data_9XAL # _entry.id 9XAL # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9XAL pdb_00009xal 10.2210/pdb9xal/pdb WWPDB D_1300064993 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-28 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9XAL _pdbx_database_status.recvd_initial_deposition_date 2025-10-22 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible N # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Ren _pdbx_contact_author.name_last Aiming _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of RhoBAST-G38A in complex of TMR-DN' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (57-MER)' 18478.107 1 ? ? ? ? 2 non-polymer syn ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; 727.740 1 ? ? ? ? 3 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 4 water nat water 18.015 12 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAAGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_seq_one_letter_code_can GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAAGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; A1EZE 3 'MAGNESIUM ION' MG 4 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 C n 1 7 U n 1 8 C n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 G n 1 18 G n 1 19 C n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 G n 1 32 G n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 A n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 57 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 A1EZE non-polymer . ;[9-[2-carboxy-4-[2-[2-[2-[(2,4-dinitrophenyl)amino]ethoxy]ethoxy]ethylcarbamoyl]phenyl]-6-(dimethylamino)xanthen-3-ylidene]-dimethyl-azanium ; ? 'C37 H39 N6 O10 1' 727.740 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 1 1 G G B . n A 1 2 G 2 2 2 G G B . n A 1 3 A 3 3 3 A A B . n A 1 4 A 4 4 4 A A B . n A 1 5 C 5 5 5 C C B . n A 1 6 C 6 6 6 C C B . n A 1 7 U 7 7 7 U U B . n A 1 8 C 8 8 8 C C B . n A 1 9 C 9 9 9 C C B . n A 1 10 G 10 10 10 G G B . n A 1 11 C 11 11 11 C C B . n A 1 12 C 12 12 12 C C B . n A 1 13 G 13 13 13 G G B . n A 1 14 A 14 14 14 A A B . n A 1 15 A 15 15 15 A A B . n A 1 16 A 16 16 16 A A B . n A 1 17 G 17 17 17 G G B . n A 1 18 G 18 18 18 G G B . n A 1 19 C 19 19 19 C C B . n A 1 20 G 20 20 20 G G B . n A 1 21 G 21 21 21 G G B . n A 1 22 U 22 22 22 U U B . n A 1 23 G 23 23 23 G G B . n A 1 24 A 24 24 24 A A B . n A 1 25 A 25 25 25 A A B . n A 1 26 G 26 26 26 G G B . n A 1 27 G 27 27 27 G G B . n A 1 28 A 28 28 28 A A B . n A 1 29 G 29 29 29 G G B . n A 1 30 A 30 30 30 A A B . n A 1 31 G 31 31 31 G G B . n A 1 32 G 32 32 32 G G B . n A 1 33 C 33 33 33 C C B . n A 1 34 G 34 34 34 G G B . n A 1 35 C 35 35 35 C C B . n A 1 36 A 36 36 36 A A B . n A 1 37 A 37 37 37 A A B . n A 1 38 A 38 38 38 A A B . n A 1 39 G 39 39 39 G G B . n A 1 40 U 40 40 40 U U B . n A 1 41 U 41 41 41 U U B . n A 1 42 A 42 42 42 A A B . n A 1 43 A 43 43 43 A A B . n A 1 44 C 44 44 44 C C B . n A 1 45 C 45 45 45 C C B . n A 1 46 G 46 46 46 G G B . n A 1 47 C 47 47 47 C C B . n A 1 48 C 48 48 48 C C B . n A 1 49 U 49 49 49 U U B . n A 1 50 C 50 50 50 C C B . n A 1 51 A 51 51 51 A A B . n A 1 52 G 52 52 52 G G B . n A 1 53 G 53 53 53 G G B . n A 1 54 U 54 54 54 U U B . n A 1 55 U 55 55 55 U U B . n A 1 56 C 56 56 56 C C B . n A 1 57 C 57 57 57 C C B . n # _pdbx_entity_instance_feature.ordinal 1 _pdbx_entity_instance_feature.comp_id A1EZE _pdbx_entity_instance_feature.asym_id ? _pdbx_entity_instance_feature.seq_num ? _pdbx_entity_instance_feature.auth_comp_id A1EZE _pdbx_entity_instance_feature.auth_asym_id ? _pdbx_entity_instance_feature.auth_seq_num ? _pdbx_entity_instance_feature.feature_type 'SUBJECT OF INVESTIGATION' _pdbx_entity_instance_feature.details ? # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 A1EZE 1 101 101 A1EZE LIG B . C 3 MG 1 102 1 MG MG B . D 4 HOH 1 201 8 HOH HOH B . D 4 HOH 2 202 7 HOH HOH B . D 4 HOH 3 203 4 HOH HOH B . D 4 HOH 4 204 5 HOH HOH B . D 4 HOH 5 205 6 HOH HOH B . D 4 HOH 6 206 12 HOH HOH B . D 4 HOH 7 207 10 HOH HOH B . D 4 HOH 8 208 9 HOH HOH B . D 4 HOH 9 209 2 HOH HOH B . D 4 HOH 10 210 11 HOH HOH B . D 4 HOH 11 211 1 HOH HOH B . D 4 HOH 12 212 3 HOH HOH B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? HKL-3000 ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9XAL _cell.details ? _cell.formula_units_Z ? _cell.length_a 83.987 _cell.length_a_esd ? _cell.length_b 83.987 _cell.length_b_esd ? _cell.length_c 106.718 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9XAL _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9XAL _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.94 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 58.16 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details ;Lithium chloride, Strontium chloride hexahydrate, Sodium cacodylate trihydrate pH 7.0, (+/-)-2-Methyl-2,4-pentanediol, Spermine tetrahydrochloride ; _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-07-04 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97853 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL18U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97853 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL18U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9XAL _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.75 _reflns.d_resolution_low 30.00 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 6203 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 100.0 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 36.1 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 3.5 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared 2.002 _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all 0.284 _reflns.pdbx_Rpim_I_all 0.047 _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.976 _reflns.pdbx_CC_star 0.994 _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # loop_ _reflns_shell.d_res_high _reflns_shell.d_res_low _reflns_shell.meanI_over_sigI_all _reflns_shell.meanI_over_sigI_obs _reflns_shell.number_measured_all _reflns_shell.number_measured_obs _reflns_shell.number_possible _reflns_shell.number_unique_all _reflns_shell.number_unique_obs _reflns_shell.percent_possible_obs _reflns_shell.Rmerge_F_all _reflns_shell.Rmerge_F_obs _reflns_shell.meanI_over_sigI_gt _reflns_shell.meanI_over_uI_all _reflns_shell.meanI_over_uI_gt _reflns_shell.number_measured_gt _reflns_shell.number_unique_gt _reflns_shell.percent_possible_gt _reflns_shell.Rmerge_F_gt _reflns_shell.Rmerge_I_gt _reflns_shell.pdbx_redundancy _reflns_shell.pdbx_chi_squared _reflns_shell.pdbx_netI_over_sigmaI_all _reflns_shell.pdbx_netI_over_sigmaI_obs _reflns_shell.pdbx_Rrim_I_all _reflns_shell.pdbx_Rpim_I_all _reflns_shell.pdbx_rejects _reflns_shell.pdbx_ordinal _reflns_shell.pdbx_diffrn_id _reflns_shell.pdbx_CC_half _reflns_shell.pdbx_CC_star _reflns_shell.pdbx_R_split _reflns_shell.percent_possible_all _reflns_shell.Rmerge_I_all _reflns_shell.Rmerge_I_obs _reflns_shell.pdbx_Rsym_value _reflns_shell.pdbx_percent_possible_ellipsoidal _reflns_shell.pdbx_percent_possible_spherical _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous _reflns_shell.pdbx_percent_possible_spherical_anomalous _reflns_shell.pdbx_redundancy_anomalous _reflns_shell.pdbx_CC_half_anomalous _reflns_shell.pdbx_absDiff_over_sigma_anomalous _reflns_shell.pdbx_percent_possible_anomalous 2.75 2.80 ? ? ? ? ? ? 311 ? ? ? ? ? ? ? ? ? ? ? ? 0.463 ? ? ? 0.518 ? 1 1 0.643 0.885 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.80 2.85 ? ? ? ? ? ? 282 ? ? ? ? ? ? ? ? ? ? ? ? 0.474 ? ? ? 0.410 ? 2 1 0.864 0.963 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.85 2.90 ? ? ? ? ? ? 305 ? ? ? ? ? ? ? ? ? ? ? ? 0.506 ? ? ? 0.323 ? 3 1 0.889 0.970 ? 100.0 ? ? ? ? ? ? ? ? ? ? ? 2.90 2.96 ? ? ? ? ? ? 299 ? ? ? ? ? ? ? ? ? ? ? ? 0.511 ? ? ? 0.214 ? 4 1 0.964 0.991 ? 100.0 ? 1.285 ? ? ? ? ? ? ? ? ? 2.96 3.03 ? ? ? ? ? ? 292 ? ? ? ? ? ? ? ? ? ? ? ? 0.590 ? ? 0.992 0.158 ? 5 1 0.968 0.992 ? 100.0 ? 0.979 ? ? ? ? ? ? ? ? ? 3.03 3.10 ? ? ? ? ? ? 303 ? ? ? ? ? ? ? ? ? ? ? ? 0.655 ? ? 0.620 0.099 ? 6 1 0.987 0.997 ? 100.0 ? 0.612 ? ? ? ? ? ? ? ? ? 3.10 3.17 ? ? ? ? ? ? 300 ? ? ? ? ? ? ? ? ? ? ? ? 0.764 ? ? 0.486 0.077 ? 7 1 0.991 0.998 ? 100.0 ? 0.479 ? ? ? ? ? ? ? ? ? 3.17 3.26 ? ? ? ? ? ? 304 ? ? ? ? ? ? ? ? ? ? ? ? 0.804 ? ? 0.390 0.062 ? 8 1 0.990 0.998 ? 100.0 ? 0.385 ? ? ? ? ? ? ? ? ? 3.26 3.36 ? ? ? ? ? ? 306 ? ? ? ? ? ? ? ? ? ? ? ? 0.983 ? ? 0.335 0.053 ? 9 1 0.993 0.998 ? 100.0 ? 0.331 ? ? ? ? ? ? ? ? ? 3.36 3.46 ? ? ? ? ? ? 303 ? ? ? ? ? ? ? ? ? ? ? ? 2.509 ? ? 0.648 0.106 ? 10 1 0.986 0.997 ? 100.0 ? 0.640 ? ? ? ? ? ? ? ? ? 3.46 3.59 ? ? ? ? ? ? 301 ? ? ? ? ? ? ? ? ? ? ? ? 1.169 ? ? 0.309 0.051 ? 11 1 0.991 0.998 ? 100.0 ? 0.304 ? ? ? ? ? ? ? ? ? 3.59 3.73 ? ? ? ? ? ? 303 ? ? ? ? ? ? ? ? ? ? ? ? 2.088 ? ? 0.522 0.082 ? 12 1 0.987 0.997 ? 100.0 ? 0.516 ? ? ? ? ? ? ? ? ? 3.73 3.90 ? ? ? ? ? ? 312 ? ? ? ? ? ? ? ? ? ? ? ? 2.427 ? ? 0.548 0.088 ? 13 1 0.992 0.998 ? 100.0 ? 0.541 ? ? ? ? ? ? ? ? ? 3.90 4.11 ? ? ? ? ? ? 310 ? ? ? ? ? ? ? ? ? ? ? ? 1.409 ? ? 0.215 0.035 ? 14 1 0.993 0.998 ? 100.0 ? 0.212 ? ? ? ? ? ? ? ? ? 4.11 4.36 ? ? ? ? ? ? 306 ? ? ? ? ? ? ? ? ? ? ? ? 1.559 ? ? 0.189 0.030 ? 15 1 0.990 0.998 ? 100.0 ? 0.187 ? ? ? ? ? ? ? ? ? 4.36 4.70 ? ? ? ? ? ? 319 ? ? ? ? ? ? ? ? ? ? ? ? 1.935 ? ? 0.172 0.028 ? 16 1 0.993 0.998 ? 100.0 ? 0.169 ? ? ? ? ? ? ? ? ? 4.70 5.17 ? ? ? ? ? ? 318 ? ? ? ? ? ? ? ? ? ? ? ? 2.769 ? ? 0.175 0.029 ? 17 1 0.984 0.996 ? 100.0 ? 0.172 ? ? ? ? ? ? ? ? ? 5.17 5.91 ? ? ? ? ? ? 321 ? ? ? ? ? ? ? ? ? ? ? ? 2.336 ? ? 0.146 0.024 ? 18 1 0.992 0.998 ? 100.0 ? 0.144 ? ? ? ? ? ? ? ? ? 5.91 7.43 ? ? ? ? ? ? 331 ? ? ? ? ? ? ? ? ? ? ? ? 4.128 ? ? 0.153 0.026 ? 19 1 0.988 0.997 ? 100.0 ? 0.151 ? ? ? ? ? ? ? ? ? 7.43 30.00 ? ? ? ? ? ? 377 ? ? ? ? ? ? ? ? ? ? ? ? 11.674 ? ? 0.211 0.038 ? 20 1 0.979 0.995 ? 100.0 ? 0.208 ? ? ? ? ? ? ? ? ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9XAL _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.75 _refine.ls_d_res_low 27.49 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 6152 _refine.ls_number_reflns_R_free 616 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.64 _refine.ls_percent_reflns_R_free 10.01 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2198 _refine.ls_R_factor_R_free 0.2670 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2147 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.36 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 29.14 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.45 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1227 _refine_hist.pdbx_number_atoms_ligand 54 _refine_hist.number_atoms_solvent 12 _refine_hist.number_atoms_total 1293 _refine_hist.d_res_high 2.75 _refine_hist.d_res_low 27.49 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.004 ? 1431 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 0.868 ? 2222 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 13.877 ? 727 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.044 ? 285 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.007 ? 87 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.75 3.03 . . 148 1332 99.00 . . . . 0.3705 . . . . . . . . . . . . . . . 0.4250 'X-RAY DIFFRACTION' 3.03 3.47 . . 151 1356 100.00 . . . . 0.2416 . . . . . . . . . . . . . . . 0.2634 'X-RAY DIFFRACTION' 3.47 4.37 . . 152 1376 100.00 . . . . 0.2074 . . . . . . . . . . . . . . . 0.2671 'X-RAY DIFFRACTION' 4.37 27.49 . . 165 1472 99.00 . . . . 0.1863 . . . . . . . . . . . . . . . 0.2445 # _struct.entry_id 9XAL _struct.title 'Crystal structure of RhoBAST-G38A in complex of TMR-DN' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9XAL _struct_keywords.text 'aptamer, RhoBAST, TMR-DN, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? D N N 4 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9XAL _struct_ref.pdbx_db_accession 9XAL _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9XAL _struct_ref_seq.pdbx_strand_id B _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9XAL _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 70 ? 1 MORE -4 ? 1 'SSA (A^2)' 10040 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A,B,C,D # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation x,y,z _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role metalc1 metalc ? ? A G 1 OP2 ? ? ? 1_555 C MG . MG ? ? B G 1 B MG 102 1_555 ? ? ? ? ? ? ? 2.702 ? ? hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 57 N3 ? ? B G 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 57 O2 ? ? B G 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 57 N4 ? ? B G 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 55 N3 ? ? B A 3 B U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 55 O4 ? ? B A 3 B U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 54 N3 ? ? B A 4 B U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 54 O4 ? ? B A 4 B U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 53 N1 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 53 O6 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 53 N2 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 52 N1 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 52 O6 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 52 N2 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 51 N1 ? ? B U 7 B A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 51 N6 ? ? B U 7 B A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 20 N1 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 20 O6 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 20 N2 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 18 N1 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 18 O6 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 18 N2 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? B G 13 B A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog35 hydrog ? ? A G 13 N3 ? ? ? 1_555 A A 16 N6 ? ? B G 13 B A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog36 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? B U 22 B A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? B U 22 B A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 24 N1 ? ? ? 1_555 A A 42 N6 ? ? B A 24 B A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 42 N7 ? ? B A 24 B A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog43 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 43 N7 ? ? B G 26 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog44 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 43 N6 ? ? B G 26 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog45 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 35 N3 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 35 O2 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 35 N4 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 50 N3 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 29 N2 ? ? ? 1_555 A C 50 O2 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 29 O6 ? ? ? 1_555 A C 50 N4 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 49 N3 ? ? B A 30 B U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 49 O4 ? ? B A 30 B U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 48 N3 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 48 O2 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 48 N4 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 47 N3 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 47 O2 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 46 N1 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 46 O6 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 46 N2 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference metalc ? ? hydrog ? ? # _pdbx_entry_details.entry_id 9XAL _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest Y _pdbx_entry_details.has_protein_modification N # _pdbx_validate_close_contact.id 1 _pdbx_validate_close_contact.PDB_model_num 1 _pdbx_validate_close_contact.auth_atom_id_1 OP2 _pdbx_validate_close_contact.auth_asym_id_1 B _pdbx_validate_close_contact.auth_comp_id_1 C _pdbx_validate_close_contact.auth_seq_id_1 6 _pdbx_validate_close_contact.PDB_ins_code_1 ? _pdbx_validate_close_contact.label_alt_id_1 ? _pdbx_validate_close_contact.auth_atom_id_2 O _pdbx_validate_close_contact.auth_asym_id_2 B _pdbx_validate_close_contact.auth_comp_id_2 HOH _pdbx_validate_close_contact.auth_seq_id_2 201 _pdbx_validate_close_contact.PDB_ins_code_2 ? _pdbx_validate_close_contact.label_alt_id_2 ? _pdbx_validate_close_contact.dist 2.15 # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 4.2905 _pdbx_refine_tls.origin_y -31.0793 _pdbx_refine_tls.origin_z -0.4624 _pdbx_refine_tls.T[1][1] 0.6888 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.1738 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0282 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.9023 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.2209 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.6387 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 3.2063 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 1.2102 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.3851 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] -0.4663 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.9011 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.4821 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] 0.1195 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.1351 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.2345 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.0461 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] -0.0288 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.2732 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.4621 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.1235 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.1209 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 A1EZE C4 C N N 38 A1EZE C5 C N N 39 A1EZE C6 C N N 40 A1EZE C7 C N N 41 A1EZE C8 C N N 42 A1EZE C10 C Y N 43 A1EZE C13 C Y N 44 A1EZE C17 C N N 45 A1EZE C20 C N N 46 A1EZE C22 C N N 47 A1EZE C26 C Y N 48 A1EZE C28 C Y N 49 A1EZE C1 C N N 50 A1EZE C11 C Y N 51 A1EZE C12 C Y N 52 A1EZE C14 C N N 53 A1EZE C16 C N N 54 A1EZE C19 C N N 55 A1EZE C23 C N N 56 A1EZE C25 C Y N 57 A1EZE C27 C Y N 58 A1EZE C3 C N N 59 A1EZE C32 C Y N 60 A1EZE C33 C Y N 61 A1EZE C38 C Y N 62 A1EZE C39 C Y N 63 A1EZE C40 C N N 64 A1EZE C43 C Y N 65 A1EZE C44 C Y N 66 A1EZE C45 C Y N 67 A1EZE C46 C Y N 68 A1EZE C47 C Y N 69 A1EZE C48 C Y N 70 A1EZE C51 C N N 71 A1EZE C52 C N N 72 A1EZE C53 C N N 73 A1EZE C9 C N N 74 A1EZE N15 N N N 75 A1EZE N2 N N N 76 A1EZE N24 N N N 77 A1EZE N29 N N N 78 A1EZE N34 N N N 79 A1EZE N50 N N N 80 A1EZE O18 O N N 81 A1EZE O21 O N N 82 A1EZE O30 O N N 83 A1EZE O31 O N N 84 A1EZE O35 O N N 85 A1EZE O36 O N N 86 A1EZE O37 O N N 87 A1EZE O41 O N N 88 A1EZE O42 O N N 89 A1EZE O49 O N N 90 A1EZE H1 H N N 91 A1EZE H2 H N N 92 A1EZE H3 H N N 93 A1EZE H4 H N N 94 A1EZE H5 H N N 95 A1EZE H6 H N N 96 A1EZE H7 H N N 97 A1EZE H8 H N N 98 A1EZE H9 H N N 99 A1EZE H10 H N N 100 A1EZE H11 H N N 101 A1EZE H12 H N N 102 A1EZE H13 H N N 103 A1EZE H14 H N N 104 A1EZE H15 H N N 105 A1EZE H16 H N N 106 A1EZE H17 H N N 107 A1EZE H18 H N N 108 A1EZE H19 H N N 109 A1EZE H20 H N N 110 A1EZE H21 H N N 111 A1EZE H22 H N N 112 A1EZE H23 H N N 113 A1EZE H24 H N N 114 A1EZE H25 H N N 115 A1EZE H26 H N N 116 A1EZE H27 H N N 117 A1EZE H28 H N N 118 A1EZE H29 H N N 119 A1EZE H30 H N N 120 A1EZE H31 H N N 121 A1EZE H32 H N N 122 A1EZE H33 H N N 123 A1EZE H34 H N N 124 A1EZE H35 H N N 125 A1EZE H36 H N N 126 A1EZE H37 H N N 127 A1EZE H38 H N N 128 A1EZE H39 H N N 129 C OP3 O N N 130 C P P N N 131 C OP1 O N N 132 C OP2 O N N 133 C "O5'" O N N 134 C "C5'" C N N 135 C "C4'" C N R 136 C "O4'" O N N 137 C "C3'" C N S 138 C "O3'" O N N 139 C "C2'" C N R 140 C "O2'" O N N 141 C "C1'" C N R 142 C N1 N N N 143 C C2 C N N 144 C O2 O N N 145 C N3 N N N 146 C C4 C N N 147 C N4 N N N 148 C C5 C N N 149 C C6 C N N 150 C HOP3 H N N 151 C HOP2 H N N 152 C "H5'" H N N 153 C "H5''" H N N 154 C "H4'" H N N 155 C "H3'" H N N 156 C "HO3'" H N N 157 C "H2'" H N N 158 C "HO2'" H N N 159 C "H1'" H N N 160 C H41 H N N 161 C H42 H N N 162 C H5 H N N 163 C H6 H N N 164 G OP3 O N N 165 G P P N N 166 G OP1 O N N 167 G OP2 O N N 168 G "O5'" O N N 169 G "C5'" C N N 170 G "C4'" C N R 171 G "O4'" O N N 172 G "C3'" C N S 173 G "O3'" O N N 174 G "C2'" C N R 175 G "O2'" O N N 176 G "C1'" C N R 177 G N9 N Y N 178 G C8 C Y N 179 G N7 N Y N 180 G C5 C Y N 181 G C6 C N N 182 G O6 O N N 183 G N1 N N N 184 G C2 C N N 185 G N2 N N N 186 G N3 N N N 187 G C4 C Y N 188 G HOP3 H N N 189 G HOP2 H N N 190 G "H5'" H N N 191 G "H5''" H N N 192 G "H4'" H N N 193 G "H3'" H N N 194 G "HO3'" H N N 195 G "H2'" H N N 196 G "HO2'" H N N 197 G "H1'" H N N 198 G H8 H N N 199 G H1 H N N 200 G H21 H N N 201 G H22 H N N 202 HOH O O N N 203 HOH H1 H N N 204 HOH H2 H N N 205 MG MG MG N N 206 U OP3 O N N 207 U P P N N 208 U OP1 O N N 209 U OP2 O N N 210 U "O5'" O N N 211 U "C5'" C N N 212 U "C4'" C N R 213 U "O4'" O N N 214 U "C3'" C N S 215 U "O3'" O N N 216 U "C2'" C N R 217 U "O2'" O N N 218 U "C1'" C N R 219 U N1 N N N 220 U C2 C N N 221 U O2 O N N 222 U N3 N N N 223 U C4 C N N 224 U O4 O N N 225 U C5 C N N 226 U C6 C N N 227 U HOP3 H N N 228 U HOP2 H N N 229 U "H5'" H N N 230 U "H5''" H N N 231 U "H4'" H N N 232 U "H3'" H N N 233 U "HO3'" H N N 234 U "H2'" H N N 235 U "HO2'" H N N 236 U "H1'" H N N 237 U H3 H N N 238 U H5 H N N 239 U H6 H N N 240 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 A1EZE C17 C16 sing N N 40 A1EZE C17 O18 sing N N 41 A1EZE C16 N15 sing N N 42 A1EZE O37 C14 doub N N 43 A1EZE O18 C19 sing N N 44 A1EZE C14 N15 sing N N 45 A1EZE C14 C13 sing N N 46 A1EZE C12 C13 doub Y N 47 A1EZE C12 C11 sing Y N 48 A1EZE C13 C38 sing Y N 49 A1EZE C19 C20 sing N N 50 A1EZE C20 O21 sing N N 51 A1EZE O21 C22 sing N N 52 A1EZE C11 C10 doub Y N 53 A1EZE O30 N29 doub N N 54 A1EZE C38 C39 doub Y N 55 A1EZE C27 C26 doub Y N 56 A1EZE C27 C28 sing Y N 57 A1EZE C23 C22 sing N N 58 A1EZE C23 N24 sing N N 59 A1EZE C26 C25 sing Y N 60 A1EZE C8 C7 doub N N 61 A1EZE C8 C3 sing N N 62 A1EZE C53 N2 sing N N 63 A1EZE C7 C6 sing N N 64 A1EZE C10 C39 sing Y N 65 A1EZE C10 C9 sing N N 66 A1EZE N29 C28 sing N N 67 A1EZE N29 O31 doub N N 68 A1EZE C39 C40 sing N N 69 A1EZE C28 C32 doub Y N 70 A1EZE N2 C3 doub N N 71 A1EZE N2 C1 sing N N 72 A1EZE C3 C4 sing N N 73 A1EZE C6 C9 doub N N 74 A1EZE C6 C5 sing N N 75 A1EZE C25 N24 sing N N 76 A1EZE C25 C33 doub Y N 77 A1EZE C9 C43 sing N N 78 A1EZE O41 C40 doub N N 79 A1EZE C4 C5 doub N N 80 A1EZE C5 O49 sing N N 81 A1EZE C40 O42 sing N N 82 A1EZE C32 C33 sing Y N 83 A1EZE C43 C44 doub Y N 84 A1EZE C43 C48 sing Y N 85 A1EZE C33 N34 sing N N 86 A1EZE C44 C45 sing Y N 87 A1EZE O49 C48 sing N N 88 A1EZE C48 C47 doub Y N 89 A1EZE N34 O36 doub N N 90 A1EZE N34 O35 doub N N 91 A1EZE C45 C46 doub Y N 92 A1EZE C47 C46 sing Y N 93 A1EZE C46 N50 sing N N 94 A1EZE N50 C51 sing N N 95 A1EZE N50 C52 sing N N 96 A1EZE C4 H1 sing N N 97 A1EZE C7 H2 sing N N 98 A1EZE C8 H3 sing N N 99 A1EZE C17 H4 sing N N 100 A1EZE C17 H5 sing N N 101 A1EZE C20 H6 sing N N 102 A1EZE C20 H7 sing N N 103 A1EZE C22 H8 sing N N 104 A1EZE C22 H9 sing N N 105 A1EZE C26 H10 sing N N 106 A1EZE C1 H11 sing N N 107 A1EZE C1 H12 sing N N 108 A1EZE C1 H13 sing N N 109 A1EZE C11 H14 sing N N 110 A1EZE C12 H15 sing N N 111 A1EZE C16 H16 sing N N 112 A1EZE C16 H17 sing N N 113 A1EZE C19 H18 sing N N 114 A1EZE C19 H19 sing N N 115 A1EZE C23 H20 sing N N 116 A1EZE C23 H21 sing N N 117 A1EZE C27 H22 sing N N 118 A1EZE C32 H23 sing N N 119 A1EZE C38 H24 sing N N 120 A1EZE C44 H25 sing N N 121 A1EZE C45 H26 sing N N 122 A1EZE C47 H27 sing N N 123 A1EZE C51 H28 sing N N 124 A1EZE C51 H29 sing N N 125 A1EZE C51 H30 sing N N 126 A1EZE C52 H31 sing N N 127 A1EZE C52 H32 sing N N 128 A1EZE C52 H33 sing N N 129 A1EZE C53 H34 sing N N 130 A1EZE C53 H35 sing N N 131 A1EZE C53 H36 sing N N 132 A1EZE N15 H37 sing N N 133 A1EZE N24 H38 sing N N 134 A1EZE O42 H39 sing N N 135 C OP3 P sing N N 136 C OP3 HOP3 sing N N 137 C P OP1 doub N N 138 C P OP2 sing N N 139 C P "O5'" sing N N 140 C OP2 HOP2 sing N N 141 C "O5'" "C5'" sing N N 142 C "C5'" "C4'" sing N N 143 C "C5'" "H5'" sing N N 144 C "C5'" "H5''" sing N N 145 C "C4'" "O4'" sing N N 146 C "C4'" "C3'" sing N N 147 C "C4'" "H4'" sing N N 148 C "O4'" "C1'" sing N N 149 C "C3'" "O3'" sing N N 150 C "C3'" "C2'" sing N N 151 C "C3'" "H3'" sing N N 152 C "O3'" "HO3'" sing N N 153 C "C2'" "O2'" sing N N 154 C "C2'" "C1'" sing N N 155 C "C2'" "H2'" sing N N 156 C "O2'" "HO2'" sing N N 157 C "C1'" N1 sing N N 158 C "C1'" "H1'" sing N N 159 C N1 C2 sing N N 160 C N1 C6 sing N N 161 C C2 O2 doub N N 162 C C2 N3 sing N N 163 C N3 C4 doub N N 164 C C4 N4 sing N N 165 C C4 C5 sing N N 166 C N4 H41 sing N N 167 C N4 H42 sing N N 168 C C5 C6 doub N N 169 C C5 H5 sing N N 170 C C6 H6 sing N N 171 G OP3 P sing N N 172 G OP3 HOP3 sing N N 173 G P OP1 doub N N 174 G P OP2 sing N N 175 G P "O5'" sing N N 176 G OP2 HOP2 sing N N 177 G "O5'" "C5'" sing N N 178 G "C5'" "C4'" sing N N 179 G "C5'" "H5'" sing N N 180 G "C5'" "H5''" sing N N 181 G "C4'" "O4'" sing N N 182 G "C4'" "C3'" sing N N 183 G "C4'" "H4'" sing N N 184 G "O4'" "C1'" sing N N 185 G "C3'" "O3'" sing N N 186 G "C3'" "C2'" sing N N 187 G "C3'" "H3'" sing N N 188 G "O3'" "HO3'" sing N N 189 G "C2'" "O2'" sing N N 190 G "C2'" "C1'" sing N N 191 G "C2'" "H2'" sing N N 192 G "O2'" "HO2'" sing N N 193 G "C1'" N9 sing N N 194 G "C1'" "H1'" sing N N 195 G N9 C8 sing Y N 196 G N9 C4 sing Y N 197 G C8 N7 doub Y N 198 G C8 H8 sing N N 199 G N7 C5 sing Y N 200 G C5 C6 sing N N 201 G C5 C4 doub Y N 202 G C6 O6 doub N N 203 G C6 N1 sing N N 204 G N1 C2 sing N N 205 G N1 H1 sing N N 206 G C2 N2 sing N N 207 G C2 N3 doub N N 208 G N2 H21 sing N N 209 G N2 H22 sing N N 210 G N3 C4 sing N N 211 HOH O H1 sing N N 212 HOH O H2 sing N N 213 U OP3 P sing N N 214 U OP3 HOP3 sing N N 215 U P OP1 doub N N 216 U P OP2 sing N N 217 U P "O5'" sing N N 218 U OP2 HOP2 sing N N 219 U "O5'" "C5'" sing N N 220 U "C5'" "C4'" sing N N 221 U "C5'" "H5'" sing N N 222 U "C5'" "H5''" sing N N 223 U "C4'" "O4'" sing N N 224 U "C4'" "C3'" sing N N 225 U "C4'" "H4'" sing N N 226 U "O4'" "C1'" sing N N 227 U "C3'" "O3'" sing N N 228 U "C3'" "C2'" sing N N 229 U "C3'" "H3'" sing N N 230 U "O3'" "HO3'" sing N N 231 U "C2'" "O2'" sing N N 232 U "C2'" "C1'" sing N N 233 U "C2'" "H2'" sing N N 234 U "O2'" "HO2'" sing N N 235 U "C1'" N1 sing N N 236 U "C1'" "H1'" sing N N 237 U N1 C2 sing N N 238 U N1 C6 sing N N 239 U C2 O2 doub N N 240 U C2 N3 sing N N 241 U N3 C4 sing N N 242 U N3 H3 sing N N 243 U C4 O4 doub N N 244 U C4 C5 sing N N 245 U C5 C6 doub N N 246 U C5 H5 sing N N 247 U C6 H6 sing N N 248 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9XAL 'double helix' 9XAL 'a-form double helix' 9XAL 'hairpin loop' 9XAL tetraloop 9XAL 'bulge loop' 9XAL 'mismatched base pair' 9XAL 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 57 1_555 -1.218 -0.397 0.201 -3.042 -12.556 3.314 1 B_G1:C57_B B 1 ? B 57 ? 19 1 1 A G 2 1_555 A C 56 1_555 -0.204 -0.055 0.289 1.558 -18.824 1.022 2 B_G2:C56_B B 2 ? B 56 ? 19 1 1 A A 3 1_555 A U 55 1_555 -0.304 -0.192 -0.073 -1.680 -15.101 -4.718 3 B_A3:U55_B B 3 ? B 55 ? 20 1 1 A A 4 1_555 A U 54 1_555 0.053 -0.362 0.295 3.124 -16.674 -3.456 4 B_A4:U54_B B 4 ? B 54 ? 20 1 1 A C 5 1_555 A G 53 1_555 0.653 -0.627 0.230 -1.958 -15.123 -1.364 5 B_C5:G53_B B 5 ? B 53 ? 19 1 1 A C 6 1_555 A G 52 1_555 0.333 -0.236 0.592 -10.401 -16.801 1.688 6 B_C6:G52_B B 6 ? B 52 ? 19 1 1 A U 7 1_555 A A 51 1_555 0.090 0.267 0.366 6.783 -4.319 0.931 7 B_U7:A51_B B 7 ? B 51 ? 20 1 1 A G 29 1_555 A C 50 1_555 -0.350 -0.041 -0.218 4.719 -3.317 7.726 8 B_G29:C50_B B 29 ? B 50 ? 19 1 1 A A 30 1_555 A U 49 1_555 -0.169 0.160 0.262 -8.599 -13.542 14.508 9 B_A30:U49_B B 30 ? B 49 ? 20 1 1 A G 31 1_555 A C 48 1_555 -0.114 -0.297 -0.370 -17.693 -16.424 -3.336 10 B_G31:C48_B B 31 ? B 48 ? 19 1 1 A G 32 1_555 A C 47 1_555 -0.247 -0.183 -0.431 -13.332 -14.442 7.206 11 B_G32:C47_B B 32 ? B 47 ? 19 1 1 A C 33 1_555 A G 46 1_555 -0.346 -0.332 0.355 -4.129 -11.550 6.040 12 B_C33:G46_B B 33 ? B 46 ? 19 1 1 A G 34 1_555 A C 45 1_555 0.229 -0.239 -0.199 -3.564 -16.453 5.216 13 B_G34:C45_B B 34 ? B 45 ? 19 1 1 A C 35 1_555 A G 27 1_555 -0.443 -0.179 -0.005 -9.996 0.556 -2.420 14 B_C35:G27_B B 35 ? B 27 ? 19 1 1 A A 16 1_555 A G 13 1_555 -6.587 -4.608 1.325 -11.298 2.936 -7.640 15 B_A16:G13_B B 16 ? B 13 ? 11 10 1 A G 17 1_555 A C 12 1_555 0.028 0.003 -0.110 2.651 1.393 10.034 16 B_G17:C12_B B 17 ? B 12 ? 19 1 1 A G 18 1_555 A C 11 1_555 -1.030 -0.390 0.209 6.680 -2.919 2.439 17 B_G18:C11_B B 18 ? B 11 ? 19 1 1 A C 19 1_555 A G 10 1_555 0.292 -0.281 0.345 -4.070 -6.051 -0.277 18 B_C19:G10_B B 19 ? B 10 ? 19 1 1 A G 20 1_555 A C 9 1_555 -0.040 -0.166 0.329 -3.435 -14.917 6.848 19 B_G20:C9_B B 20 ? B 9 ? 19 1 1 A G 21 1_555 A C 8 1_555 -0.107 -0.182 0.300 -11.112 -16.473 -5.554 20 B_G21:C8_B B 21 ? B 8 ? 19 1 1 A U 22 1_555 A A 28 1_555 0.230 -0.137 0.678 -13.143 -5.108 -0.775 21 B_U22:A28_B B 22 ? B 28 ? 20 1 1 A G 23 1_555 A C 44 1_555 -0.205 -0.232 -0.282 -6.730 10.623 -3.149 22 B_G23:C44_B B 23 ? B 44 ? 19 1 1 A G 26 1_555 A A 43 1_555 7.013 -4.585 -0.082 -18.891 -24.079 0.418 23 B_G26:A43_B B 26 ? B 43 ? 11 10 1 A A 24 1_555 A A 42 1_555 4.169 1.267 0.083 -2.580 -3.819 -110.916 24 B_A24:A42_B B 24 ? B 42 ? 5 4 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 57 1_555 A G 2 1_555 A C 56 1_555 -0.540 -1.901 3.093 -6.341 10.958 35.647 -4.180 0.115 2.480 17.243 9.978 37.760 1 BB_G1G2:C56C57_BB B 1 ? B 57 ? B 2 ? B 56 ? 1 A G 2 1_555 A C 56 1_555 A A 3 1_555 A U 55 1_555 -0.303 -1.357 3.462 0.739 6.908 32.157 -3.596 0.664 3.103 12.292 -1.315 32.879 2 BB_G2A3:U55C56_BB B 2 ? B 56 ? B 3 ? B 55 ? 1 A A 3 1_555 A U 55 1_555 A A 4 1_555 A U 54 1_555 0.214 -1.454 3.012 -2.862 5.508 33.663 -3.240 -0.762 2.720 9.412 4.890 34.214 3 BB_A3A4:U54U55_BB B 3 ? B 55 ? B 4 ? B 54 ? 1 A A 4 1_555 A U 54 1_555 A C 5 1_555 A G 53 1_555 0.462 -1.208 3.367 1.170 3.607 39.097 -2.233 -0.546 3.259 5.375 -1.743 39.273 4 BB_A4C5:G53U54_BB B 4 ? B 54 ? B 5 ? B 53 ? 1 A C 5 1_555 A G 53 1_555 A C 6 1_555 A G 52 1_555 0.116 -1.705 3.166 1.724 6.291 37.731 -3.333 0.023 2.858 9.640 -2.642 38.270 5 BB_C5C6:G52G53_BB B 5 ? B 53 ? B 6 ? B 52 ? 1 A C 6 1_555 A G 52 1_555 A U 7 1_555 A A 51 1_555 0.250 -1.148 2.833 5.281 6.894 29.249 -3.331 0.402 2.509 13.287 -10.178 30.483 6 BB_C6U7:A51G52_BB B 6 ? B 52 ? B 7 ? B 51 ? 1 A U 7 1_555 A A 51 1_555 A G 29 1_555 A C 50 1_555 -0.990 -1.579 3.124 4.761 14.242 38.891 -3.523 1.829 2.301 20.485 -6.848 41.585 7 BB_U7G29:C50A51_BB B 7 ? B 51 ? B 29 ? B 50 ? 1 A G 29 1_555 A C 50 1_555 A A 30 1_555 A U 49 1_555 0.100 -2.139 3.294 -5.209 12.229 37.221 -4.481 -0.706 2.463 18.454 7.860 39.444 8 BB_G29A30:U49C50_BB B 29 ? B 50 ? B 30 ? B 49 ? 1 A A 30 1_555 A U 49 1_555 A G 31 1_555 A C 48 1_555 -1.364 -1.842 3.380 3.273 8.359 30.699 -4.769 3.036 2.644 15.381 -6.023 31.955 9 BB_A30G31:C48U49_BB B 30 ? B 49 ? B 31 ? B 48 ? 1 A G 31 1_555 A C 48 1_555 A G 32 1_555 A C 47 1_555 0.033 -1.003 3.079 -0.209 7.746 31.313 -3.056 -0.093 2.758 14.083 0.381 32.234 10 BB_G31G32:C47C48_BB B 31 ? B 48 ? B 32 ? B 47 ? 1 A G 32 1_555 A C 47 1_555 A C 33 1_555 A G 46 1_555 0.439 -0.845 3.074 -5.427 6.995 27.692 -3.064 -1.945 2.654 14.162 10.987 29.046 11 BB_G32C33:G46C47_BB B 32 ? B 47 ? B 33 ? B 46 ? 1 A C 33 1_555 A G 46 1_555 A G 34 1_555 A C 45 1_555 0.657 -1.634 3.157 5.022 10.515 34.956 -3.892 -0.419 2.639 16.934 -8.087 36.790 12 BB_C33G34:C45G46_BB B 33 ? B 46 ? B 34 ? B 45 ? 1 A G 34 1_555 A C 45 1_555 A C 35 1_555 A G 27 1_555 1.850 -1.345 3.397 0.693 -6.081 47.136 -1.147 -2.237 3.560 -7.567 -0.863 47.509 13 BB_G34C35:G27C45_BB B 34 ? B 45 ? B 35 ? B 27 ? 1 A A 16 1_555 A G 13 1_555 A G 17 1_555 A C 12 1_555 2.208 -0.807 2.645 4.999 11.564 49.058 -1.614 -2.296 2.603 13.668 -5.909 50.553 14 BB_A16G17:C12G13_BB B 16 ? B 13 ? B 17 ? B 12 ? 1 A G 17 1_555 A C 12 1_555 A G 18 1_555 A C 11 1_555 -0.759 -2.089 3.057 -3.178 2.107 25.557 -5.213 0.880 2.949 4.728 7.133 25.836 15 BB_G17G18:C11C12_BB B 17 ? B 12 ? B 18 ? B 11 ? 1 A G 18 1_555 A C 11 1_555 A C 19 1_555 A G 10 1_555 0.069 -1.453 3.571 -0.749 5.152 40.966 -2.651 -0.184 3.370 7.325 1.065 41.282 16 BB_G18C19:G10C11_BB B 18 ? B 11 ? B 19 ? B 10 ? 1 A C 19 1_555 A G 10 1_555 A G 20 1_555 A C 9 1_555 0.556 -2.035 3.032 2.580 5.592 26.404 -5.575 -0.618 2.595 12.036 -5.553 27.100 17 BB_C19G20:C9G10_BB B 19 ? B 10 ? B 20 ? B 9 ? 1 A G 20 1_555 A C 9 1_555 A G 21 1_555 A C 8 1_555 -0.261 -1.934 3.177 1.931 6.097 30.370 -4.685 0.827 2.725 11.479 -3.636 31.020 18 BB_G20G21:C8C9_BB B 20 ? B 9 ? B 21 ? B 8 ? 1 A G 21 1_555 A C 8 1_555 A U 22 1_555 A A 28 1_555 -0.264 -1.488 3.254 -0.237 -2.957 36.542 -1.955 0.386 3.361 -4.707 0.378 36.658 19 BB_G21U22:A28C8_BB B 21 ? B 8 ? B 22 ? B 28 ? 1 A U 22 1_555 A A 28 1_555 A G 23 1_555 A C 44 1_555 2.134 0.251 2.988 18.468 -2.762 43.603 0.548 -1.089 3.548 -3.532 -23.617 47.253 20 BB_U22G23:C44A28_BB B 22 ? B 28 ? B 23 ? B 44 ? 1 A G 23 1_555 A C 44 1_555 A G 26 1_555 A A 43 1_555 0.104 0.010 4.223 12.836 27.367 69.352 -1.103 0.435 3.970 22.991 -10.784 74.891 21 BB_G23G26:A43C44_BB B 23 ? B 44 ? B 26 ? B 43 ? 1 A G 26 1_555 A A 43 1_555 A A 24 1_555 A A 42 1_555 -1.621 0.180 2.992 -0.387 4.232 -17.289 -2.834 -5.445 2.829 -13.810 -1.262 -17.800 22 BB_G26A24:A42A43_BB B 26 ? B 43 ? B 24 ? B 42 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9L8F _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9XAL _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.011907 _atom_sites.fract_transf_matrix[1][2] 0.006874 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013749 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009370 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #