A 33 ? 1 A A 10 1_555 A G 33 1_555 A G 12 1_555 A C 32 1_555 -2.595 -1.952 -1.302 124.048 -120.190 -33.015 0.669 -1.619 0.114 61.906 63.893 -173.024 10 AA_A10G12:C32G33_AA A 10 ? A 33 ? A 12 ? A 32 ? 1 A G 12 1_555 A C 32 1_555 A C 13 1_555 A G 31 1_555 -0.250 -2.041 3.347 5.355 1.429 40.256 -3.100 0.961 3.217 2.065 -7.737 40.620 11 AA_G12C13:G31C32_AA A 12 ? A 32 ? A 13 ? A 31 ? 1 A C 13 1_555 A G 31 1_555 A U 14 1_555 A A 30 1_555 -0.935 -1.661 3.287 -3.514 9.128 23.705 -6.161 1.180 2.588 21.106 8.125 25.618 12 AA_C13U14:A30G31_AA A 13 ? A 31 ? A 14 ? A 30 ? 1 A U 14 1_555 A A 30 1_555 A C 15 1_555 A G 29 1_555 0.022 -1.620 3.024 4.229 4.729 31.988 -3.620 0.617 2.743 8.478 -7.580 32.595 13 AA_U14C15:G29A30_AA A 14 ? A 30 ? A 15 ? A 29 ? 1 A C 15 1_555 A G 29 1_555 A G 16 1_555 A U 28 1_555 0.841 -2.126 3.272 -2.129 9.178 24.027 -7.005 -2.406 2.239 21.041 4.882 25.783 14 AA_C15G16:U28G29_AA A 15 ? A 29 ? A 16 ? A 28 ? 1 A G 16 1_555 A U 28 1_555 A U 17 1_555 A A 27 1_555 0.137 -1.672 3.248 3.473 0.626 34.062 -2.938 0.309 3.215 1.066 -5.910 34.239 15 AA_G16U17:A27U28_AA A 16 ? A 28 ? A 17 ? A 27 ? 1 A U 17 1_555 A A 27 1_555 A U 18 1_555 A A 26 1_555 0.368 -1.604 3.122 -2.769 6.779 28.572 -4.446 -1.251 2.633 13.459 5.497 29.476 16 AA_U17U18:A26A27_AA A 17 ? A 27 ? A 18 ? A 26 ? 1 A C 47 1_555 A G 25 1_555 A A 20 1_555 A A 53 1_555 0.428 -6.855 0.627 -0.302 -17.778 -125.955 3.851 0.239 0.087 9.958 -0.169 -126.656 17 AA_C47A20:A53G25_AA A 47 ? A 25 ? A 20 ? A 53 ? 1 A A 20 1_555 A A 53 1_555 A U 21 1_555 A A 52 1_555 1.187 1.247 3.374 -2.256 10.822 -96.210 -1.022 0.755 3.277 -7.251 -1.512 -96.687 18 AA_A20U21:A52A53_AA A 20 ? A 53 ? A 21 ? A 52 ? 1 A C 40 1_555 A G 62 1_555 A A 11 1_555 A A 61 1_555 -1.149 -1.148 2.933 10.521 9.765 -23.942 -0.037 0.222 3.351 -21.267 22.913 -27.862 19 AA_C40A11:A61G62_AA A 40 ? A 62 ? A 11 ? A 61 ? 1 A A 11 1_555 A A 61 1_555 A A 41 1_555 A C 59 1_555 -1.188 -2.479 3.650 -6.434 0.468 89.044 -1.776 0.696 3.701 0.333 4.583 89.228 20 AA_A11A41:C59A61_AA A 11 ? A 61 ? A 41 ? A 59 ? 1 A A 41 1_555 A C 59 1_555 A G 42 1_555 A C 58 1_555 1.292 0.179 2.956 -11.661 0.017 -23.696 -0.397 -0.276 3.224 -0.039 -26.443 -26.373 21 AA_A41G42:C58C59_AA A 41 ? A 59 ? A 42 ? A 58 ? 1 A G 42 1_555 A C 58 1_555 A G 43 1_555 A C 57 1_555 -0.165 -1.309 2.997 1.072 1.077 33.631 -2.419 0.444 2.949 1.860 -1.852 33.665 22 AA_G42G43:C57C58_AA A 42 ? A 58 ? A 43 ? A 57 ? 1 A G 43 1_555 A C 57 1_555 A C 44 1_555 A G 56 1_555 0.182 -1.063 3.066 2.152 7.064 33.259 -2.836 0.001 2.794 12.155 -3.704 34.046 23 AA_G43C44:G56C57_AA A 43 ? A 57 ? A 44 ? A 56 ? 1 A C 44 1_555 A G 56 1_555 A A 45 1_555 A U 55 1_555 0.388 -1.510 3.306 -0.302 8.906 29.233 -4.539 -0.794 2.733 17.150 0.581 30.533 24 AA_C44A45:U55G56_AA A 44 ? A 56 ? A 45 ? A 55 ? 1 A A 45 1_555 A U 55 1_555 A A 46 1_555 A U 54 1_555 0.259 -2.105 3.665 -2.515 0.668 34.522 -3.652 -0.866 3.598 1.123 4.231 34.617 25 AA_A45A46:U54U55_AA A 45 ? A 55 ? A 46 ? A 54 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9LJN _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9V4Z _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.026441 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019838 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004550 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #