data_9V51 # _entry.id 9V51 # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.407 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9V51 pdb_00009v51 10.2210/pdb9v51/pdb WWPDB D_1300059812 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2025-11-26 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9V51 _pdbx_database_status.recvd_initial_deposition_date 2025-05-24 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Aiming _pdbx_contact_author.name_last Ren _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Li, H.C.' 1 0009-0002-2998-6881 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country UK _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'Nucleic Acids Res.' _citation.journal_id_ASTM NARHAD _citation.journal_id_CSD 0389 _citation.journal_id_ISSN 1362-4962 _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume 53 _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Ligand specificity and adaptability revealed by the first Guanine-II riboswitch tertiary structure.' _citation.year 2025 _citation.database_id_CSD ? _citation.pdbx_database_id_DOI 10.1093/nar/gkaf884 _citation.pdbx_database_id_PubMed 40966503 _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Li, H.' 1 ? primary 'Shen, X.' 2 ? primary 'Xu, X.' 3 ? primary 'Tai, X.' 4 ? primary 'He, M.' 5 ? primary 'Zhang, J.' 6 ? primary 'Ren, A.' 7 0000-0002-5420-4899 # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (71-MER)' 23024.453 1 ? ? ? ? 2 non-polymer syn 5,6,7,8-TETRAHYDROBIOPTERIN 241.247 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 2 ? ? ? ? 4 water nat water 18.015 19 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAU(CCC)' _entity_poly.pdbx_seq_one_letter_code_can GGGUUGUAUAAGCUCGUUAAUUUGGAAUGAGCGUAUCUACAGGCAACCGUAAAUUGCCCCAGGCUACAAUC _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 5,6,7,8-TETRAHYDROBIOPTERIN H4B 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 G n 1 4 U n 1 5 U n 1 6 G n 1 7 U n 1 8 A n 1 9 U n 1 10 A n 1 11 A n 1 12 G n 1 13 C n 1 14 U n 1 15 C n 1 16 G n 1 17 U n 1 18 U n 1 19 A n 1 20 A n 1 21 U n 1 22 U n 1 23 U n 1 24 G n 1 25 G n 1 26 A n 1 27 A n 1 28 U n 1 29 G n 1 30 A n 1 31 G n 1 32 C n 1 33 G n 1 34 U n 1 35 A n 1 36 U n 1 37 C n 1 38 U n 1 39 A n 1 40 C n 1 41 A n 1 42 G n 1 43 G n 1 44 C n 1 45 A n 1 46 A n 1 47 C n 1 48 C n 1 49 G n 1 50 U n 1 51 A n 1 52 A n 1 53 A n 1 54 U n 1 55 U n 1 56 G n 1 57 C n 1 58 C n 1 59 C n 1 60 C n 1 61 A n 1 62 G n 1 63 G n 1 64 C n 1 65 U n 1 66 A n 1 67 C n 1 68 A n 1 69 A n 1 70 U n 1 71 CCC n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 71 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'Staphylococcus aureus' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 1280 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 CCC 'RNA linking' n ;CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE ; ? 'C9 H13 N3 O10 P2' 385.161 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 H4B non-polymer . 5,6,7,8-TETRAHYDROBIOPTERIN ? 'C9 H15 N5 O3' 241.247 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP A . n A 1 2 G 2 2 2 G G A . n A 1 3 G 3 3 3 G G A . n A 1 4 U 4 4 4 U U A . n A 1 5 U 5 5 5 U U A . n A 1 6 G 6 6 6 G G A . n A 1 7 U 7 7 7 U U A . n A 1 8 A 8 8 8 A A A . n A 1 9 U 9 9 9 U U A . n A 1 10 A 10 10 10 A A A . n A 1 11 A 11 11 11 A A A . n A 1 12 G 12 12 12 G G A . n A 1 13 C 13 13 13 C C A . n A 1 14 U 14 14 14 U U A . n A 1 15 C 15 15 15 C C A . n A 1 16 G 16 16 16 G G A . n A 1 17 U 17 17 17 U U A . n A 1 18 U 18 18 18 U U A . n A 1 19 A 19 19 19 A A A . n A 1 20 A 20 20 20 A A A . n A 1 21 U 21 21 21 U U A . n A 1 22 U 22 22 22 U U A . n A 1 23 U 23 23 23 U U A . n A 1 24 G 24 24 24 G G A . n A 1 25 G 25 25 25 G G A . n A 1 26 A 26 26 26 A A A . n A 1 27 A 27 27 27 A A A . n A 1 28 U 28 28 28 U U A . n A 1 29 G 29 29 29 G G A . n A 1 30 A 30 30 30 A A A . n A 1 31 G 31 31 31 G G A . n A 1 32 C 32 32 32 C C A . n A 1 33 G 33 33 33 G G A . n A 1 34 U 34 34 34 U U A . n A 1 35 A 35 35 35 A A A . n A 1 36 U 36 36 36 U U A . n A 1 37 C 37 37 37 C C A . n A 1 38 U 38 38 38 U U A . n A 1 39 A 39 39 39 A A A . n A 1 40 C 40 40 40 C C A . n A 1 41 A 41 41 41 A A A . n A 1 42 G 42 42 42 G G A . n A 1 43 G 43 43 43 G G A . n A 1 44 C 44 44 44 C C A . n A 1 45 A 45 45 45 A A A . n A 1 46 A 46 46 46 A A A . n A 1 47 C 47 47 47 C C A . n A 1 48 C 48 48 48 C C A . n A 1 49 G 49 49 49 G G A . n A 1 50 U 50 50 50 U U A . n A 1 51 A 51 51 51 A A A . n A 1 52 A 52 52 52 A A A . n A 1 53 A 53 53 53 A A A . n A 1 54 U 54 54 54 U U A . n A 1 55 U 55 55 55 U U A . n A 1 56 G 56 56 56 G G A . n A 1 57 C 57 57 57 C C A . n A 1 58 C 58 58 58 C C A . n A 1 59 C 59 59 59 C C A . n A 1 60 C 60 60 60 C C A . n A 1 61 A 61 61 61 A A A . n A 1 62 G 62 62 62 G G A . n A 1 63 G 63 63 63 G G A . n A 1 64 C 64 64 64 C C A . n A 1 65 U 65 65 65 U U A . n A 1 66 A 66 66 66 A A A . n A 1 67 C 67 67 67 C C A . n A 1 68 A 68 68 68 A A A . n A 1 69 A 69 69 69 A A A . n A 1 70 U 70 70 70 U U A . n A 1 71 CCC 71 71 71 CCC CCC A . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id H4B _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id H4B _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 H4B 1 101 101 H4B H4B A . C 3 MG 1 102 1 MG MG A . D 3 MG 1 103 3 MG MG A . E 4 HOH 1 201 14 HOH HOH A . E 4 HOH 2 202 19 HOH HOH A . E 4 HOH 3 203 15 HOH HOH A . E 4 HOH 4 204 43 HOH HOH A . E 4 HOH 5 205 42 HOH HOH A . E 4 HOH 6 206 21 HOH HOH A . E 4 HOH 7 207 25 HOH HOH A . E 4 HOH 8 208 33 HOH HOH A . E 4 HOH 9 209 18 HOH HOH A . E 4 HOH 10 210 20 HOH HOH A . E 4 HOH 11 211 17 HOH HOH A . E 4 HOH 12 212 32 HOH HOH A . E 4 HOH 13 213 27 HOH HOH A . E 4 HOH 14 214 31 HOH HOH A . E 4 HOH 15 215 2 HOH HOH A . E 4 HOH 16 216 35 HOH HOH A . E 4 HOH 17 217 24 HOH HOH A . E 4 HOH 18 218 12 HOH HOH A . E 4 HOH 19 219 39 HOH HOH A . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? Aimless ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? autoPROC ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 90.00 _cell.angle_gamma_esd ? _cell.entry_id 9V51 _cell.details ? _cell.formula_units_Z ? _cell.length_a 37.780 _cell.length_a_esd ? _cell.length_b 50.808 _cell.length_b_esd ? _cell.length_c 217.816 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 8 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9V51 _symmetry.cell_setting ? _symmetry.Int_Tables_number 20 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'C 2 2 21' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9V51 _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.28 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 45.96 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;0.08 M sodium chloride, 0.04 M sodium cacodylate trihydrate (pH 7.0), 30% v/v (+/-)-2-methyl-2,4-pentanediol, and 0.012 M spermine tetrahydrochloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2024-04-23 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 1.10213 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL19U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 1.10213 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL19U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9V51 _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 3.23 _reflns.d_resolution_low 217.82 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 3531 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 96.2 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 10.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 6.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.992 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs 0.365 _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 3.23 _reflns_shell.d_res_low 3.43 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 568 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.915 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9V51 _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 3.23 _refine.ls_d_res_low 54.45 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 3484 _refine.ls_number_reflns_R_free 348 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 95.87 _refine.ls_percent_reflns_R_free 9.99 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2436 _refine.ls_R_factor_R_free 0.2933 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2382 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.34 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.44 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.37 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.details ? _refine_hist.d_res_high 3.23 _refine_hist.d_res_low 54.45 _refine_hist.number_atoms_solvent 19 _refine_hist.number_atoms_total 1561 _refine_hist.number_reflns_all ? _refine_hist.number_reflns_obs ? _refine_hist.number_reflns_R_free ? _refine_hist.number_reflns_R_work ? _refine_hist.R_factor_all ? _refine_hist.R_factor_obs ? _refine_hist.R_factor_R_free ? _refine_hist.R_factor_R_work ? _refine_hist.pdbx_number_residues_total ? _refine_hist.pdbx_B_iso_mean_ligand ? _refine_hist.pdbx_B_iso_mean_solvent ? _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1540 _refine_hist.pdbx_number_atoms_ligand 2 _refine_hist.pdbx_number_atoms_lipid ? _refine_hist.pdbx_number_atoms_carb ? _refine_hist.pdbx_pseudo_atom_details ? # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.002 ? 1719 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.778 ? 2675 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 23.753 ? 858 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.036 ? 356 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.004 ? 72 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 3.23 4.07 . . 162 1461 92.00 . . . . 0.2647 . . . . . . . . . . . . . . . 0.2854 'X-RAY DIFFRACTION' 4.07 54.45 . . 186 1675 100.00 . . . . 0.2246 . . . . . . . . . . . . . . . 0.2979 # _struct.entry_id 9V51 _struct.title 'Crystal structure of Guanine-II riboswitch in complex with tetrahydrobiopterin' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9V51 _struct_keywords.text 'guanine riboswitch, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 3 ? E N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9V51 _struct_ref.pdbx_db_accession 9V51 _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9V51 _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 71 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9V51 _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 71 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 71 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? A GTP 1 A G 2 1_555 ? ? ? ? ? ? ? 1.558 ? ? covale2 covale both ? A U 70 "O3'" ? ? ? 1_555 A CCC 71 P ? ? A U 70 A CCC 71 1_555 ? ? ? ? ? ? ? 1.606 ? ? metalc1 metalc ? ? A G 2 "O2'" ? ? ? 1_555 D MG . MG ? ? A G 2 A MG 103 5_445 ? ? ? ? ? ? ? 2.535 ? ? metalc2 metalc ? ? A A 35 N7 ? ? ? 1_555 D MG . MG ? ? A A 35 A MG 103 1_555 ? ? ? ? ? ? ? 2.241 ? ? hydrog1 hydrog ? ? A G 2 N1 ? ? ? 1_555 A CCC 71 N3 ? ? A G 2 A CCC 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 2 N2 ? ? ? 1_555 A CCC 71 O2 ? ? A G 2 A CCC 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 2 O6 ? ? ? 1_555 A CCC 71 N4 ? ? A G 2 A CCC 71 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 3 N1 ? ? ? 1_555 A U 70 O2 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog5 hydrog ? ? A G 3 O6 ? ? ? 1_555 A U 70 N3 ? ? A G 3 A U 70 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog6 hydrog ? ? A U 4 N3 ? ? ? 1_555 A A 69 N1 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A U 4 O4 ? ? ? 1_555 A A 69 N6 ? ? A U 4 A A 69 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A U 5 N3 ? ? ? 1_555 A A 68 N1 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A U 5 O4 ? ? ? 1_555 A A 68 N6 ? ? A U 5 A A 68 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 6 N1 ? ? ? 1_555 A C 67 N3 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 6 N2 ? ? ? 1_555 A C 67 O2 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A G 6 O6 ? ? ? 1_555 A C 67 N4 ? ? A G 6 A C 67 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 66 N1 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 66 N6 ? ? A U 7 A A 66 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 8 N1 ? ? ? 1_555 A U 65 N3 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A A 8 N6 ? ? ? 1_555 A U 65 O4 ? ? A A 8 A U 65 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 9 N3 ? ? ? 1_555 A A 39 N1 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 9 O4 ? ? ? 1_555 A A 39 N6 ? ? A U 9 A A 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A A 10 N1 ? ? ? 1_555 A G 33 N2 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog20 hydrog ? ? A A 10 N6 ? ? ? 1_555 A G 33 N3 ? ? A A 10 A G 33 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog21 hydrog ? ? A A 11 N6 ? ? ? 1_555 A A 61 N1 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog22 hydrog ? ? A A 11 N7 ? ? ? 1_555 A A 61 N6 ? ? A A 11 A A 61 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog23 hydrog ? ? A G 12 N1 ? ? ? 1_555 A C 32 N3 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 12 N2 ? ? ? 1_555 A C 32 O2 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 12 O6 ? ? ? 1_555 A C 32 N4 ? ? A G 12 A C 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 31 N1 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 31 O6 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 31 N2 ? ? A C 13 A G 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 30 N1 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 30 N6 ? ? A U 14 A A 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 29 N1 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 29 O6 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 29 N2 ? ? A C 15 A G 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 16 N1 ? ? ? 1_555 A U 28 O2 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog35 hydrog ? ? A G 16 O6 ? ? ? 1_555 A U 28 N3 ? ? A G 16 A U 28 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog36 hydrog ? ? A U 17 N3 ? ? ? 1_555 A A 27 N1 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 17 O4 ? ? ? 1_555 A A 27 N6 ? ? A U 17 A A 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A U 18 N3 ? ? ? 1_555 A A 26 N1 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A U 18 O4 ? ? ? 1_555 A A 26 N6 ? ? A U 18 A A 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 21 O2 ? ? ? 1_555 A G 24 N2 ? ? A U 21 A G 24 1_555 ? ? ? ? ? ? 'U-G MISPAIR' ? ? ? hydrog41 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 52 N1 ? ? A U 21 A A 52 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog42 hydrog ? ? A G 24 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 24 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 24 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 24 A C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 25 N1 ? ? ? 1_555 A C 47 N3 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 25 N2 ? ? ? 1_555 A C 47 O2 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 25 O6 ? ? ? 1_555 A C 47 N4 ? ? A G 25 A C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 25 N2 ? ? ? 1_555 A A 53 N1 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog49 hydrog ? ? A G 25 N3 ? ? ? 1_555 A A 53 N6 ? ? A G 25 A A 53 1_555 ? ? ? ? ? ? TYPE_10_PAIR ? ? ? hydrog50 hydrog ? ? A U 34 N3 ? ? ? 1_555 A U 38 O4 ? ? A U 34 A U 38 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog51 hydrog ? ? A U 36 N3 ? ? ? 1_555 A A 66 N3 ? ? A U 36 A A 66 1_555 ? ? ? ? ? ? 'U-A PAIR' ? ? ? hydrog52 hydrog ? ? A C 37 N4 ? ? ? 1_555 A U 65 O2 ? ? A C 37 A U 65 1_555 ? ? ? ? ? ? 'C-U MISPAIR' ? ? ? hydrog53 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 62 N1 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 62 O6 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 62 N2 ? ? A C 40 A G 62 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A A 41 N1 ? ? ? 1_555 A C 59 N4 ? ? A A 41 A C 59 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog57 hydrog ? ? A G 42 N2 ? ? ? 1_555 A C 58 O2 ? ? A G 42 A C 58 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog58 hydrog ? ? A G 43 N1 ? ? ? 1_555 A C 57 N3 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 43 N2 ? ? ? 1_555 A C 57 O2 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 43 O6 ? ? ? 1_555 A C 57 N4 ? ? A G 43 A C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 44 N3 ? ? ? 1_555 A G 56 N1 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A C 44 N4 ? ? ? 1_555 A G 56 O6 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A C 44 O2 ? ? ? 1_555 A G 56 N2 ? ? A C 44 A G 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A A 45 N1 ? ? ? 1_555 A U 55 N3 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A A 45 N6 ? ? ? 1_555 A U 55 O4 ? ? A A 45 A U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A A 46 N1 ? ? ? 1_555 A U 54 N3 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog67 hydrog ? ? A A 46 N6 ? ? ? 1_555 A U 54 O4 ? ? A A 46 A U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog68 hydrog ? ? A C 48 O2 ? ? ? 1_555 A A 53 N6 ? ? A C 48 A A 53 1_555 ? ? ? ? ? ? 'C-A MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # _pdbx_struct_conn_angle.id 1 _pdbx_struct_conn_angle.ptnr1_label_atom_id "O2'" _pdbx_struct_conn_angle.ptnr1_label_alt_id ? _pdbx_struct_conn_angle.ptnr1_label_asym_id A _pdbx_struct_conn_angle.ptnr1_label_comp_id G _pdbx_struct_conn_angle.ptnr1_label_seq_id 2 _pdbx_struct_conn_angle.ptnr1_auth_atom_id ? _pdbx_struct_conn_angle.ptnr1_auth_asym_id A _pdbx_struct_conn_angle.ptnr1_auth_comp_id G _pdbx_struct_conn_angle.ptnr1_auth_seq_id 2 _pdbx_struct_conn_angle.ptnr1_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr1_symmetry 1_555 _pdbx_struct_conn_angle.ptnr2_label_atom_id MG _pdbx_struct_conn_angle.ptnr2_label_alt_id ? _pdbx_struct_conn_angle.ptnr2_label_asym_id D _pdbx_struct_conn_angle.ptnr2_label_comp_id MG _pdbx_struct_conn_angle.ptnr2_label_seq_id . _pdbx_struct_conn_angle.ptnr2_auth_atom_id ? _pdbx_struct_conn_angle.ptnr2_auth_asym_id A _pdbx_struct_conn_angle.ptnr2_auth_comp_id MG _pdbx_struct_conn_angle.ptnr2_auth_seq_id 103 _pdbx_struct_conn_angle.ptnr2_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr2_symmetry 5_445 _pdbx_struct_conn_angle.ptnr3_label_atom_id N7 _pdbx_struct_conn_angle.ptnr3_label_alt_id ? _pdbx_struct_conn_angle.ptnr3_label_asym_id A _pdbx_struct_conn_angle.ptnr3_label_comp_id A _pdbx_struct_conn_angle.ptnr3_label_seq_id 35 _pdbx_struct_conn_angle.ptnr3_auth_atom_id ? _pdbx_struct_conn_angle.ptnr3_auth_asym_id A _pdbx_struct_conn_angle.ptnr3_auth_comp_id A _pdbx_struct_conn_angle.ptnr3_auth_seq_id 35 _pdbx_struct_conn_angle.ptnr3_PDB_ins_code ? _pdbx_struct_conn_angle.ptnr3_symmetry 1_555 _pdbx_struct_conn_angle.value 40.6 _pdbx_struct_conn_angle.value_esd ? # _pdbx_entry_details.entry_id 9V51 _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O3'" _pdbx_validate_rmsd_angle.auth_asym_id_1 A _pdbx_validate_rmsd_angle.auth_comp_id_1 U _pdbx_validate_rmsd_angle.auth_seq_id_1 70 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 P _pdbx_validate_rmsd_angle.auth_asym_id_2 A _pdbx_validate_rmsd_angle.auth_comp_id_2 CCC _pdbx_validate_rmsd_angle.auth_seq_id_2 71 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 OP1 _pdbx_validate_rmsd_angle.auth_asym_id_3 A _pdbx_validate_rmsd_angle.auth_comp_id_3 CCC _pdbx_validate_rmsd_angle.auth_seq_id_3 71 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 91.87 _pdbx_validate_rmsd_angle.angle_target_value 105.20 _pdbx_validate_rmsd_angle.angle_deviation -13.33 _pdbx_validate_rmsd_angle.angle_standard_deviation 2.20 _pdbx_validate_rmsd_angle.linker_flag Y # _pdbx_struct_special_symmetry.id 1 _pdbx_struct_special_symmetry.PDB_model_num 1 _pdbx_struct_special_symmetry.auth_asym_id A _pdbx_struct_special_symmetry.auth_comp_id HOH _pdbx_struct_special_symmetry.auth_seq_id 219 _pdbx_struct_special_symmetry.PDB_ins_code ? _pdbx_struct_special_symmetry.label_asym_id E _pdbx_struct_special_symmetry.label_comp_id HOH _pdbx_struct_special_symmetry.label_seq_id . # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -6.7995 _pdbx_refine_tls.origin_y -8.1001 _pdbx_refine_tls.origin_z -26.0890 _pdbx_refine_tls.T[1][1] 0.4396 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] -0.0775 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0930 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.6706 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.1885 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.2012 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 0.7629 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] -0.0134 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.1417 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.6056 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.2664 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.7579 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.0903 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] 0.5922 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.1588 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] -0.4354 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.0817 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0683 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.4742 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0016 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.1250 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 CCC PC P N S 73 CCC O1C O N N 74 CCC O2C O N N 75 CCC P P N N 76 CCC OP1 O N N 77 CCC OP2 O N N 78 CCC OP3 O N N 79 CCC "O5'" O N N 80 CCC "C5'" C N N 81 CCC "C4'" C N R 82 CCC "O4'" O N N 83 CCC "C3'" C N R 84 CCC "O3'" O N N 85 CCC "C2'" C N R 86 CCC "O2'" O N N 87 CCC "C1'" C N R 88 CCC N1 N N N 89 CCC C2 C N N 90 CCC O2 O N N 91 CCC N3 N N N 92 CCC C4 C N N 93 CCC N4 N N N 94 CCC C5 C N N 95 CCC C6 C N N 96 CCC HOC2 H N N 97 CCC HOP2 H N N 98 CCC HOP3 H N N 99 CCC "H5'" H N N 100 CCC "H5''" H N N 101 CCC "H4'" H N N 102 CCC "H3'" H N N 103 CCC "H2'" H N N 104 CCC "H1'" H N N 105 CCC H41 H N N 106 CCC H42 H N N 107 CCC H5 H N N 108 CCC H6 H N N 109 G OP3 O N N 110 G P P N N 111 G OP1 O N N 112 G OP2 O N N 113 G "O5'" O N N 114 G "C5'" C N N 115 G "C4'" C N R 116 G "O4'" O N N 117 G "C3'" C N S 118 G "O3'" O N N 119 G "C2'" C N R 120 G "O2'" O N N 121 G "C1'" C N R 122 G N9 N Y N 123 G C8 C Y N 124 G N7 N Y N 125 G C5 C Y N 126 G C6 C N N 127 G O6 O N N 128 G N1 N N N 129 G C2 C N N 130 G N2 N N N 131 G N3 N N N 132 G C4 C Y N 133 G HOP3 H N N 134 G HOP2 H N N 135 G "H5'" H N N 136 G "H5''" H N N 137 G "H4'" H N N 138 G "H3'" H N N 139 G "HO3'" H N N 140 G "H2'" H N N 141 G "HO2'" H N N 142 G "H1'" H N N 143 G H8 H N N 144 G H1 H N N 145 G H21 H N N 146 G H22 H N N 147 GTP PG P N N 148 GTP O1G O N N 149 GTP O2G O N N 150 GTP O3G O N N 151 GTP O3B O N N 152 GTP PB P N N 153 GTP O1B O N N 154 GTP O2B O N N 155 GTP O3A O N N 156 GTP PA P N N 157 GTP O1A O N N 158 GTP O2A O N N 159 GTP "O5'" O N N 160 GTP "C5'" C N N 161 GTP "C4'" C N R 162 GTP "O4'" O N N 163 GTP "C3'" C N S 164 GTP "O3'" O N N 165 GTP "C2'" C N R 166 GTP "O2'" O N N 167 GTP "C1'" C N R 168 GTP N9 N Y N 169 GTP C8 C Y N 170 GTP N7 N Y N 171 GTP C5 C Y N 172 GTP C6 C N N 173 GTP O6 O N N 174 GTP N1 N N N 175 GTP C2 C N N 176 GTP N2 N N N 177 GTP N3 N N N 178 GTP C4 C Y N 179 GTP HOG2 H N N 180 GTP HOG3 H N N 181 GTP HOB2 H N N 182 GTP HOA2 H N N 183 GTP "H5'" H N N 184 GTP "H5''" H N N 185 GTP "H4'" H N N 186 GTP "H3'" H N N 187 GTP "HO3'" H N N 188 GTP "H2'" H N N 189 GTP "HO2'" H N N 190 GTP "H1'" H N N 191 GTP H8 H N N 192 GTP HN1 H N N 193 GTP HN21 H N N 194 GTP HN22 H N N 195 H4B N1 N Y N 196 H4B C2 C Y N 197 H4B N2 N N N 198 H4B N3 N Y N 199 H4B C4 C Y N 200 H4B O4 O N N 201 H4B C4A C Y N 202 H4B C8A C Y N 203 H4B N5 N N N 204 H4B N8 N N N 205 H4B C6 C N R 206 H4B C7 C N N 207 H4B C9 C N R 208 H4B O9 O N N 209 H4B C10 C N S 210 H4B C11 C N N 211 H4B O10 O N N 212 H4B HN21 H N N 213 H4B HN22 H N N 214 H4B HN3 H N N 215 H4B HN5 H N N 216 H4B HN8 H N N 217 H4B H6 H N N 218 H4B H71 H N N 219 H4B H72 H N N 220 H4B H9 H N N 221 H4B HO9 H N N 222 H4B H10 H N N 223 H4B H111 H N N 224 H4B H112 H N N 225 H4B H113 H N N 226 H4B HO0 H N N 227 HOH O O N N 228 HOH H1 H N N 229 HOH H2 H N N 230 MG MG MG N N 231 U OP3 O N N 232 U P P N N 233 U OP1 O N N 234 U OP2 O N N 235 U "O5'" O N N 236 U "C5'" C N N 237 U "C4'" C N R 238 U "O4'" O N N 239 U "C3'" C N S 240 U "O3'" O N N 241 U "C2'" C N R 242 U "O2'" O N N 243 U "C1'" C N R 244 U N1 N N N 245 U C2 C N N 246 U O2 O N N 247 U N3 N N N 248 U C4 C N N 249 U O4 O N N 250 U C5 C N N 251 U C6 C N N 252 U HOP3 H N N 253 U HOP2 H N N 254 U "H5'" H N N 255 U "H5''" H N N 256 U "H4'" H N N 257 U "H3'" H N N 258 U "HO3'" H N N 259 U "H2'" H N N 260 U "HO2'" H N N 261 U "H1'" H N N 262 U H3 H N N 263 U H5 H N N 264 U H6 H N N 265 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 CCC PC O1C doub N N 76 CCC PC O2C sing N N 77 CCC PC "O3'" sing N N 78 CCC PC "O2'" sing N N 79 CCC O2C HOC2 sing N N 80 CCC P OP1 doub N N 81 CCC P OP2 sing N N 82 CCC P OP3 sing N N 83 CCC P "O5'" sing N N 84 CCC OP2 HOP2 sing N N 85 CCC OP3 HOP3 sing N N 86 CCC "O5'" "C5'" sing N N 87 CCC "C5'" "C4'" sing N N 88 CCC "C5'" "H5'" sing N N 89 CCC "C5'" "H5''" sing N N 90 CCC "C4'" "O4'" sing N N 91 CCC "C4'" "C3'" sing N N 92 CCC "C4'" "H4'" sing N N 93 CCC "O4'" "C1'" sing N N 94 CCC "C3'" "O3'" sing N N 95 CCC "C3'" "C2'" sing N N 96 CCC "C3'" "H3'" sing N N 97 CCC "C2'" "O2'" sing N N 98 CCC "C2'" "C1'" sing N N 99 CCC "C2'" "H2'" sing N N 100 CCC "C1'" N1 sing N N 101 CCC "C1'" "H1'" sing N N 102 CCC N1 C2 sing N N 103 CCC N1 C6 sing N N 104 CCC C2 O2 doub N N 105 CCC C2 N3 sing N N 106 CCC N3 C4 doub N N 107 CCC C4 N4 sing N N 108 CCC C4 C5 sing N N 109 CCC N4 H41 sing N N 110 CCC N4 H42 sing N N 111 CCC C5 C6 doub N N 112 CCC C5 H5 sing N N 113 CCC C6 H6 sing N N 114 G OP3 P sing N N 115 G OP3 HOP3 sing N N 116 G P OP1 doub N N 117 G P OP2 sing N N 118 G P "O5'" sing N N 119 G OP2 HOP2 sing N N 120 G "O5'" "C5'" sing N N 121 G "C5'" "C4'" sing N N 122 G "C5'" "H5'" sing N N 123 G "C5'" "H5''" sing N N 124 G "C4'" "O4'" sing N N 125 G "C4'" "C3'" sing N N 126 G "C4'" "H4'" sing N N 127 G "O4'" "C1'" sing N N 128 G "C3'" "O3'" sing N N 129 G "C3'" "C2'" sing N N 130 G "C3'" "H3'" sing N N 131 G "O3'" "HO3'" sing N N 132 G "C2'" "O2'" sing N N 133 G "C2'" "C1'" sing N N 134 G "C2'" "H2'" sing N N 135 G "O2'" "HO2'" sing N N 136 G "C1'" N9 sing N N 137 G "C1'" "H1'" sing N N 138 G N9 C8 sing Y N 139 G N9 C4 sing Y N 140 G C8 N7 doub Y N 141 G C8 H8 sing N N 142 G N7 C5 sing Y N 143 G C5 C6 sing N N 144 G C5 C4 doub Y N 145 G C6 O6 doub N N 146 G C6 N1 sing N N 147 G N1 C2 sing N N 148 G N1 H1 sing N N 149 G C2 N2 sing N N 150 G C2 N3 doub N N 151 G N2 H21 sing N N 152 G N2 H22 sing N N 153 G N3 C4 sing N N 154 GTP PG O1G doub N N 155 GTP PG O2G sing N N 156 GTP PG O3G sing N N 157 GTP PG O3B sing N N 158 GTP O2G HOG2 sing N N 159 GTP O3G HOG3 sing N N 160 GTP O3B PB sing N N 161 GTP PB O1B doub N N 162 GTP PB O2B sing N N 163 GTP PB O3A sing N N 164 GTP O2B HOB2 sing N N 165 GTP O3A PA sing N N 166 GTP PA O1A doub N N 167 GTP PA O2A sing N N 168 GTP PA "O5'" sing N N 169 GTP O2A HOA2 sing N N 170 GTP "O5'" "C5'" sing N N 171 GTP "C5'" "C4'" sing N N 172 GTP "C5'" "H5'" sing N N 173 GTP "C5'" "H5''" sing N N 174 GTP "C4'" "O4'" sing N N 175 GTP "C4'" "C3'" sing N N 176 GTP "C4'" "H4'" sing N N 177 GTP "O4'" "C1'" sing N N 178 GTP "C3'" "O3'" sing N N 179 GTP "C3'" "C2'" sing N N 180 GTP "C3'" "H3'" sing N N 181 GTP "O3'" "HO3'" sing N N 182 GTP "C2'" "O2'" sing N N 183 GTP "C2'" "C1'" sing N N 184 GTP "C2'" "H2'" sing N N 185 GTP "O2'" "HO2'" sing N N 186 GTP "C1'" N9 sing N N 187 GTP "C1'" "H1'" sing N N 188 GTP N9 C8 sing Y N 189 GTP N9 C4 sing Y N 190 GTP C8 N7 doub Y N 191 GTP C8 H8 sing N N 192 GTP N7 C5 sing Y N 193 GTP C5 C6 sing N N 194 GTP C5 C4 doub Y N 195 GTP C6 O6 doub N N 196 GTP C6 N1 sing N N 197 GTP N1 C2 sing N N 198 GTP N1 HN1 sing N N 199 GTP C2 N2 sing N N 200 GTP C2 N3 doub N N 201 GTP N2 HN21 sing N N 202 GTP N2 HN22 sing N N 203 GTP N3 C4 sing N N 204 H4B N1 C2 doub Y N 205 H4B N1 C8A sing Y N 206 H4B C2 N2 sing N N 207 H4B C2 N3 sing Y N 208 H4B N2 HN21 sing N N 209 H4B N2 HN22 sing N N 210 H4B N3 C4 sing Y N 211 H4B N3 HN3 sing N N 212 H4B C4 O4 doub N N 213 H4B C4 C4A sing Y N 214 H4B C4A C8A doub Y N 215 H4B C4A N5 sing N N 216 H4B C8A N8 sing N N 217 H4B N5 C6 sing N N 218 H4B N5 HN5 sing N N 219 H4B N8 C7 sing N N 220 H4B N8 HN8 sing N N 221 H4B C6 C7 sing N N 222 H4B C6 C9 sing N N 223 H4B C6 H6 sing N N 224 H4B C7 H71 sing N N 225 H4B C7 H72 sing N N 226 H4B C9 O9 sing N N 227 H4B C9 C10 sing N N 228 H4B C9 H9 sing N N 229 H4B O9 HO9 sing N N 230 H4B C10 C11 sing N N 231 H4B C10 O10 sing N N 232 H4B C10 H10 sing N N 233 H4B C11 H111 sing N N 234 H4B C11 H112 sing N N 235 H4B C11 H113 sing N N 236 H4B O10 HO0 sing N N 237 HOH O H1 sing N N 238 HOH O H2 sing N N 239 U OP3 P sing N N 240 U OP3 HOP3 sing N N 241 U P OP1 doub N N 242 U P OP2 sing N N 243 U P "O5'" sing N N 244 U OP2 HOP2 sing N N 245 U "O5'" "C5'" sing N N 246 U "C5'" "C4'" sing N N 247 U "C5'" "H5'" sing N N 248 U "C5'" "H5''" sing N N 249 U "C4'" "O4'" sing N N 250 U "C4'" "C3'" sing N N 251 U "C4'" "H4'" sing N N 252 U "O4'" "C1'" sing N N 253 U "C3'" "O3'" sing N N 254 U "C3'" "C2'" sing N N 255 U "C3'" "H3'" sing N N 256 U "O3'" "HO3'" sing N N 257 U "C2'" "O2'" sing N N 258 U "C2'" "C1'" sing N N 259 U "C2'" "H2'" sing N N 260 U "O2'" "HO2'" sing N N 261 U "C1'" N1 sing N N 262 U "C1'" "H1'" sing N N 263 U N1 C2 sing N N 264 U N1 C6 sing N N 265 U C2 O2 doub N N 266 U C2 N3 sing N N 267 U N3 C4 sing N N 268 U N3 H3 sing N N 269 U C4 O4 doub N N 270 U C4 C5 sing N N 271 U C5 C6 doub N N 272 U C5 H5 sing N N 273 U C6 H6 sing N N 274 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9V51 'double helix' 9V51 'a-form double helix' 9V51 'mismatched base pair' 9V51 'internal loop' 9V51 'triple helix' 9V51 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 2 1_555 A CCC 71 1_555 0.398 -0.262 -0.259 -8.866 -2.815 -3.502 1 A_G2:CCC71_A A 2 ? A 71 ? 19 1 1 A G 3 1_555 A U 70 1_555 -1.306 -0.484 0.068 -2.794 3.186 -0.056 2 A_G3:U70_A A 3 ? A 70 ? 28 1 1 A U 4 1_555 A A 69 1_555 0.032 -0.164 0.224 3.222 1.328 5.700 3 A_U4:A69_A A 4 ? A 69 ? 20 1 1 A U 5 1_555 A A 68 1_555 -0.010 -0.174 0.047 3.676 -0.852 3.975 4 A_U5:A68_A A 5 ? A 68 ? 20 1 1 A G 6 1_555 A C 67 1_555 -0.205 -0.173 0.460 -1.558 1.308 1.541 5 A_G6:C67_A A 6 ? A 67 ? 19 1 1 A U 7 1_555 A A 66 1_555 -0.021 -0.168 0.585 -4.332 -2.426 -0.898 6 A_U7:A66_A A 7 ? A 66 ? 20 1 1 A A 8 1_555 A U 65 1_555 0.005 -0.145 0.000 -6.543 -7.399 -0.104 7 A_A8:U65_A A 8 ? A 65 ? 20 1 1 A U 38 1_555 A U 34 1_555 -3.565 -0.537 1.627 -24.806 48.936 -68.962 8 A_U38:U34_A A 38 ? A 34 ? ? ? 1 A A 39 1_555 A U 9 1_555 0.087 -0.069 0.165 -5.289 -1.430 -0.338 9 A_A39:U9_A A 39 ? A 9 ? 20 1 1 A A 10 1_555 A G 33 1_555 -2.449 4.354 0.068 4.143 5.801 78.580 10 A_A10:G33_A A 10 ? A 33 ? 10 6 1 A G 12 1_555 A C 32 1_555 -0.209 -0.164 -0.597 -4.659 -2.781 0.329 11 A_G12:C32_A A 12 ? A 32 ? 19 1 1 A C 13 1_555 A G 31 1_555 0.181 -0.162 -0.324 -2.737 0.676 0.459 12 A_C13:G31_A A 13 ? A 31 ? 19 1 1 A U 14 1_555 A A 30 1_555 -0.068 -0.123 -0.250 -0.253 6.342 0.882 13 A_U14:A30_A A 14 ? A 30 ? 20 1 1 A C 15 1_555 A G 29 1_555 0.193 -0.117 -0.168 0.713 -3.607 1.317 14 A_C15:G29_A A 15 ? A 29 ? 19 1 1 A G 16 1_555 A U 28 1_555 -1.413 -0.396 -0.348 -10.035 -1.415 -2.274 15 A_G16:U28_A A 16 ? A 28 ? 28 1 1 A U 17 1_555 A A 27 1_555 -0.025 -0.083 -0.114 -4.790 3.850 5.791 16 A_U17:A27_A A 17 ? A 27 ? 20 1 1 A U 18 1_555 A A 26 1_555 0.084 -0.174 0.419 4.339 1.016 6.542 17 A_U18:A26_A A 18 ? A 26 ? 20 1 1 A U 21 1_555 A A 52 1_555 -0.244 2.190 -1.511 21.467 7.515 145.979 18 A_U21:A52_A A 21 ? A 52 ? ? 2 1 A G 24 1_555 A C 48 1_555 -0.211 -0.143 0.092 -5.802 3.447 -0.482 19 A_G24:C48_A A 24 ? A 48 ? 19 1 1 A G 25 1_555 A C 47 1_555 -0.181 -0.151 -0.107 3.544 8.082 0.258 20 A_G25:C47_A A 25 ? A 47 ? 19 1 1 A U 54 1_555 A A 46 1_555 0.010 -0.095 -0.090 4.251 -0.895 2.686 21 A_U54:A46_A A 54 ? A 46 ? 20 1 1 A U 55 1_555 A A 45 1_555 -0.008 -0.099 -0.105 -2.272 -2.804 6.339 22 A_U55:A45_A A 55 ? A 45 ? 20 1 1 A G 56 1_555 A C 44 1_555 -0.146 -0.172 -0.048 -3.584 -1.076 -1.756 23 A_G56:C44_A A 56 ? A 44 ? 19 1 1 A C 57 1_555 A G 43 1_555 0.250 -0.167 -0.323 4.438 -5.341 -1.099 24 A_C57:G43_A A 57 ? A 43 ? 19 1 1 A C 58 1_555 A G 42 1_555 0.302 0.664 -0.254 9.930 -9.990 7.629 25 A_C58:G42_A A 58 ? A 42 ? ? 1 1 A C 59 1_555 A A 41 1_555 -4.715 0.878 -0.131 8.582 -4.913 -101.829 26 A_C59:A41_A A 59 ? A 41 ? ? 4 1 A A 61 1_555 A A 11 1_555 4.442 0.673 -0.289 -6.560 -15.489 -115.899 27 A_A61:A11_A A 61 ? A 11 ? 5 4 1 A G 62 1_555 A C 40 1_555 -0.133 -0.152 0.039 2.965 -3.045 1.378 28 A_G62:C40_A A 62 ? A 40 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 2 1_555 A CCC 71 1_555 A G 3 1_555 A U 70 1_555 0.001 -1.606 2.802 -5.597 7.571 27.852 -4.460 -0.958 2.254 15.189 11.228 29.371 1 AA_G2G3:U70CCC71_AA A 2 ? A 71 ? A 3 ? A 70 ? 1 A G 3 1_555 A U 70 1_555 A U 4 1_555 A A 69 1_555 0.569 -1.319 3.027 -2.737 5.210 36.588 -2.700 -1.224 2.771 8.234 4.325 37.042 2 AA_G3U4:A69U70_AA A 3 ? A 70 ? A 4 ? A 69 ? 1 A U 4 1_555 A A 69 1_555 A U 5 1_555 A A 68 1_555 -0.010 -1.621 3.003 2.140 6.295 32.675 -3.741 0.328 2.648 11.046 -3.755 33.326 3 AA_U4U5:A68A69_AA A 4 ? A 69 ? A 5 ? A 68 ? 1 A U 5 1_555 A A 68 1_555 A G 6 1_555 A C 67 1_555 0.104 -1.633 3.098 -1.367 9.308 30.091 -4.526 -0.415 2.487 17.401 2.556 31.495 4 AA_U5G6:C67A68_AA A 5 ? A 68 ? A 6 ? A 67 ? 1 A G 6 1_555 A C 67 1_555 A U 7 1_555 A A 66 1_555 -0.084 -1.610 3.306 0.889 4.383 37.768 -3.019 0.240 3.104 6.742 -1.368 38.022 5 AA_G6U7:A66C67_AA A 6 ? A 67 ? A 7 ? A 66 ? 1 A U 7 1_555 A A 66 1_555 A A 8 1_555 A U 65 1_555 0.712 -2.117 2.986 9.181 17.233 27.433 -5.851 -0.069 1.577 31.743 -16.912 33.564 6 AA_U7A8:U65A66_AA A 7 ? A 66 ? A 8 ? A 65 ? 1 A A 8 1_555 A U 65 1_555 A U 38 1_555 A U 34 1_555 -2.341 6.301 0.949 24.821 2.705 160.045 3.195 1.205 0.886 1.373 -12.595 160.521 7 AA_A8U38:U34U65_AA A 8 ? A 65 ? A 38 ? A 34 ? 1 A U 38 1_555 A U 34 1_555 A A 39 1_555 A U 9 1_555 0.048 -2.304 3.550 -11.506 41.005 7.379 -5.293 -0.672 -1.577 77.627 21.781 43.194 8 AA_U38A39:U9U34_AA A 38 ? A 34 ? A 39 ? A 9 ? 1 A A 10 1_555 A G 33 1_555 A G 12 1_555 A C 32 1_555 -2.815 -2.260 -1.212 115.957 -130.047 44.016 -1.594 0.996 -0.628 -66.368 -59.177 174.656 9 AA_A10G12:C32G33_AA A 10 ? A 33 ? A 12 ? A 32 ? 1 A G 12 1_555 A C 32 1_555 A C 13 1_555 A G 31 1_555 -0.699 -2.202 3.166 -3.730 2.262 34.251 -4.047 0.625 3.075 3.822 6.302 34.519 10 AA_G12C13:G31C32_AA A 12 ? A 32 ? A 13 ? A 31 ? 1 A C 13 1_555 A G 31 1_555 A U 14 1_555 A A 30 1_555 -0.244 -1.738 3.272 -0.883 2.542 28.869 -4.020 0.297 3.116 5.084 1.765 28.992 11 AA_C13U14:A30G31_AA A 13 ? A 31 ? A 14 ? A 30 ? 1 A U 14 1_555 A A 30 1_555 A C 15 1_555 A G 29 1_555 0.287 -1.653 3.072 2.336 10.332 32.037 -4.308 -0.165 2.450 18.112 -4.095 33.699 12 AA_U14C15:G29A30_AA A 14 ? A 30 ? A 15 ? A 29 ? 1 A C 15 1_555 A G 29 1_555 A G 16 1_555 A U 28 1_555 0.240 -2.183 3.474 1.630 10.950 24.085 -7.451 -0.125 2.291 24.643 -3.668 26.473 13 AA_C15G16:U28G29_AA A 15 ? A 29 ? A 16 ? A 28 ? 1 A G 16 1_555 A U 28 1_555 A U 17 1_555 A A 27 1_555 0.273 -1.320 3.379 -4.059 1.848 33.694 -2.560 -1.128 3.250 3.171 6.964 33.979 14 AA_G16U17:A27U28_AA A 16 ? A 28 ? A 17 ? A 27 ? 1 A U 17 1_555 A A 27 1_555 A U 18 1_555 A A 26 1_555 0.055 -2.051 3.046 -4.729 7.389 26.020 -5.866 -1.104 2.340 15.849 10.143 27.435 15 AA_U17U18:A26A27_AA A 17 ? A 27 ? A 18 ? A 26 ? 1 A U 21 1_555 A A 52 1_555 A G 24 1_555 A C 48 1_555 4.978 -4.532 -2.929 -80.249 129.215 -81.697 2.313 2.536 2.887 -68.618 -42.615 -158.991 16 AA_U21G24:C48A52_AA A 21 ? A 52 ? A 24 ? A 48 ? 1 A G 24 1_555 A C 48 1_555 A G 25 1_555 A C 47 1_555 0.134 -1.518 3.080 -0.940 6.279 29.073 -4.133 -0.437 2.695 12.323 1.844 29.743 17 AA_G24G25:C47C48_AA A 24 ? A 48 ? A 25 ? A 47 ? 1 A G 25 1_555 A C 47 1_555 A U 54 1_555 A A 46 1_555 -1.694 -1.162 3.197 -1.946 -0.317 50.313 -1.344 1.854 3.263 -0.373 2.288 50.349 18 AA_G25U54:A46C47_AA A 25 ? A 47 ? A 54 ? A 46 ? 1 A U 54 1_555 A A 46 1_555 A U 55 1_555 A A 45 1_555 0.449 -1.991 3.272 2.546 3.311 32.414 -4.098 -0.368 3.085 5.902 -4.537 32.675 19 AA_U54U55:A45A46_AA A 54 ? A 46 ? A 55 ? A 45 ? 1 A U 55 1_555 A A 45 1_555 A G 56 1_555 A C 44 1_555 -0.712 -1.532 3.134 1.152 9.225 29.212 -4.512 1.549 2.515 17.732 -2.214 30.625 20 AA_U55G56:C44A45_AA A 55 ? A 45 ? A 56 ? A 44 ? 1 A G 56 1_555 A C 44 1_555 A C 57 1_555 A G 43 1_555 0.045 -1.083 2.986 3.268 3.726 39.903 -1.957 0.269 2.873 5.434 -4.766 40.197 21 AA_G56C57:G43C44_AA A 56 ? A 44 ? A 57 ? A 43 ? 1 A C 57 1_555 A G 43 1_555 A C 58 1_555 A G 42 1_555 0.733 -1.004 3.063 4.565 5.592 29.194 -2.998 -0.546 2.904 10.885 -8.887 30.054 22 AA_C57C58:G42G43_AA A 57 ? A 43 ? A 58 ? A 42 ? 1 A C 58 1_555 A G 42 1_555 A C 59 1_555 A A 41 1_555 -1.179 0.901 3.380 3.767 2.764 -20.884 -3.605 -1.568 3.390 -7.505 10.227 -21.395 23 AA_C58C59:A41G42_AA A 58 ? A 42 ? A 59 ? A 41 ? 1 A C 59 1_555 A A 41 1_555 A A 61 1_555 A A 11 1_555 0.734 -3.116 3.832 0.643 6.348 91.340 -2.316 -0.498 3.662 4.433 -0.449 91.513 24 AA_C59A61:A11A41_AA A 59 ? A 41 ? A 61 ? A 11 ? 1 A A 61 1_555 A A 11 1_555 A G 62 1_555 A C 40 1_555 1.134 -0.925 3.050 -4.325 -1.630 -28.070 2.238 1.365 3.128 3.331 -8.842 -28.441 25 AA_A61G62:C40A11_AA A 61 ? A 11 ? A 62 ? A 40 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9LJN _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9V51 _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.026469 _atom_sites.fract_transf_matrix[1][2] 0.000000 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.019682 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.004591 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #