data_9X9N # _entry.id 9X9N # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9X9N pdb_00009x9n 10.2210/pdb9x9n/pdb WWPDB D_1300064929 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-28 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9X9N _pdbx_database_status.recvd_initial_deposition_date 2025-10-21 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Ren _pdbx_contact_author.name_last Aiming _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of RhoBAST in complex with 5-TAMRA' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (56-MER)' 18148.902 1 ? ? ? ? 2 non-polymer syn '5-carboxy methylrhodamine' 431.461 1 ? ? ? ? 3 non-polymer syn "GUANOSINE-5'-TRIPHOSPHATE" 523.180 1 ? ? ? ? 4 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 5 water nat water 18.015 6 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_seq_one_letter_code_can GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id U _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 '5-carboxy methylrhodamine' FH8 3 "GUANOSINE-5'-TRIPHOSPHATE" GTP 4 'MAGNESIUM ION' MG 5 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 A n 1 3 A n 1 4 C n 1 5 C n 1 6 U n 1 7 C n 1 8 C n 1 9 G n 1 10 C n 1 11 C n 1 12 G n 1 13 A n 1 14 A n 1 15 A n 1 16 G n 1 17 G n 1 18 C n 1 19 G n 1 20 G n 1 21 U n 1 22 G n 1 23 A n 1 24 A n 1 25 G n 1 26 G n 1 27 A n 1 28 G n 1 29 A n 1 30 G n 1 31 G n 1 32 C n 1 33 G n 1 34 C n 1 35 A n 1 36 A n 1 37 G n 1 38 G n 1 39 U n 1 40 U n 1 41 A n 1 42 A n 1 43 C n 1 44 C n 1 45 G n 1 46 C n 1 47 C n 1 48 U n 1 49 C n 1 50 A n 1 51 G n 1 52 G n 1 53 U n 1 54 U n 1 55 C n 1 56 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 56 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 FH8 non-polymer . '5-carboxy methylrhodamine' ? 'C25 H23 N2 O5 1' 431.461 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 2 2 G G U . n A 1 2 A 2 3 3 A A U . n A 1 3 A 3 4 4 A A U . n A 1 4 C 4 5 5 C C U . n A 1 5 C 5 6 6 C C U . n A 1 6 U 6 7 7 U U U . n A 1 7 C 7 8 8 C C U . n A 1 8 C 8 9 9 C C U . n A 1 9 G 9 10 10 G G U . n A 1 10 C 10 11 11 C C U . n A 1 11 C 11 12 12 C C U . n A 1 12 G 12 13 13 G G U . n A 1 13 A 13 14 14 A A U . n A 1 14 A 14 15 15 A A U . n A 1 15 A 15 16 16 A A U . n A 1 16 G 16 17 17 G G U . n A 1 17 G 17 18 18 G G U . n A 1 18 C 18 19 19 C C U . n A 1 19 G 19 20 20 G G U . n A 1 20 G 20 21 21 G G U . n A 1 21 U 21 22 22 U U U . n A 1 22 G 22 23 23 G G U . n A 1 23 A 23 24 24 A A U . n A 1 24 A 24 25 25 A A U . n A 1 25 G 25 26 26 G G U . n A 1 26 G 26 27 27 G G U . n A 1 27 A 27 28 28 A A U . n A 1 28 G 28 29 29 G G U . n A 1 29 A 29 30 30 A A U . n A 1 30 G 30 31 31 G G U . n A 1 31 G 31 32 32 G G U . n A 1 32 C 32 33 33 C C U . n A 1 33 G 33 34 34 G G U . n A 1 34 C 34 35 35 C C U . n A 1 35 A 35 36 36 A A U . n A 1 36 A 36 37 37 A A U . n A 1 37 G 37 38 38 G G U . n A 1 38 G 38 39 39 G G U . n A 1 39 U 39 40 40 U U U . n A 1 40 U 40 41 41 U U U . n A 1 41 A 41 42 42 A A U . n A 1 42 A 42 43 43 A A U . n A 1 43 C 43 44 44 C C U . n A 1 44 C 44 45 45 C C U . n A 1 45 G 45 46 46 G G U . n A 1 46 C 46 47 47 C C U . n A 1 47 C 47 48 48 C C U . n A 1 48 U 48 49 49 U U U . n A 1 49 C 49 50 50 C C U . n A 1 50 A 50 51 51 A A U . n A 1 51 G 51 52 52 G G U . n A 1 52 G 52 53 53 G G U . n A 1 53 U 53 54 54 U U U . n A 1 54 U 54 55 55 U U U . n A 1 55 C 55 56 56 C C U . n A 1 56 C 56 57 57 C C U . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id FH8 _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id FH8 _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 FH8 1 101 101 FH8 FH8 U . C 3 GTP 1 102 102 GTP GTP U . D 4 MG 1 103 1 MG MG U . E 5 HOH 1 201 8 HOH HOH U . E 5 HOH 2 202 2 HOH HOH U . E 5 HOH 3 203 6 HOH HOH U . E 5 HOH 4 204 7 HOH HOH U . E 5 HOH 5 205 3 HOH HOH U . E 5 HOH 6 206 4 HOH HOH U . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9X9N _cell.details ? _cell.formula_units_Z ? _cell.length_a 82.688 _cell.length_a_esd ? _cell.length_b 82.688 _cell.length_b_esd ? _cell.length_c 106.142 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9X9N _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9X9N _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.89 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 57.38 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Magnesium sulfate heptahydrate, Sodium cacodylate trihydrate pH 6.5, Ammonium sulfate' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-03-14 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97946 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL18U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97946 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL18U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9X9N _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.97 _reflns.d_resolution_low 35.8 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 4831 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.9 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 35.7 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 1.36 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.994 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.97 _reflns_shell.d_res_low 3.15 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 4813 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.285 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9X9N _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.97 _refine.ls_d_res_low 35.80 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 4801 _refine.ls_number_reflns_R_free 481 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.98 _refine.ls_percent_reflns_R_free 10.02 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2254 _refine.ls_R_factor_R_free 0.2661 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2210 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.36 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 25.90 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.42 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1205 _refine_hist.pdbx_number_atoms_ligand 65 _refine_hist.number_atoms_solvent 6 _refine_hist.number_atoms_total 1276 _refine_hist.d_res_high 2.97 _refine_hist.d_res_low 35.80 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.003 ? 1418 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.788 ? 2209 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 17.501 ? 690 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.036 ? 284 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.003 ? 63 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.97 3.40 . . 153 1383 100.00 . . . . 0.3163 . . . . . . . . . . . . . . . 0.3495 'X-RAY DIFFRACTION' 3.40 4.28 . . 158 1417 100.00 . . . . 0.2417 . . . . . . . . . . . . . . . 0.2756 'X-RAY DIFFRACTION' 4.28 35.80 . . 170 1520 100.00 . . . . 0.1787 . . . . . . . . . . . . . . . 0.2326 # _struct.entry_id 9X9N _struct.title 'Crystal structure of RhoBAST in complex with 5-TAMRA' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9X9N _struct_keywords.text 'aptamer, RhoBAST, 5-TAMRA, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? E N N 5 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9X9N _struct_ref.pdbx_db_accession 9X9N _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9X9N _struct_ref_seq.pdbx_strand_id U _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 56 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9X9N _struct_ref_seq.db_align_beg 2 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 2 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 1260 ? 1 MORE -21 ? 1 'SSA (A^2)' 19610 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D,E # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 9_555 -x,-x+y,-z+1/3 -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 -0.8660254038 0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 35.3806666667 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A G 1 P ? ? ? 1_555 C GTP . "O3'" ? ? U G 2 U GTP 102 1_555 ? ? ? ? ? ? ? 1.561 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 55 N3 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 55 O2 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 55 N4 ? ? U G 2 U C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A A 2 N1 ? ? ? 1_555 A U 54 N3 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A A 2 N6 ? ? ? 1_555 A U 54 O4 ? ? U A 3 U U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 53 N3 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 53 O4 ? ? U A 4 U U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A C 4 N3 ? ? ? 1_555 A G 52 N1 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A C 4 N4 ? ? ? 1_555 A G 52 O6 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A C 4 O2 ? ? ? 1_555 A G 52 N2 ? ? U C 5 U G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 51 N1 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 51 O6 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 51 N2 ? ? U C 6 U G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A U 6 N3 ? ? ? 1_555 A A 50 N1 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A U 6 O4 ? ? ? 1_555 A A 50 N6 ? ? U U 7 U A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 7 N3 ? ? ? 1_555 A G 20 N1 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A C 7 N4 ? ? ? 1_555 A G 20 O6 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 7 O2 ? ? ? 1_555 A G 20 N2 ? ? U C 8 U G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 19 N1 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 19 O6 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 19 N2 ? ? U C 9 U G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A G 9 N1 ? ? ? 1_555 A C 18 N3 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A G 9 N2 ? ? ? 1_555 A C 18 O2 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A G 9 O6 ? ? ? 1_555 A C 18 N4 ? ? U G 10 U C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A C 10 N3 ? ? ? 1_555 A G 17 N1 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A C 10 N4 ? ? ? 1_555 A G 17 O6 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A C 10 O2 ? ? ? 1_555 A G 17 N2 ? ? U C 11 U G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 16 N1 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 16 O6 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 16 N2 ? ? U C 12 U G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A G 12 N2 ? ? ? 1_555 A A 15 N7 ? ? U G 13 U A 16 1_555 ? ? ? ? ? ? 'G-A MISPAIR' ? ? ? hydrog32 hydrog ? ? A U 21 N3 ? ? ? 1_555 A A 27 N1 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A U 21 O4 ? ? ? 1_555 A A 27 N6 ? ? U U 22 U A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 22 N1 ? ? ? 1_555 A C 43 N3 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A G 22 N2 ? ? ? 1_555 A C 43 O2 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A G 22 O6 ? ? ? 1_555 A C 43 N4 ? ? U G 23 U C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A A 23 N1 ? ? ? 1_555 A A 41 N6 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog38 hydrog ? ? A A 23 N6 ? ? ? 1_555 A A 41 N7 ? ? U A 24 U A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog39 hydrog ? ? A G 25 N2 ? ? ? 1_555 A A 42 N7 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog40 hydrog ? ? A G 25 N3 ? ? ? 1_555 A A 42 N6 ? ? U G 26 U A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog41 hydrog ? ? A G 26 N1 ? ? ? 1_555 A C 34 N3 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog42 hydrog ? ? A G 26 N2 ? ? ? 1_555 A C 34 O2 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog43 hydrog ? ? A G 26 O6 ? ? ? 1_555 A C 34 N4 ? ? U G 27 U C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 49 N3 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 49 O2 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 49 N4 ? ? U G 29 U C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A A 29 N1 ? ? ? 1_555 A U 48 N3 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A A 29 N6 ? ? ? 1_555 A U 48 O4 ? ? U A 30 U U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 30 N1 ? ? ? 1_555 A C 47 N3 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 30 N2 ? ? ? 1_555 A C 47 O2 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A G 30 O6 ? ? ? 1_555 A C 47 N4 ? ? U G 31 U C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 46 N3 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 46 O2 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 46 N4 ? ? U G 32 U C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 45 N1 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 45 O6 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 45 N2 ? ? U C 33 U G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 33 N1 ? ? ? 1_555 A C 44 N3 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A G 33 N2 ? ? ? 1_555 A C 44 O2 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 33 O6 ? ? ? 1_555 A C 44 N4 ? ? U G 34 U C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 38 N2 ? ? ? 1_555 A U 40 O4 ? ? U G 39 U U 41 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9X9N _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # loop_ _pdbx_validate_close_contact.id _pdbx_validate_close_contact.PDB_model_num _pdbx_validate_close_contact.auth_atom_id_1 _pdbx_validate_close_contact.auth_asym_id_1 _pdbx_validate_close_contact.auth_comp_id_1 _pdbx_validate_close_contact.auth_seq_id_1 _pdbx_validate_close_contact.PDB_ins_code_1 _pdbx_validate_close_contact.label_alt_id_1 _pdbx_validate_close_contact.auth_atom_id_2 _pdbx_validate_close_contact.auth_asym_id_2 _pdbx_validate_close_contact.auth_comp_id_2 _pdbx_validate_close_contact.auth_seq_id_2 _pdbx_validate_close_contact.PDB_ins_code_2 _pdbx_validate_close_contact.label_alt_id_2 _pdbx_validate_close_contact.dist 1 1 OP1 U G 2 ? ? "O3'" U GTP 102 ? ? 2.03 2 1 P U G 2 ? ? "C3'" U GTP 102 ? ? 2.12 # _pdbx_validate_symm_contact.id 1 _pdbx_validate_symm_contact.PDB_model_num 1 _pdbx_validate_symm_contact.auth_atom_id_1 "O2'" _pdbx_validate_symm_contact.auth_asym_id_1 U _pdbx_validate_symm_contact.auth_comp_id_1 G _pdbx_validate_symm_contact.auth_seq_id_1 20 _pdbx_validate_symm_contact.PDB_ins_code_1 ? _pdbx_validate_symm_contact.label_alt_id_1 ? _pdbx_validate_symm_contact.site_symmetry_1 1_555 _pdbx_validate_symm_contact.auth_atom_id_2 "O2'" _pdbx_validate_symm_contact.auth_asym_id_2 U _pdbx_validate_symm_contact.auth_comp_id_2 G _pdbx_validate_symm_contact.auth_seq_id_2 20 _pdbx_validate_symm_contact.PDB_ins_code_2 ? _pdbx_validate_symm_contact.label_alt_id_2 ? _pdbx_validate_symm_contact.site_symmetry_2 10_665 _pdbx_validate_symm_contact.dist 2.18 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x -3.8892 _pdbx_refine_tls.origin_y 30.3070 _pdbx_refine_tls.origin_z -0.8663 _pdbx_refine_tls.T[1][1] 0.5860 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.0519 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] 0.0456 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.8635 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] -0.0978 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.6788 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 3.3905 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.6275 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] 0.0630 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.4078 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] -0.1835 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.1122 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.1789 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.2974 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] 0.1598 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.1276 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.1791 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] -0.2230 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] 0.1451 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] 0.0408 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0220 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 FH8 O3 O N N 73 FH8 O5 O N N 74 FH8 OE O N N 75 FH8 C02 C N N 76 FH8 O2 O N N 77 FH8 C13 C Y N 78 FH8 C14 C Y N 79 FH8 C15 C Y N 80 FH8 C03 C N N 81 FH8 O4 O N N 82 FH8 C16 C Y N 83 FH8 C11 C Y N 84 FH8 C12 C Y N 85 FH8 C01 C N N 86 FH8 C34 C N N 87 FH8 C33 C N N 88 FH8 C32 C N N 89 FH8 C31 C N N 90 FH8 N2 N N N 91 FH8 C311 C N N 92 FH8 C321 C N N 93 FH8 C36 C N N 94 FH8 C35 C N N 95 FH8 C25 C Y N 96 FH8 C26 C Y N 97 FH8 C21 C Y N 98 FH8 N3 N N N 99 FH8 C211 C N N 100 FH8 C221 C N N 101 FH8 C22 C Y N 102 FH8 C23 C Y N 103 FH8 C24 C Y N 104 FH8 H1 H N N 105 FH8 H2 H N N 106 FH8 H14 H N N 107 FH8 H16 H N N 108 FH8 H11 H N N 109 FH8 H33 H N N 110 FH8 H32 H N N 111 FH8 H313 H N N 112 FH8 H311 H N N 113 FH8 H312 H N N 114 FH8 H321 H N N 115 FH8 H322 H N N 116 FH8 H323 H N N 117 FH8 H36 H N N 118 FH8 H26 H N N 119 FH8 H211 H N N 120 FH8 H212 H N N 121 FH8 H213 H N N 122 FH8 H221 H N N 123 FH8 H222 H N N 124 FH8 H223 H N N 125 FH8 H22 H N N 126 FH8 H23 H N N 127 G OP3 O N N 128 G P P N N 129 G OP1 O N N 130 G OP2 O N N 131 G "O5'" O N N 132 G "C5'" C N N 133 G "C4'" C N R 134 G "O4'" O N N 135 G "C3'" C N S 136 G "O3'" O N N 137 G "C2'" C N R 138 G "O2'" O N N 139 G "C1'" C N R 140 G N9 N Y N 141 G C8 C Y N 142 G N7 N Y N 143 G C5 C Y N 144 G C6 C N N 145 G O6 O N N 146 G N1 N N N 147 G C2 C N N 148 G N2 N N N 149 G N3 N N N 150 G C4 C Y N 151 G HOP3 H N N 152 G HOP2 H N N 153 G "H5'" H N N 154 G "H5''" H N N 155 G "H4'" H N N 156 G "H3'" H N N 157 G "HO3'" H N N 158 G "H2'" H N N 159 G "HO2'" H N N 160 G "H1'" H N N 161 G H8 H N N 162 G H1 H N N 163 G H21 H N N 164 G H22 H N N 165 GTP PG P N N 166 GTP O1G O N N 167 GTP O2G O N N 168 GTP O3G O N N 169 GTP O3B O N N 170 GTP PB P N N 171 GTP O1B O N N 172 GTP O2B O N N 173 GTP O3A O N N 174 GTP PA P N N 175 GTP O1A O N N 176 GTP O2A O N N 177 GTP "O5'" O N N 178 GTP "C5'" C N N 179 GTP "C4'" C N R 180 GTP "O4'" O N N 181 GTP "C3'" C N S 182 GTP "O3'" O N N 183 GTP "C2'" C N R 184 GTP "O2'" O N N 185 GTP "C1'" C N R 186 GTP N9 N Y N 187 GTP C8 C Y N 188 GTP N7 N Y N 189 GTP C5 C Y N 190 GTP C6 C N N 191 GTP O6 O N N 192 GTP N1 N N N 193 GTP C2 C N N 194 GTP N2 N N N 195 GTP N3 N N N 196 GTP C4 C Y N 197 GTP HOG2 H N N 198 GTP HOG3 H N N 199 GTP HOB2 H N N 200 GTP HOA2 H N N 201 GTP "H5'" H N N 202 GTP "H5''" H N N 203 GTP "H4'" H N N 204 GTP "H3'" H N N 205 GTP "HO3'" H N N 206 GTP "H2'" H N N 207 GTP "HO2'" H N N 208 GTP "H1'" H N N 209 GTP H8 H N N 210 GTP HN1 H N N 211 GTP HN21 H N N 212 GTP HN22 H N N 213 HOH O O N N 214 HOH H1 H N N 215 HOH H2 H N N 216 MG MG MG N N 217 U OP3 O N N 218 U P P N N 219 U OP1 O N N 220 U OP2 O N N 221 U "O5'" O N N 222 U "C5'" C N N 223 U "C4'" C N R 224 U "O4'" O N N 225 U "C3'" C N S 226 U "O3'" O N N 227 U "C2'" C N R 228 U "O2'" O N N 229 U "C1'" C N R 230 U N1 N N N 231 U C2 C N N 232 U O2 O N N 233 U N3 N N N 234 U C4 C N N 235 U O4 O N N 236 U C5 C N N 237 U C6 C N N 238 U HOP3 H N N 239 U HOP2 H N N 240 U "H5'" H N N 241 U "H5''" H N N 242 U "H4'" H N N 243 U "H3'" H N N 244 U "HO3'" H N N 245 U "H2'" H N N 246 U "HO2'" H N N 247 U "H1'" H N N 248 U H3 H N N 249 U H5 H N N 250 U H6 H N N 251 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 FH8 O4 C03 doub N N 76 FH8 C321 N2 sing N N 77 FH8 C03 O3 sing N N 78 FH8 C03 C15 sing N N 79 FH8 C16 C15 doub Y N 80 FH8 C16 C11 sing Y N 81 FH8 C32 C33 doub N N 82 FH8 C32 C31 sing N N 83 FH8 N2 C31 doub N N 84 FH8 N2 C311 sing N N 85 FH8 C15 C14 sing Y N 86 FH8 C33 C34 sing N N 87 FH8 C11 C12 doub Y N 88 FH8 C31 C36 sing N N 89 FH8 C14 C13 doub Y N 90 FH8 C34 C01 doub N N 91 FH8 C34 C35 sing N N 92 FH8 C12 C13 sing Y N 93 FH8 C12 C01 sing N N 94 FH8 C36 C35 doub N N 95 FH8 C13 C02 sing N N 96 FH8 C01 C24 sing N N 97 FH8 C35 O5 sing N N 98 FH8 O5 C25 sing N N 99 FH8 C02 O2 doub N N 100 FH8 C02 OE sing N N 101 FH8 C24 C25 doub Y N 102 FH8 C24 C23 sing Y N 103 FH8 C25 C26 sing Y N 104 FH8 C23 C22 doub Y N 105 FH8 C26 C21 doub Y N 106 FH8 C22 C21 sing Y N 107 FH8 C21 N3 sing N N 108 FH8 N3 C211 sing N N 109 FH8 N3 C221 sing N N 110 FH8 O3 H1 sing N N 111 FH8 OE H2 sing N N 112 FH8 C14 H14 sing N N 113 FH8 C16 H16 sing N N 114 FH8 C11 H11 sing N N 115 FH8 C33 H33 sing N N 116 FH8 C32 H32 sing N N 117 FH8 C311 H313 sing N N 118 FH8 C311 H311 sing N N 119 FH8 C311 H312 sing N N 120 FH8 C321 H321 sing N N 121 FH8 C321 H322 sing N N 122 FH8 C321 H323 sing N N 123 FH8 C36 H36 sing N N 124 FH8 C26 H26 sing N N 125 FH8 C211 H211 sing N N 126 FH8 C211 H212 sing N N 127 FH8 C211 H213 sing N N 128 FH8 C221 H221 sing N N 129 FH8 C221 H222 sing N N 130 FH8 C221 H223 sing N N 131 FH8 C22 H22 sing N N 132 FH8 C23 H23 sing N N 133 G OP3 P sing N N 134 G OP3 HOP3 sing N N 135 G P OP1 doub N N 136 G P OP2 sing N N 137 G P "O5'" sing N N 138 G OP2 HOP2 sing N N 139 G "O5'" "C5'" sing N N 140 G "C5'" "C4'" sing N N 141 G "C5'" "H5'" sing N N 142 G "C5'" "H5''" sing N N 143 G "C4'" "O4'" sing N N 144 G "C4'" "C3'" sing N N 145 G "C4'" "H4'" sing N N 146 G "O4'" "C1'" sing N N 147 G "C3'" "O3'" sing N N 148 G "C3'" "C2'" sing N N 149 G "C3'" "H3'" sing N N 150 G "O3'" "HO3'" sing N N 151 G "C2'" "O2'" sing N N 152 G "C2'" "C1'" sing N N 153 G "C2'" "H2'" sing N N 154 G "O2'" "HO2'" sing N N 155 G "C1'" N9 sing N N 156 G "C1'" "H1'" sing N N 157 G N9 C8 sing Y N 158 G N9 C4 sing Y N 159 G C8 N7 doub Y N 160 G C8 H8 sing N N 161 G N7 C5 sing Y N 162 G C5 C6 sing N N 163 G C5 C4 doub Y N 164 G C6 O6 doub N N 165 G C6 N1 sing N N 166 G N1 C2 sing N N 167 G N1 H1 sing N N 168 G C2 N2 sing N N 169 G C2 N3 doub N N 170 G N2 H21 sing N N 171 G N2 H22 sing N N 172 G N3 C4 sing N N 173 GTP PG O1G doub N N 174 GTP PG O2G sing N N 175 GTP PG O3G sing N N 176 GTP PG O3B sing N N 177 GTP O2G HOG2 sing N N 178 GTP O3G HOG3 sing N N 179 GTP O3B PB sing N N 180 GTP PB O1B doub N N 181 GTP PB O2B sing N N 182 GTP PB O3A sing N N 183 GTP O2B HOB2 sing N N 184 GTP O3A PA sing N N 185 GTP PA O1A doub N N 186 GTP PA O2A sing N N 187 GTP PA "O5'" sing N N 188 GTP O2A HOA2 sing N N 189 GTP "O5'" "C5'" sing N N 190 GTP "C5'" "C4'" sing N N 191 GTP "C5'" "H5'" sing N N 192 GTP "C5'" "H5''" sing N N 193 GTP "C4'" "O4'" sing N N 194 GTP "C4'" "C3'" sing N N 195 GTP "C4'" "H4'" sing N N 196 GTP "O4'" "C1'" sing N N 197 GTP "C3'" "O3'" sing N N 198 GTP "C3'" "C2'" sing N N 199 GTP "C3'" "H3'" sing N N 200 GTP "O3'" "HO3'" sing N N 201 GTP "C2'" "O2'" sing N N 202 GTP "C2'" "C1'" sing N N 203 GTP "C2'" "H2'" sing N N 204 GTP "O2'" "HO2'" sing N N 205 GTP "C1'" N9 sing N N 206 GTP "C1'" "H1'" sing N N 207 GTP N9 C8 sing Y N 208 GTP N9 C4 sing Y N 209 GTP C8 N7 doub Y N 210 GTP C8 H8 sing N N 211 GTP N7 C5 sing Y N 212 GTP C5 C6 sing N N 213 GTP C5 C4 doub Y N 214 GTP C6 O6 doub N N 215 GTP C6 N1 sing N N 216 GTP N1 C2 sing N N 217 GTP N1 HN1 sing N N 218 GTP C2 N2 sing N N 219 GTP C2 N3 doub N N 220 GTP N2 HN21 sing N N 221 GTP N2 HN22 sing N N 222 GTP N3 C4 sing N N 223 HOH O H1 sing N N 224 HOH O H2 sing N N 225 U OP3 P sing N N 226 U OP3 HOP3 sing N N 227 U P OP1 doub N N 228 U P OP2 sing N N 229 U P "O5'" sing N N 230 U OP2 HOP2 sing N N 231 U "O5'" "C5'" sing N N 232 U "C5'" "C4'" sing N N 233 U "C5'" "H5'" sing N N 234 U "C5'" "H5''" sing N N 235 U "C4'" "O4'" sing N N 236 U "C4'" "C3'" sing N N 237 U "C4'" "H4'" sing N N 238 U "O4'" "C1'" sing N N 239 U "C3'" "O3'" sing N N 240 U "C3'" "C2'" sing N N 241 U "C3'" "H3'" sing N N 242 U "O3'" "HO3'" sing N N 243 U "C2'" "O2'" sing N N 244 U "C2'" "C1'" sing N N 245 U "C2'" "H2'" sing N N 246 U "O2'" "HO2'" sing N N 247 U "C1'" N1 sing N N 248 U "C1'" "H1'" sing N N 249 U N1 C2 sing N N 250 U N1 C6 sing N N 251 U C2 O2 doub N N 252 U C2 N3 sing N N 253 U N3 C4 sing N N 254 U N3 H3 sing N N 255 U C4 O4 doub N N 256 U C4 C5 sing N N 257 U C5 C6 doub N N 258 U C5 H5 sing N N 259 U C6 H6 sing N N 260 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9X9N 'double helix' 9X9N 'a-form double helix' 9X9N 'hairpin loop' 9X9N tetraloop 9X9N 'bulge loop' 9X9N 'mismatched base pair' 9X9N 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 55 1_555 -1.340 -0.380 -0.116 2.178 -23.379 14.842 1 U_G2:C56_U U 2 ? U 56 ? 19 1 1 A A 2 1_555 A U 54 1_555 -0.654 -0.270 -0.204 -7.456 -14.018 2.237 2 U_A3:U55_U U 3 ? U 55 ? 20 1 1 A A 3 1_555 A U 53 1_555 0.529 -0.245 -0.226 -5.116 -15.579 3.198 3 U_A4:U54_U U 4 ? U 54 ? 20 1 1 A C 4 1_555 A G 52 1_555 -0.044 -0.314 -0.181 2.553 -19.529 4.050 4 U_C5:G53_U U 5 ? U 53 ? 19 1 1 A C 5 1_555 A G 51 1_555 -0.080 -0.164 0.375 -4.708 -19.684 2.727 5 U_C6:G52_U U 6 ? U 52 ? 19 1 1 A U 6 1_555 A A 50 1_555 -0.200 -0.168 0.514 3.617 -7.466 -10.460 6 U_U7:A51_U U 7 ? U 51 ? 20 1 1 A G 28 1_555 A C 49 1_555 -0.583 -0.127 -0.556 -2.629 -1.773 11.156 7 U_G29:C50_U U 29 ? U 50 ? 19 1 1 A A 29 1_555 A U 48 1_555 -0.647 -0.037 -0.294 -17.807 -12.287 10.782 8 U_A30:U49_U U 30 ? U 49 ? 20 1 1 A G 30 1_555 A C 47 1_555 0.585 -0.296 0.013 -14.809 -7.939 -4.540 9 U_G31:C48_U U 31 ? U 48 ? 19 1 1 A G 31 1_555 A C 46 1_555 0.321 -0.201 0.209 -4.499 -14.360 0.595 10 U_G32:C47_U U 32 ? U 47 ? 19 1 1 A C 32 1_555 A G 45 1_555 0.531 -0.457 -0.166 3.130 -18.012 -3.989 11 U_C33:G46_U U 33 ? U 46 ? 19 1 1 A G 33 1_555 A C 44 1_555 0.188 -0.350 -0.165 -3.384 -4.007 3.144 12 U_G34:C45_U U 34 ? U 45 ? 19 1 1 A C 34 1_555 A G 26 1_555 -0.448 -0.420 -0.216 -4.510 -0.748 -1.648 13 U_C35:G27_U U 35 ? U 27 ? 19 1 1 A A 15 1_555 A G 12 1_555 -7.033 -5.003 1.046 -14.079 3.309 -21.726 14 U_A16:G13_U U 16 ? U 13 ? ? ? 1 A G 16 1_555 A C 11 1_555 0.360 -0.154 -0.188 1.013 -5.190 3.361 15 U_G17:C12_U U 17 ? U 12 ? 19 1 1 A G 17 1_555 A C 10 1_555 -0.489 -0.092 -0.072 1.103 -8.227 11.277 16 U_G18:C11_U U 18 ? U 11 ? 19 1 1 A C 18 1_555 A G 9 1_555 -0.707 -0.190 0.710 -10.007 -9.767 -0.537 17 U_C19:G10_U U 19 ? U 10 ? 19 1 1 A G 19 1_555 A C 8 1_555 0.252 -0.512 0.292 -4.265 -12.503 -4.960 18 U_G20:C9_U U 20 ? U 9 ? 19 1 1 A G 20 1_555 A C 7 1_555 -0.256 -0.282 0.260 -10.767 -17.719 3.380 19 U_G21:C8_U U 21 ? U 8 ? 19 1 1 A U 21 1_555 A A 27 1_555 -0.296 -0.011 0.401 -12.058 -16.262 0.016 20 U_U22:A28_U U 22 ? U 28 ? 20 1 1 A G 22 1_555 A C 43 1_555 0.511 -0.308 -0.628 -10.455 6.025 -3.107 21 U_G23:C44_U U 23 ? U 44 ? 19 1 1 A G 25 1_555 A A 42 1_555 6.894 -4.238 0.054 -22.742 -22.051 7.262 22 U_G26:A43_U U 26 ? U 43 ? 11 10 1 A A 23 1_555 A A 41 1_555 4.310 0.904 0.270 -3.367 -5.932 -113.377 23 U_A24:A42_U U 24 ? U 42 ? 5 4 1 A G 38 1_555 A U 40 1_555 3.056 1.035 -1.432 31.895 56.030 100.501 24 U_G39:U41_U U 39 ? U 41 ? ? 5 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 55 1_555 A A 2 1_555 A U 54 1_555 -0.312 -1.014 3.469 -5.368 13.795 35.390 -3.306 -0.209 2.905 21.565 8.392 38.269 1 UU_G2A3:U55C56_UU U 2 ? U 56 ? U 3 ? U 55 ? 1 A A 2 1_555 A U 54 1_555 A A 3 1_555 A U 53 1_555 -0.283 -0.859 3.220 -0.195 6.463 39.214 -1.989 0.395 3.048 9.550 0.288 39.722 2 UU_A3A4:U54U55_UU U 3 ? U 55 ? U 4 ? U 54 ? 1 A A 3 1_555 A U 53 1_555 A C 4 1_555 A G 52 1_555 0.341 -1.319 2.987 0.670 3.825 30.312 -3.179 -0.528 2.810 7.276 -1.274 30.554 3 UU_A4C5:G53U54_UU U 4 ? U 54 ? U 5 ? U 53 ? 1 A C 4 1_555 A G 52 1_555 A C 5 1_555 A G 51 1_555 -0.231 -1.376 3.403 -0.867 7.471 34.153 -3.418 0.255 3.048 12.533 1.455 34.948 4 UU_C5C6:G52G53_UU U 5 ? U 53 ? U 6 ? U 52 ? 1 A C 5 1_555 A G 51 1_555 A U 6 1_555 A A 50 1_555 -0.182 -1.485 3.060 1.831 8.034 30.890 -3.978 0.622 2.587 14.756 -3.363 31.944 5 UU_C6U7:A51G52_UU U 6 ? U 52 ? U 7 ? U 51 ? 1 A U 6 1_555 A A 50 1_555 A G 28 1_555 A C 49 1_555 0.206 -1.830 3.361 7.104 13.858 38.261 -4.014 0.432 2.572 20.155 -10.332 41.198 6 UU_U7G29:C50A51_UU U 7 ? U 51 ? U 29 ? U 50 ? 1 A G 28 1_555 A C 49 1_555 A A 29 1_555 A U 48 1_555 0.232 -1.955 3.238 -1.377 14.881 36.833 -4.413 -0.484 2.300 22.450 2.077 39.651 7 UU_G29A30:U49C50_UU U 29 ? U 50 ? U 30 ? U 49 ? 1 A A 29 1_555 A U 48 1_555 A G 30 1_555 A C 47 1_555 -1.120 -1.559 3.093 -2.628 5.207 35.791 -3.181 1.459 2.917 8.404 4.241 36.248 8 UU_A30G31:C48U49_UU U 30 ? U 49 ? U 31 ? U 48 ? 1 A G 30 1_555 A C 47 1_555 A G 31 1_555 A C 46 1_555 0.051 -1.241 2.957 1.362 8.444 33.093 -3.262 0.099 2.572 14.525 -2.342 34.150 9 UU_G31G32:C47C48_UU U 31 ? U 48 ? U 32 ? U 47 ? 1 A G 31 1_555 A C 46 1_555 A C 32 1_555 A G 45 1_555 0.481 -1.271 2.991 4.946 4.157 32.424 -2.870 -0.091 2.851 7.354 -8.750 33.045 10 UU_G32C33:G46C47_UU U 32 ? U 47 ? U 33 ? U 46 ? 1 A C 32 1_555 A G 45 1_555 A G 33 1_555 A C 44 1_555 0.714 -1.663 3.338 1.852 11.984 28.638 -5.249 -1.002 2.498 22.970 -3.550 31.050 11 UU_C33G34:C45G46_UU U 33 ? U 46 ? U 34 ? U 45 ? 1 A G 33 1_555 A C 44 1_555 A C 34 1_555 A G 26 1_555 2.061 -1.350 3.227 6.569 -4.998 46.189 -1.262 -2.020 3.591 -6.312 -8.295 46.881 12 UU_G34C35:G27C45_UU U 34 ? U 45 ? U 35 ? U 27 ? 1 A A 15 1_555 A G 12 1_555 A G 16 1_555 A C 11 1_555 2.500 -1.161 2.813 6.829 6.600 51.648 -1.697 -2.431 2.940 7.503 -7.763 52.455 13 UU_A16G17:C12G13_UU U 16 ? U 13 ? U 17 ? U 12 ? 1 A G 16 1_555 A C 11 1_555 A G 17 1_555 A C 10 1_555 0.121 -1.759 3.002 -1.699 9.287 27.116 -5.289 -0.563 2.275 19.089 3.492 28.683 14 UU_G17G18:C11C12_UU U 17 ? U 12 ? U 18 ? U 11 ? 1 A G 17 1_555 A C 10 1_555 A C 18 1_555 A G 9 1_555 -0.477 -1.866 3.513 -4.929 6.392 33.690 -4.154 0.017 3.153 10.837 8.356 34.616 15 UU_G18C19:G10C11_UU U 18 ? U 11 ? U 19 ? U 10 ? 1 A C 18 1_555 A G 9 1_555 A G 19 1_555 A C 8 1_555 0.064 -2.196 2.892 3.338 2.429 29.525 -4.704 0.473 2.697 4.737 -6.510 29.806 16 UU_C19G20:C9G10_UU U 19 ? U 10 ? U 20 ? U 9 ? 1 A G 19 1_555 A C 8 1_555 A G 20 1_555 A C 7 1_555 0.578 -1.555 3.112 2.075 9.193 35.425 -3.611 -0.663 2.667 14.787 -3.338 36.619 17 UU_G20G21:C8C9_UU U 20 ? U 9 ? U 21 ? U 8 ? 1 A G 20 1_555 A C 7 1_555 A U 21 1_555 A A 27 1_555 -0.328 -1.418 3.431 5.457 -8.255 31.734 -0.964 1.576 3.574 -14.657 -9.689 33.203 18 UU_G21U22:A28C8_UU U 21 ? U 8 ? U 22 ? U 28 ? 1 A U 21 1_555 A A 27 1_555 A G 22 1_555 A C 43 1_555 2.529 0.751 3.054 20.997 4.270 48.060 0.540 -1.336 3.830 4.966 -24.420 52.360 19 UU_U22G23:C44A28_UU U 22 ? U 28 ? U 23 ? U 44 ? 1 A G 22 1_555 A C 43 1_555 A G 25 1_555 A A 42 1_555 0.227 -0.221 4.009 10.971 31.532 63.236 -1.565 0.282 3.576 28.117 -9.783 70.691 20 UU_G23G26:A43C44_UU U 23 ? U 44 ? U 26 ? U 43 ? 1 A G 25 1_555 A A 42 1_555 A A 23 1_555 A A 41 1_555 -1.864 0.135 2.954 0.292 6.724 -15.589 -4.385 -6.145 2.694 -23.418 1.017 -16.972 21 UU_G26A24:A42A43_UU U 26 ? U 43 ? U 24 ? U 42 ? 1 A A 23 1_555 A A 41 1_555 A G 38 1_555 A U 40 1_555 0.863 0.820 6.666 22.825 -16.207 122.172 0.754 -0.080 6.638 -9.203 -12.960 124.043 22 UU_A24G39:U41A42_UU U 24 ? U 42 ? U 39 ? U 41 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code pdb_00009l8f _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9X9N _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012094 _atom_sites.fract_transf_matrix[1][2] 0.006982 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013965 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009421 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #