data_9XAN # _entry.id 9XAN # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.417 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 9XAN pdb_00009xan 10.2210/pdb9xan/pdb WWPDB D_1300065003 ? ? # _pdbx_audit_revision_history.ordinal 1 _pdbx_audit_revision_history.data_content_type 'Structure model' _pdbx_audit_revision_history.major_revision 1 _pdbx_audit_revision_history.minor_revision 0 _pdbx_audit_revision_history.revision_date 2026-10-28 _pdbx_audit_revision_history.part_number ? # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf REL _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 9XAN _pdbx_database_status.recvd_initial_deposition_date 2025-10-22 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site PDBJ _pdbx_database_status.process_site PDBC _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # _pdbx_contact_author.id 2 _pdbx_contact_author.email aimingren@zju.edu.cn _pdbx_contact_author.name_first Ren _pdbx_contact_author.name_last Aiming _pdbx_contact_author.name_mi ? _pdbx_contact_author.role 'principal investigator/group leader' _pdbx_contact_author.identifier_ORCID 0000-0002-5420-4899 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Tai, X.Q.' 1 ? 'Ren, A.M.' 2 ? # _citation.abstract ? _citation.abstract_id_CAS ? _citation.book_id_ISBN ? _citation.book_publisher ? _citation.book_publisher_city ? _citation.book_title ? _citation.coordinate_linkage ? _citation.country ? _citation.database_id_Medline ? _citation.details ? _citation.id primary _citation.journal_abbrev 'To Be Published' _citation.journal_id_ASTM ? _citation.journal_id_CSD 0353 _citation.journal_id_ISSN ? _citation.journal_full ? _citation.journal_issue ? _citation.journal_volume ? _citation.language ? _citation.page_first ? _citation.page_last ? _citation.title 'Crystal structure of apo-state RhoBAST-G38A' _citation.year ? _citation.database_id_CSD ? _citation.pdbx_database_id_DOI ? _citation.pdbx_database_id_PubMed ? _citation.pdbx_database_id_patent ? _citation.unpublished_flag ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Tai, X.Q.' 1 ? primary 'Ren, A.M.' 2 ? # loop_ _entity.id _entity.type _entity.src_method _entity.pdbx_description _entity.formula_weight _entity.pdbx_number_of_molecules _entity.pdbx_ec _entity.pdbx_mutation _entity.pdbx_fragment _entity.details 1 polymer man 'RNA (57-MER)' 18638.066 1 ? ? ? ? 2 non-polymer syn 'MAGNESIUM ION' 24.305 1 ? ? ? ? 3 water nat water 18.015 13 ? ? ? ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer yes _entity_poly.pdbx_seq_one_letter_code '(GTP)GAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAAGUUAACCGCCUCAGGUUCC' _entity_poly.pdbx_seq_one_letter_code_can GGAACCUCCGCCGAAAGGCGGUGAAGGAGAGGCGCAAAGUUAACCGCCUCAGGUUCC _entity_poly.pdbx_strand_id B _entity_poly.pdbx_target_identifier ? # loop_ _pdbx_entity_nonpoly.entity_id _pdbx_entity_nonpoly.name _pdbx_entity_nonpoly.comp_id 2 'MAGNESIUM ION' MG 3 water HOH # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 GTP n 1 2 G n 1 3 A n 1 4 A n 1 5 C n 1 6 C n 1 7 U n 1 8 C n 1 9 C n 1 10 G n 1 11 C n 1 12 C n 1 13 G n 1 14 A n 1 15 A n 1 16 A n 1 17 G n 1 18 G n 1 19 C n 1 20 G n 1 21 G n 1 22 U n 1 23 G n 1 24 A n 1 25 A n 1 26 G n 1 27 G n 1 28 A n 1 29 G n 1 30 A n 1 31 G n 1 32 G n 1 33 C n 1 34 G n 1 35 C n 1 36 A n 1 37 A n 1 38 A n 1 39 G n 1 40 U n 1 41 U n 1 42 A n 1 43 A n 1 44 C n 1 45 C n 1 46 G n 1 47 C n 1 48 C n 1 49 U n 1 50 C n 1 51 A n 1 52 G n 1 53 G n 1 54 U n 1 55 U n 1 56 C n 1 57 C n # _entity_src_gen.entity_id 1 _entity_src_gen.pdbx_src_id 1 _entity_src_gen.pdbx_alt_source_flag sample _entity_src_gen.pdbx_seq_type 'Biological sequence' _entity_src_gen.pdbx_beg_seq_num 1 _entity_src_gen.pdbx_end_seq_num 57 _entity_src_gen.gene_src_common_name ? _entity_src_gen.gene_src_genus ? _entity_src_gen.pdbx_gene_src_gene ? _entity_src_gen.gene_src_species ? _entity_src_gen.gene_src_strain ? _entity_src_gen.gene_src_tissue ? _entity_src_gen.gene_src_tissue_fraction ? _entity_src_gen.gene_src_details ? _entity_src_gen.pdbx_gene_src_fragment ? _entity_src_gen.pdbx_gene_src_scientific_name 'synthetic construct' _entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 32630 _entity_src_gen.pdbx_gene_src_variant ? _entity_src_gen.pdbx_gene_src_cell_line ? _entity_src_gen.pdbx_gene_src_atcc ? _entity_src_gen.pdbx_gene_src_organ ? _entity_src_gen.pdbx_gene_src_organelle ? _entity_src_gen.pdbx_gene_src_cell ? _entity_src_gen.pdbx_gene_src_cellular_location ? _entity_src_gen.host_org_common_name ? _entity_src_gen.pdbx_host_org_scientific_name 'in vitro transcription vector pT7-TP(deltai)' _entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 905931 _entity_src_gen.host_org_genus ? _entity_src_gen.pdbx_host_org_gene ? _entity_src_gen.pdbx_host_org_organ ? _entity_src_gen.host_org_species ? _entity_src_gen.pdbx_host_org_tissue ? _entity_src_gen.pdbx_host_org_tissue_fraction ? _entity_src_gen.pdbx_host_org_strain ? _entity_src_gen.pdbx_host_org_variant ? _entity_src_gen.pdbx_host_org_cell_line ? _entity_src_gen.pdbx_host_org_atcc ? _entity_src_gen.pdbx_host_org_culture_collection ? _entity_src_gen.pdbx_host_org_cell ? _entity_src_gen.pdbx_host_org_organelle ? _entity_src_gen.pdbx_host_org_cellular_location ? _entity_src_gen.pdbx_host_org_vector_type ? _entity_src_gen.pdbx_host_org_vector ? _entity_src_gen.host_org_details ? _entity_src_gen.expression_system_id ? _entity_src_gen.plasmid_name ? _entity_src_gen.plasmid_details ? _entity_src_gen.pdbx_description ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 GTP non-polymer n "GUANOSINE-5'-TRIPHOSPHATE" ? 'C10 H16 N5 O14 P3' 523.180 HOH non-polymer . WATER ? 'H2 O' 18.015 MG non-polymer . 'MAGNESIUM ION' ? 'Mg 2' 24.305 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 GTP 1 1 1 GTP GTP B . n A 1 2 G 2 2 2 G G B . n A 1 3 A 3 3 3 A A B . n A 1 4 A 4 4 4 A A B . n A 1 5 C 5 5 5 C C B . n A 1 6 C 6 6 6 C C B . n A 1 7 U 7 7 7 U U B . n A 1 8 C 8 8 8 C C B . n A 1 9 C 9 9 9 C C B . n A 1 10 G 10 10 10 G G B . n A 1 11 C 11 11 11 C C B . n A 1 12 C 12 12 12 C C B . n A 1 13 G 13 13 13 G G B . n A 1 14 A 14 14 14 A A B . n A 1 15 A 15 15 15 A A B . n A 1 16 A 16 16 16 A A B . n A 1 17 G 17 17 17 G G B . n A 1 18 G 18 18 18 G G B . n A 1 19 C 19 19 19 C C B . n A 1 20 G 20 20 20 G G B . n A 1 21 G 21 21 21 G G B . n A 1 22 U 22 22 22 U U B . n A 1 23 G 23 23 23 G G B . n A 1 24 A 24 24 24 A A B . n A 1 25 A 25 25 25 A A B . n A 1 26 G 26 26 26 G G B . n A 1 27 G 27 27 27 G G B . n A 1 28 A 28 28 28 A A B . n A 1 29 G 29 29 29 G G B . n A 1 30 A 30 30 30 A A B . n A 1 31 G 31 31 31 G G B . n A 1 32 G 32 32 32 G G B . n A 1 33 C 33 33 33 C C B . n A 1 34 G 34 34 34 G G B . n A 1 35 C 35 35 35 C C B . n A 1 36 A 36 36 36 A A B . n A 1 37 A 37 37 37 A A B . n A 1 38 A 38 38 38 A A B . n A 1 39 G 39 39 39 G G B . n A 1 40 U 40 40 40 U U B . n A 1 41 U 41 41 41 U U B . n A 1 42 A 42 42 42 A A B . n A 1 43 A 43 43 43 A A B . n A 1 44 C 44 44 44 C C B . n A 1 45 C 45 45 45 C C B . n A 1 46 G 46 46 46 G G B . n A 1 47 C 47 47 47 C C B . n A 1 48 C 48 48 48 C C B . n A 1 49 U 49 49 49 U U B . n A 1 50 C 50 50 50 C C B . n A 1 51 A 51 51 51 A A B . n A 1 52 G 52 52 52 G G B . n A 1 53 G 53 53 53 G G B . n A 1 54 U 54 54 54 U U B . n A 1 55 U 55 55 55 U U B . n A 1 56 C 56 56 56 C C B . n A 1 57 C 57 57 57 C C B . n # loop_ _pdbx_nonpoly_scheme.asym_id _pdbx_nonpoly_scheme.entity_id _pdbx_nonpoly_scheme.mon_id _pdbx_nonpoly_scheme.ndb_seq_num _pdbx_nonpoly_scheme.pdb_seq_num _pdbx_nonpoly_scheme.auth_seq_num _pdbx_nonpoly_scheme.pdb_mon_id _pdbx_nonpoly_scheme.auth_mon_id _pdbx_nonpoly_scheme.pdb_strand_id _pdbx_nonpoly_scheme.pdb_ins_code B 2 MG 1 101 1 MG MG B . C 3 HOH 1 201 23 HOH HOH B . C 3 HOH 2 202 19 HOH HOH B . C 3 HOH 3 203 9 HOH HOH B . C 3 HOH 4 204 13 HOH HOH B . C 3 HOH 5 205 2 HOH HOH B . C 3 HOH 6 206 20 HOH HOH B . C 3 HOH 7 207 12 HOH HOH B . C 3 HOH 8 208 22 HOH HOH B . C 3 HOH 9 209 5 HOH HOH B . C 3 HOH 10 210 4 HOH HOH B . C 3 HOH 11 211 21 HOH HOH B . C 3 HOH 12 212 10 HOH HOH B . C 3 HOH 13 213 17 HOH HOH B . # loop_ _software.citation_id _software.classification _software.compiler_name _software.compiler_version _software.contact_author _software.contact_author_email _software.date _software.description _software.dependencies _software.hardware _software.language _software.location _software.mods _software.name _software.os _software.os_version _software.type _software.version _software.pdbx_reference_DOI _software.pdbx_ordinal ? refinement ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? '(1.20.1_4487: ???)' ? 1 ? 'data scaling' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 2 ? 'data extraction' ? ? ? ? ? ? ? ? ? ? ? PDB_EXTRACT ? ? ? . ? 3 ? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS ? ? ? . ? 4 ? phasing ? ? ? ? ? ? ? ? ? ? ? PHASER ? ? ? . ? 5 # _cell.angle_alpha 90.00 _cell.angle_alpha_esd ? _cell.angle_beta 90.00 _cell.angle_beta_esd ? _cell.angle_gamma 120.00 _cell.angle_gamma_esd ? _cell.entry_id 9XAN _cell.details ? _cell.formula_units_Z ? _cell.length_a 83.058 _cell.length_a_esd ? _cell.length_b 83.058 _cell.length_b_esd ? _cell.length_c 101.975 _cell.length_c_esd ? _cell.volume ? _cell.volume_esd ? _cell.Z_PDB 12 _cell.reciprocal_angle_alpha ? _cell.reciprocal_angle_beta ? _cell.reciprocal_angle_gamma ? _cell.reciprocal_angle_alpha_esd ? _cell.reciprocal_angle_beta_esd ? _cell.reciprocal_angle_gamma_esd ? _cell.reciprocal_length_a ? _cell.reciprocal_length_b ? _cell.reciprocal_length_c ? _cell.reciprocal_length_a_esd ? _cell.reciprocal_length_b_esd ? _cell.reciprocal_length_c_esd ? _cell.pdbx_unique_axis ? _cell.pdbx_esd_method ? # _symmetry.entry_id 9XAN _symmetry.cell_setting ? _symmetry.Int_Tables_number 179 _symmetry.space_group_name_Hall ? _symmetry.space_group_name_H-M 'P 65 2 2' _symmetry.pdbx_full_space_group_name_H-M ? # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 9XAN _exptl.crystals_number 1 _exptl.details ? _exptl.method 'X-RAY DIFFRACTION' _exptl.method_details ? # _exptl_crystal.colour ? _exptl_crystal.density_diffrn ? _exptl_crystal.density_Matthews 2.72 _exptl_crystal.density_method ? _exptl_crystal.density_percent_sol 54.85 _exptl_crystal.description ? _exptl_crystal.F_000 ? _exptl_crystal.id 1 _exptl_crystal.preparation ? _exptl_crystal.size_max ? _exptl_crystal.size_mid ? _exptl_crystal.size_min ? _exptl_crystal.size_rad ? _exptl_crystal.colour_lustre ? _exptl_crystal.colour_modifier ? _exptl_crystal.colour_primary ? _exptl_crystal.density_meas ? _exptl_crystal.density_meas_esd ? _exptl_crystal.density_meas_gt ? _exptl_crystal.density_meas_lt ? _exptl_crystal.density_meas_temp ? _exptl_crystal.density_meas_temp_esd ? _exptl_crystal.density_meas_temp_gt ? _exptl_crystal.density_meas_temp_lt ? _exptl_crystal.pdbx_crystal_image_url ? _exptl_crystal.pdbx_crystal_image_format ? _exptl_crystal.pdbx_mosaicity ? _exptl_crystal.pdbx_mosaicity_esd ? _exptl_crystal.pdbx_mosaic_method ? _exptl_crystal.pdbx_mosaic_block_size ? _exptl_crystal.pdbx_mosaic_block_size_esd ? # _exptl_crystal_grow.apparatus ? _exptl_crystal_grow.atmosphere ? _exptl_crystal_grow.crystal_id 1 _exptl_crystal_grow.details ? _exptl_crystal_grow.method 'VAPOR DIFFUSION, SITTING DROP' _exptl_crystal_grow.method_ref ? _exptl_crystal_grow.pH ? _exptl_crystal_grow.pressure ? _exptl_crystal_grow.pressure_esd ? _exptl_crystal_grow.seeding ? _exptl_crystal_grow.seeding_ref ? _exptl_crystal_grow.temp_details ? _exptl_crystal_grow.temp_esd ? _exptl_crystal_grow.time ? _exptl_crystal_grow.pdbx_details 'Sodium chloride, Sodium cacodylate pH 6.5, PEG 600, Glycerol' _exptl_crystal_grow.pdbx_pH_range ? _exptl_crystal_grow.temp 289 # _diffrn.ambient_environment ? _diffrn.ambient_temp 100 _diffrn.ambient_temp_details ? _diffrn.ambient_temp_esd ? _diffrn.crystal_id 1 _diffrn.crystal_support ? _diffrn.crystal_treatment ? _diffrn.details ? _diffrn.id 1 _diffrn.ambient_pressure ? _diffrn.ambient_pressure_esd ? _diffrn.ambient_pressure_gt ? _diffrn.ambient_pressure_lt ? _diffrn.ambient_temp_gt ? _diffrn.ambient_temp_lt ? _diffrn.pdbx_serial_crystal_experiment N # _diffrn_detector.details ? _diffrn_detector.detector PIXEL _diffrn_detector.diffrn_id 1 _diffrn_detector.type 'DECTRIS PILATUS 6M' _diffrn_detector.area_resol_mean ? _diffrn_detector.dtime ? _diffrn_detector.pdbx_frames_total ? _diffrn_detector.pdbx_collection_time_total ? _diffrn_detector.pdbx_collection_date 2025-07-04 _diffrn_detector.pdbx_frequency ? _diffrn_detector.id ? _diffrn_detector.number_of_axes ? # _diffrn_radiation.collimation ? _diffrn_radiation.diffrn_id 1 _diffrn_radiation.filter_edge ? _diffrn_radiation.inhomogeneity ? _diffrn_radiation.monochromator ? _diffrn_radiation.polarisn_norm ? _diffrn_radiation.polarisn_ratio ? _diffrn_radiation.probe ? _diffrn_radiation.type ? _diffrn_radiation.xray_symbol ? _diffrn_radiation.wavelength_id 1 _diffrn_radiation.pdbx_monochromatic_or_laue_m_l M _diffrn_radiation.pdbx_wavelength_list ? _diffrn_radiation.pdbx_wavelength ? _diffrn_radiation.pdbx_diffrn_protocol 'SINGLE WAVELENGTH' _diffrn_radiation.pdbx_analyzer ? _diffrn_radiation.pdbx_scattering_type x-ray # _diffrn_radiation_wavelength.id 1 _diffrn_radiation_wavelength.wavelength 0.97853 _diffrn_radiation_wavelength.wt 1.0 # _diffrn_source.current ? _diffrn_source.details ? _diffrn_source.diffrn_id 1 _diffrn_source.power ? _diffrn_source.size ? _diffrn_source.source SYNCHROTRON _diffrn_source.target ? _diffrn_source.type 'SSRF BEAMLINE BL18U1' _diffrn_source.voltage ? _diffrn_source.take-off_angle ? _diffrn_source.pdbx_wavelength_list 0.97853 _diffrn_source.pdbx_wavelength ? _diffrn_source.pdbx_synchrotron_beamline BL18U1 _diffrn_source.pdbx_synchrotron_site SSRF # _reflns.B_iso_Wilson_estimate ? _reflns.entry_id 9XAN _reflns.data_reduction_details ? _reflns.data_reduction_method ? _reflns.d_resolution_high 2.44 _reflns.d_resolution_low 41.60 _reflns.details ? _reflns.limit_h_max ? _reflns.limit_h_min ? _reflns.limit_k_max ? _reflns.limit_k_min ? _reflns.limit_l_max ? _reflns.limit_l_min ? _reflns.number_all ? _reflns.number_obs 300657 _reflns.observed_criterion ? _reflns.observed_criterion_F_max ? _reflns.observed_criterion_F_min ? _reflns.observed_criterion_I_max ? _reflns.observed_criterion_I_min ? _reflns.observed_criterion_sigma_F ? _reflns.observed_criterion_sigma_I ? _reflns.percent_possible_obs 99.8 _reflns.R_free_details ? _reflns.Rmerge_F_all ? _reflns.Rmerge_F_obs ? _reflns.Friedel_coverage ? _reflns.number_gt ? _reflns.threshold_expression ? _reflns.pdbx_redundancy 36.9 _reflns.pdbx_netI_over_av_sigmaI ? _reflns.pdbx_netI_over_sigmaI 42.3 _reflns.pdbx_res_netI_over_av_sigmaI_2 ? _reflns.pdbx_res_netI_over_sigmaI_2 ? _reflns.pdbx_chi_squared ? _reflns.pdbx_scaling_rejects ? _reflns.pdbx_d_res_high_opt ? _reflns.pdbx_d_res_low_opt ? _reflns.pdbx_d_res_opt_method ? _reflns.phase_calculation_details ? _reflns.pdbx_Rrim_I_all ? _reflns.pdbx_Rpim_I_all ? _reflns.pdbx_d_opt ? _reflns.pdbx_number_measured_all ? _reflns.pdbx_diffrn_id 1 _reflns.pdbx_ordinal 1 _reflns.pdbx_CC_half 0.999 _reflns.pdbx_CC_star ? _reflns.pdbx_R_split ? _reflns.pdbx_Rmerge_I_obs ? _reflns.pdbx_Rmerge_I_all ? _reflns.pdbx_Rsym_value ? _reflns.pdbx_CC_split_method ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_1_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_2_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[1] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[2] ? _reflns.pdbx_aniso_diffraction_limit_axis_3_ortho[3] ? _reflns.pdbx_aniso_diffraction_limit_1 ? _reflns.pdbx_aniso_diffraction_limit_2 ? _reflns.pdbx_aniso_diffraction_limit_3 ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_1_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_2_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[1] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[2] ? _reflns.pdbx_aniso_B_tensor_eigenvector_3_ortho[3] ? _reflns.pdbx_aniso_B_tensor_eigenvalue_1 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_2 ? _reflns.pdbx_aniso_B_tensor_eigenvalue_3 ? _reflns.pdbx_orthogonalization_convention ? _reflns.pdbx_percent_possible_ellipsoidal ? _reflns.pdbx_percent_possible_spherical ? _reflns.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns.pdbx_percent_possible_spherical_anomalous ? _reflns.pdbx_redundancy_anomalous ? _reflns.pdbx_CC_half_anomalous ? _reflns.pdbx_absDiff_over_sigma_anomalous ? _reflns.pdbx_percent_possible_anomalous ? _reflns.pdbx_observed_signal_threshold ? _reflns.pdbx_signal_type ? _reflns.pdbx_signal_details ? _reflns.pdbx_signal_software_id ? # _reflns_shell.d_res_high 2.44 _reflns_shell.d_res_low 2.54 _reflns_shell.meanI_over_sigI_all ? _reflns_shell.meanI_over_sigI_obs ? _reflns_shell.number_measured_all ? _reflns_shell.number_measured_obs ? _reflns_shell.number_possible ? _reflns_shell.number_unique_all ? _reflns_shell.number_unique_obs 34071 _reflns_shell.percent_possible_obs ? _reflns_shell.Rmerge_F_all ? _reflns_shell.Rmerge_F_obs ? _reflns_shell.meanI_over_sigI_gt ? _reflns_shell.meanI_over_uI_all ? _reflns_shell.meanI_over_uI_gt ? _reflns_shell.number_measured_gt ? _reflns_shell.number_unique_gt ? _reflns_shell.percent_possible_gt ? _reflns_shell.Rmerge_F_gt ? _reflns_shell.Rmerge_I_gt ? _reflns_shell.pdbx_redundancy ? _reflns_shell.pdbx_chi_squared ? _reflns_shell.pdbx_netI_over_sigmaI_all ? _reflns_shell.pdbx_netI_over_sigmaI_obs ? _reflns_shell.pdbx_Rrim_I_all ? _reflns_shell.pdbx_Rpim_I_all ? _reflns_shell.pdbx_rejects ? _reflns_shell.pdbx_ordinal 1 _reflns_shell.pdbx_diffrn_id 1 _reflns_shell.pdbx_CC_half 0.744 _reflns_shell.pdbx_CC_star ? _reflns_shell.pdbx_R_split ? _reflns_shell.percent_possible_all ? _reflns_shell.Rmerge_I_all ? _reflns_shell.Rmerge_I_obs ? _reflns_shell.pdbx_Rsym_value ? _reflns_shell.pdbx_percent_possible_ellipsoidal ? _reflns_shell.pdbx_percent_possible_spherical ? _reflns_shell.pdbx_percent_possible_ellipsoidal_anomalous ? _reflns_shell.pdbx_percent_possible_spherical_anomalous ? _reflns_shell.pdbx_redundancy_anomalous ? _reflns_shell.pdbx_CC_half_anomalous ? _reflns_shell.pdbx_absDiff_over_sigma_anomalous ? _reflns_shell.pdbx_percent_possible_anomalous ? # _refine.aniso_B[1][1] ? _refine.aniso_B[1][2] ? _refine.aniso_B[1][3] ? _refine.aniso_B[2][2] ? _refine.aniso_B[2][3] ? _refine.aniso_B[3][3] ? _refine.B_iso_max ? _refine.B_iso_mean ? _refine.B_iso_min ? _refine.correlation_coeff_Fo_to_Fc ? _refine.correlation_coeff_Fo_to_Fc_free ? _refine.details ? _refine.diff_density_max ? _refine.diff_density_max_esd ? _refine.diff_density_min ? _refine.diff_density_min_esd ? _refine.diff_density_rms ? _refine.diff_density_rms_esd ? _refine.entry_id 9XAN _refine.pdbx_refine_id 'X-RAY DIFFRACTION' _refine.ls_abs_structure_details ? _refine.ls_abs_structure_Flack ? _refine.ls_abs_structure_Flack_esd ? _refine.ls_abs_structure_Rogers ? _refine.ls_abs_structure_Rogers_esd ? _refine.ls_d_res_high 2.44 _refine.ls_d_res_low 41.60 _refine.ls_extinction_coef ? _refine.ls_extinction_coef_esd ? _refine.ls_extinction_expression ? _refine.ls_extinction_method ? _refine.ls_goodness_of_fit_all ? _refine.ls_goodness_of_fit_all_esd ? _refine.ls_goodness_of_fit_obs ? _refine.ls_goodness_of_fit_obs_esd ? _refine.ls_hydrogen_treatment ? _refine.ls_matrix_type ? _refine.ls_number_constraints ? _refine.ls_number_parameters ? _refine.ls_number_reflns_all ? _refine.ls_number_reflns_obs 8132 _refine.ls_number_reflns_R_free 814 _refine.ls_number_reflns_R_work ? _refine.ls_number_restraints ? _refine.ls_percent_reflns_obs 99.80 _refine.ls_percent_reflns_R_free 10.01 _refine.ls_R_factor_all ? _refine.ls_R_factor_obs 0.2213 _refine.ls_R_factor_R_free 0.2573 _refine.ls_R_factor_R_free_error ? _refine.ls_R_factor_R_free_error_details ? _refine.ls_R_factor_R_work 0.2174 _refine.ls_R_Fsqd_factor_obs ? _refine.ls_R_I_factor_obs ? _refine.ls_redundancy_reflns_all ? _refine.ls_redundancy_reflns_obs ? _refine.ls_restrained_S_all ? _refine.ls_restrained_S_obs ? _refine.ls_shift_over_esd_max ? _refine.ls_shift_over_esd_mean ? _refine.ls_structure_factor_coef ? _refine.ls_weighting_details ? _refine.ls_weighting_scheme ? _refine.ls_wR_factor_all ? _refine.ls_wR_factor_obs ? _refine.ls_wR_factor_R_free ? _refine.ls_wR_factor_R_work ? _refine.occupancy_max ? _refine.occupancy_min ? _refine.solvent_model_details 'FLAT BULK SOLVENT MODEL' _refine.solvent_model_param_bsol ? _refine.solvent_model_param_ksol ? _refine.correlation_coeff_I_to_Fcsqd_work ? _refine.correlation_coeff_I_to_Fcsqd_free ? _refine.pdbx_R_complete ? _refine.ls_R_factor_gt ? _refine.ls_goodness_of_fit_gt ? _refine.ls_goodness_of_fit_ref ? _refine.ls_shift_over_su_max ? _refine.ls_shift_over_su_max_lt ? _refine.ls_shift_over_su_mean ? _refine.ls_shift_over_su_mean_lt ? _refine.pdbx_ls_sigma_I ? _refine.pdbx_ls_sigma_F 1.37 _refine.pdbx_ls_sigma_Fsqd ? _refine.pdbx_data_cutoff_high_absF ? _refine.pdbx_data_cutoff_high_rms_absF ? _refine.pdbx_data_cutoff_low_absF ? _refine.pdbx_isotropic_thermal_model ? _refine.pdbx_ls_cross_valid_method THROUGHOUT _refine.pdbx_method_to_determine_struct 'MOLECULAR REPLACEMENT' _refine.pdbx_starting_model ? _refine.pdbx_stereochemistry_target_values ML _refine.pdbx_R_Free_selection_details ? _refine.pdbx_stereochem_target_val_spec_case ? _refine.pdbx_overall_ESU_R ? _refine.pdbx_overall_ESU_R_Free ? _refine.pdbx_solvent_vdw_probe_radii 1.10 _refine.pdbx_solvent_ion_probe_radii ? _refine.pdbx_solvent_shrinkage_radii 0.90 _refine.pdbx_real_space_R ? _refine.pdbx_density_correlation ? _refine.pdbx_pd_number_of_powder_patterns ? _refine.pdbx_pd_number_of_points ? _refine.pdbx_pd_meas_number_of_points ? _refine.pdbx_pd_proc_ls_prof_R_factor ? _refine.pdbx_pd_proc_ls_prof_wR_factor ? _refine.pdbx_pd_Marquardt_correlation_coeff ? _refine.pdbx_pd_Fsqrd_R_factor ? _refine.pdbx_pd_ls_matrix_band_width ? _refine.pdbx_overall_phase_error 26.15 _refine.pdbx_overall_SU_R_free_Cruickshank_DPI ? _refine.pdbx_overall_SU_R_free_Blow_DPI ? _refine.pdbx_overall_SU_R_Blow_DPI ? _refine.pdbx_TLS_residual_ADP_flag ? _refine.pdbx_diffrn_id 1 _refine.overall_SU_B ? _refine.overall_SU_ML 0.35 _refine.overall_SU_R_Cruickshank_DPI ? _refine.overall_SU_R_free ? _refine.overall_FOM_free_R_set ? _refine.overall_FOM_work_R_set ? _refine.pdbx_average_fsc_overall ? _refine.pdbx_average_fsc_work ? _refine.pdbx_average_fsc_free ? # _refine_hist.pdbx_refine_id 'X-RAY DIFFRACTION' _refine_hist.cycle_id LAST _refine_hist.pdbx_number_atoms_protein 0 _refine_hist.pdbx_number_atoms_nucleic_acid 1236 _refine_hist.pdbx_number_atoms_ligand 1 _refine_hist.number_atoms_solvent 13 _refine_hist.number_atoms_total 1250 _refine_hist.d_res_high 2.44 _refine_hist.d_res_low 41.60 # loop_ _refine_ls_restr.pdbx_refine_id _refine_ls_restr.criterion _refine_ls_restr.dev_ideal _refine_ls_restr.dev_ideal_target _refine_ls_restr.number _refine_ls_restr.rejects _refine_ls_restr.type _refine_ls_restr.weight _refine_ls_restr.pdbx_Zscore _refine_ls_restr.pdbx_restraint_function 'X-RAY DIFFRACTION' ? 0.005 ? 1382 ? f_bond_d ? ? ? 'X-RAY DIFFRACTION' ? 1.151 ? 2155 ? f_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 17.667 ? 683 ? f_dihedral_angle_d ? ? ? 'X-RAY DIFFRACTION' ? 0.047 ? 284 ? f_chiral_restr ? ? ? 'X-RAY DIFFRACTION' ? 0.008 ? 57 ? f_plane_restr ? ? ? # loop_ _refine_ls_shell.pdbx_refine_id _refine_ls_shell.d_res_high _refine_ls_shell.d_res_low _refine_ls_shell.number_reflns_all _refine_ls_shell.number_reflns_obs _refine_ls_shell.number_reflns_R_free _refine_ls_shell.number_reflns_R_work _refine_ls_shell.percent_reflns_obs _refine_ls_shell.percent_reflns_R_free _refine_ls_shell.R_factor_all _refine_ls_shell.R_factor_obs _refine_ls_shell.R_factor_R_free_error _refine_ls_shell.R_factor_R_work _refine_ls_shell.redundancy_reflns_all _refine_ls_shell.redundancy_reflns_obs _refine_ls_shell.wR_factor_all _refine_ls_shell.wR_factor_obs _refine_ls_shell.wR_factor_R_free _refine_ls_shell.wR_factor_R_work _refine_ls_shell.pdbx_R_complete _refine_ls_shell.correlation_coeff_Fo_to_Fc _refine_ls_shell.correlation_coeff_Fo_to_Fc_free _refine_ls_shell.correlation_coeff_I_to_Fcsqd_work _refine_ls_shell.correlation_coeff_I_to_Fcsqd_free _refine_ls_shell.pdbx_total_number_of_bins_used _refine_ls_shell.pdbx_phase_error _refine_ls_shell.pdbx_fsc_work _refine_ls_shell.pdbx_fsc_free _refine_ls_shell.R_factor_R_free 'X-RAY DIFFRACTION' 2.44 2.60 . . 130 1176 100.00 . . . . 0.3204 . . . . . . . . . . . . . . . 0.3634 'X-RAY DIFFRACTION' 2.60 2.80 . . 133 1183 100.00 . . . . 0.3647 . . . . . . . . . . . . . . . 0.3908 'X-RAY DIFFRACTION' 2.80 3.08 . . 132 1198 100.00 . . . . 0.2778 . . . . . . . . . . . . . . . 0.3108 'X-RAY DIFFRACTION' 3.08 3.53 . . 134 1207 100.00 . . . . 0.2075 . . . . . . . . . . . . . . . 0.2646 'X-RAY DIFFRACTION' 3.53 4.44 . . 137 1230 100.00 . . . . 0.1792 . . . . . . . . . . . . . . . 0.2168 'X-RAY DIFFRACTION' 4.44 41.60 . . 148 1324 99.00 . . . . 0.1884 . . . . . . . . . . . . . . . 0.2243 # _struct.entry_id 9XAN _struct.title 'Crystal structure of apo-state RhoBAST-G38A' _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 9XAN _struct_keywords.text 'aptamer, RhoBAST, RNA' _struct_keywords.pdbx_keywords RNA # loop_ _struct_asym.id _struct_asym.pdbx_blank_PDB_chainid_flag _struct_asym.pdbx_modified _struct_asym.entity_id _struct_asym.details A N N 1 ? B N N 2 ? C N N 3 ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 9XAN _struct_ref.pdbx_db_accession 9XAN _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 9XAN _struct_ref_seq.pdbx_strand_id B _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 57 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 9XAN _struct_ref_seq.db_align_beg 1 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 57 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 1 _struct_ref_seq.pdbx_auth_seq_align_end 57 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_and_software_defined_assembly _pdbx_struct_assembly.method_details PISA _pdbx_struct_assembly.oligomeric_details dimeric _pdbx_struct_assembly.oligomeric_count 2 # loop_ _pdbx_struct_assembly_prop.biol_id _pdbx_struct_assembly_prop.type _pdbx_struct_assembly_prop.value _pdbx_struct_assembly_prop.details 1 'ABSA (A^2)' 1060 ? 1 MORE -17 ? 1 'SSA (A^2)' 19340 ? # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1,2 _pdbx_struct_assembly_gen.asym_id_list A,B,C # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support none _pdbx_struct_assembly_auth_evidence.details ? # loop_ _pdbx_struct_oper_list.id _pdbx_struct_oper_list.type _pdbx_struct_oper_list.name _pdbx_struct_oper_list.symmetry_operation _pdbx_struct_oper_list.matrix[1][1] _pdbx_struct_oper_list.matrix[1][2] _pdbx_struct_oper_list.matrix[1][3] _pdbx_struct_oper_list.vector[1] _pdbx_struct_oper_list.matrix[2][1] _pdbx_struct_oper_list.matrix[2][2] _pdbx_struct_oper_list.matrix[2][3] _pdbx_struct_oper_list.vector[2] _pdbx_struct_oper_list.matrix[3][1] _pdbx_struct_oper_list.matrix[3][2] _pdbx_struct_oper_list.matrix[3][3] _pdbx_struct_oper_list.vector[3] 1 'identity operation' 1_555 x,y,z 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 2 'crystal symmetry operation' 9_555 -x,-x+y,-z+1/3 -0.5000000000 -0.8660254038 0.0000000000 0.0000000000 -0.8660254038 0.5000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 33.9916666667 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role covale1 covale both ? A GTP 1 "O3'" ? ? ? 1_555 A G 2 P ? ? B GTP 1 B G 2 1_555 ? ? ? ? ? ? ? 1.566 ? ? metalc1 metalc ? ? B MG . MG ? ? ? 1_555 C HOH . O ? ? B MG 101 B HOH 202 1_555 ? ? ? ? ? ? ? 2.114 ? ? metalc2 metalc ? ? B MG . MG ? ? ? 1_555 C HOH . O ? ? B MG 101 B HOH 202 9_555 ? ? ? ? ? ? ? 2.114 ? ? metalc3 metalc ? ? B MG . MG ? ? ? 1_555 C HOH . O ? ? B MG 101 B HOH 205 1_555 ? ? ? ? ? ? ? 2.119 ? ? metalc4 metalc ? ? B MG . MG ? ? ? 1_555 C HOH . O ? ? B MG 101 B HOH 205 9_555 ? ? ? ? ? ? ? 2.119 ? ? hydrog1 hydrog ? ? A GTP 1 N1 ? ? ? 1_555 A C 57 N3 ? ? B GTP 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A GTP 1 N2 ? ? ? 1_555 A C 57 O2 ? ? B GTP 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A GTP 1 O6 ? ? ? 1_555 A C 57 N4 ? ? B GTP 1 B C 57 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 56 N3 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 56 O2 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 56 N4 ? ? B G 2 B C 56 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 55 N3 ? ? B A 3 B U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 55 O4 ? ? B A 3 B U 55 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A A 4 N1 ? ? ? 1_555 A U 54 N3 ? ? B A 4 B U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A A 4 N6 ? ? ? 1_555 A U 54 O4 ? ? B A 4 B U 54 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 53 N1 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 53 O6 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 53 N2 ? ? B C 5 B G 53 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 6 N3 ? ? ? 1_555 A G 52 N1 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A C 6 N4 ? ? ? 1_555 A G 52 O6 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog16 hydrog ? ? A C 6 O2 ? ? ? 1_555 A G 52 N2 ? ? B C 6 B G 52 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 51 N1 ? ? B U 7 B A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 51 N6 ? ? B U 7 B A 51 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 21 N1 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 21 O6 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 21 N2 ? ? B C 8 B G 21 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog22 hydrog ? ? A C 9 N3 ? ? ? 1_555 A G 20 N1 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog23 hydrog ? ? A C 9 N4 ? ? ? 1_555 A G 20 O6 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A C 9 O2 ? ? ? 1_555 A G 20 N2 ? ? B C 9 B G 20 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 10 N1 ? ? ? 1_555 A C 19 N3 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 10 N2 ? ? ? 1_555 A C 19 O2 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 10 O6 ? ? ? 1_555 A C 19 N4 ? ? B G 10 B C 19 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 11 N3 ? ? ? 1_555 A G 18 N1 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 11 N4 ? ? ? 1_555 A G 18 O6 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 11 O2 ? ? ? 1_555 A G 18 N2 ? ? B C 11 B G 18 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A C 12 N3 ? ? ? 1_555 A G 17 N1 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A C 12 N4 ? ? ? 1_555 A G 17 O6 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 12 O2 ? ? ? 1_555 A G 17 N2 ? ? B C 12 B G 17 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A G 13 N2 ? ? ? 1_555 A A 16 N7 ? ? B G 13 B A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog35 hydrog ? ? A G 13 N3 ? ? ? 1_555 A A 16 N6 ? ? B G 13 B A 16 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog36 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 28 N1 ? ? B U 22 B A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog37 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 28 N6 ? ? B U 22 B A 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog38 hydrog ? ? A G 23 N1 ? ? ? 1_555 A C 44 N3 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog39 hydrog ? ? A G 23 N2 ? ? ? 1_555 A C 44 O2 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A G 23 O6 ? ? ? 1_555 A C 44 N4 ? ? B G 23 B C 44 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A A 24 N1 ? ? ? 1_555 A A 42 N6 ? ? B A 24 B A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog42 hydrog ? ? A A 24 N6 ? ? ? 1_555 A A 42 N7 ? ? B A 24 B A 42 1_555 ? ? ? ? ? ? TYPE_5_PAIR ? ? ? hydrog43 hydrog ? ? A G 26 N2 ? ? ? 1_555 A A 43 N7 ? ? B G 26 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog44 hydrog ? ? A G 26 N3 ? ? ? 1_555 A A 43 N6 ? ? B G 26 B A 43 1_555 ? ? ? ? ? ? TYPE_11_PAIR ? ? ? hydrog45 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 35 N3 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 35 O2 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 35 N4 ? ? B G 27 B C 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A G 29 N1 ? ? ? 1_555 A C 50 N3 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A G 29 N2 ? ? ? 1_555 A C 50 O2 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A G 29 O6 ? ? ? 1_555 A C 50 N4 ? ? B G 29 B C 50 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A A 30 N1 ? ? ? 1_555 A U 49 N3 ? ? B A 30 B U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A A 30 N6 ? ? ? 1_555 A U 49 O4 ? ? B A 30 B U 49 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A G 31 N1 ? ? ? 1_555 A C 48 N3 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog54 hydrog ? ? A G 31 N2 ? ? ? 1_555 A C 48 O2 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog55 hydrog ? ? A G 31 O6 ? ? ? 1_555 A C 48 N4 ? ? B G 31 B C 48 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A G 32 N1 ? ? ? 1_555 A C 47 N3 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A G 32 N2 ? ? ? 1_555 A C 47 O2 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A G 32 O6 ? ? ? 1_555 A C 47 N4 ? ? B G 32 B C 47 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 33 N3 ? ? ? 1_555 A G 46 N1 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A C 33 N4 ? ? ? 1_555 A G 46 O6 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A C 33 O2 ? ? ? 1_555 A G 46 N2 ? ? B C 33 B G 46 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 34 N1 ? ? ? 1_555 A C 45 N3 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 34 N2 ? ? ? 1_555 A C 45 O2 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 34 O6 ? ? ? 1_555 A C 45 N4 ? ? B G 34 B C 45 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 39 N2 ? ? ? 1_555 A U 41 O4 ? ? B G 39 B U 41 1_555 ? ? ? ? ? ? 'G-U MISPAIR' ? ? ? # loop_ _struct_conn_type.id _struct_conn_type.criteria _struct_conn_type.reference covale ? ? metalc ? ? hydrog ? ? # loop_ _pdbx_struct_conn_angle.id _pdbx_struct_conn_angle.ptnr1_label_atom_id _pdbx_struct_conn_angle.ptnr1_label_alt_id _pdbx_struct_conn_angle.ptnr1_label_asym_id _pdbx_struct_conn_angle.ptnr1_label_comp_id _pdbx_struct_conn_angle.ptnr1_label_seq_id _pdbx_struct_conn_angle.ptnr1_auth_atom_id _pdbx_struct_conn_angle.ptnr1_auth_asym_id _pdbx_struct_conn_angle.ptnr1_auth_comp_id _pdbx_struct_conn_angle.ptnr1_auth_seq_id _pdbx_struct_conn_angle.ptnr1_PDB_ins_code _pdbx_struct_conn_angle.ptnr1_symmetry _pdbx_struct_conn_angle.ptnr2_label_atom_id _pdbx_struct_conn_angle.ptnr2_label_alt_id _pdbx_struct_conn_angle.ptnr2_label_asym_id _pdbx_struct_conn_angle.ptnr2_label_comp_id _pdbx_struct_conn_angle.ptnr2_label_seq_id _pdbx_struct_conn_angle.ptnr2_auth_atom_id _pdbx_struct_conn_angle.ptnr2_auth_asym_id _pdbx_struct_conn_angle.ptnr2_auth_comp_id _pdbx_struct_conn_angle.ptnr2_auth_seq_id _pdbx_struct_conn_angle.ptnr2_PDB_ins_code _pdbx_struct_conn_angle.ptnr2_symmetry _pdbx_struct_conn_angle.ptnr3_label_atom_id _pdbx_struct_conn_angle.ptnr3_label_alt_id _pdbx_struct_conn_angle.ptnr3_label_asym_id _pdbx_struct_conn_angle.ptnr3_label_comp_id _pdbx_struct_conn_angle.ptnr3_label_seq_id _pdbx_struct_conn_angle.ptnr3_auth_atom_id _pdbx_struct_conn_angle.ptnr3_auth_asym_id _pdbx_struct_conn_angle.ptnr3_auth_comp_id _pdbx_struct_conn_angle.ptnr3_auth_seq_id _pdbx_struct_conn_angle.ptnr3_PDB_ins_code _pdbx_struct_conn_angle.ptnr3_symmetry _pdbx_struct_conn_angle.value _pdbx_struct_conn_angle.value_esd 1 O ? C HOH . ? B HOH 202 ? 1_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 202 ? 9_555 143.2 ? 2 O ? C HOH . ? B HOH 202 ? 1_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 205 ? 1_555 71.6 ? 3 O ? C HOH . ? B HOH 202 ? 9_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 205 ? 1_555 71.6 ? 4 O ? C HOH . ? B HOH 202 ? 1_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 205 ? 9_555 71.6 ? 5 O ? C HOH . ? B HOH 202 ? 9_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 205 ? 9_555 71.6 ? 6 O ? C HOH . ? B HOH 205 ? 1_555 MG ? B MG . ? B MG 101 ? 1_555 O ? C HOH . ? B HOH 205 ? 9_555 0.0 ? # _pdbx_entry_details.entry_id 9XAN _pdbx_entry_details.nonpolymer_details ? _pdbx_entry_details.sequence_details ? _pdbx_entry_details.compound_details ? _pdbx_entry_details.source_details ? _pdbx_entry_details.has_ligand_of_interest N _pdbx_entry_details.has_protein_modification N # _pdbx_validate_rmsd_angle.id 1 _pdbx_validate_rmsd_angle.PDB_model_num 1 _pdbx_validate_rmsd_angle.auth_atom_id_1 "O3'" _pdbx_validate_rmsd_angle.auth_asym_id_1 B _pdbx_validate_rmsd_angle.auth_comp_id_1 GTP _pdbx_validate_rmsd_angle.auth_seq_id_1 1 _pdbx_validate_rmsd_angle.PDB_ins_code_1 ? _pdbx_validate_rmsd_angle.label_alt_id_1 ? _pdbx_validate_rmsd_angle.auth_atom_id_2 P _pdbx_validate_rmsd_angle.auth_asym_id_2 B _pdbx_validate_rmsd_angle.auth_comp_id_2 G _pdbx_validate_rmsd_angle.auth_seq_id_2 2 _pdbx_validate_rmsd_angle.PDB_ins_code_2 ? _pdbx_validate_rmsd_angle.label_alt_id_2 ? _pdbx_validate_rmsd_angle.auth_atom_id_3 OP2 _pdbx_validate_rmsd_angle.auth_asym_id_3 B _pdbx_validate_rmsd_angle.auth_comp_id_3 G _pdbx_validate_rmsd_angle.auth_seq_id_3 2 _pdbx_validate_rmsd_angle.PDB_ins_code_3 ? _pdbx_validate_rmsd_angle.label_alt_id_3 ? _pdbx_validate_rmsd_angle.angle_value 118.25 _pdbx_validate_rmsd_angle.angle_target_value 110.50 _pdbx_validate_rmsd_angle.angle_deviation 7.75 _pdbx_validate_rmsd_angle.angle_standard_deviation 1.10 _pdbx_validate_rmsd_angle.linker_flag Y # loop_ _pdbx_struct_special_symmetry.id _pdbx_struct_special_symmetry.PDB_model_num _pdbx_struct_special_symmetry.auth_asym_id _pdbx_struct_special_symmetry.auth_comp_id _pdbx_struct_special_symmetry.auth_seq_id _pdbx_struct_special_symmetry.PDB_ins_code _pdbx_struct_special_symmetry.label_asym_id _pdbx_struct_special_symmetry.label_comp_id _pdbx_struct_special_symmetry.label_seq_id 1 1 B MG 101 ? B MG . 2 1 B HOH 205 ? C HOH . # _pdbx_refine_tls.id 1 _pdbx_refine_tls.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls.details ? _pdbx_refine_tls.method refined _pdbx_refine_tls.origin_x 4.0781 _pdbx_refine_tls.origin_y -29.9299 _pdbx_refine_tls.origin_z -0.6571 _pdbx_refine_tls.T[1][1] 0.3862 _pdbx_refine_tls.T[1][1]_esd ? _pdbx_refine_tls.T[1][2] 0.1073 _pdbx_refine_tls.T[1][2]_esd ? _pdbx_refine_tls.T[1][3] -0.0467 _pdbx_refine_tls.T[1][3]_esd ? _pdbx_refine_tls.T[2][2] 0.5348 _pdbx_refine_tls.T[2][2]_esd ? _pdbx_refine_tls.T[2][3] 0.1703 _pdbx_refine_tls.T[2][3]_esd ? _pdbx_refine_tls.T[3][3] 0.5044 _pdbx_refine_tls.T[3][3]_esd ? _pdbx_refine_tls.L[1][1] 3.6842 _pdbx_refine_tls.L[1][1]_esd ? _pdbx_refine_tls.L[1][2] 0.1600 _pdbx_refine_tls.L[1][2]_esd ? _pdbx_refine_tls.L[1][3] -0.3491 _pdbx_refine_tls.L[1][3]_esd ? _pdbx_refine_tls.L[2][2] 0.6538 _pdbx_refine_tls.L[2][2]_esd ? _pdbx_refine_tls.L[2][3] 0.0553 _pdbx_refine_tls.L[2][3]_esd ? _pdbx_refine_tls.L[3][3] 0.2568 _pdbx_refine_tls.L[3][3]_esd ? _pdbx_refine_tls.S[1][1] -0.0799 _pdbx_refine_tls.S[1][1]_esd ? _pdbx_refine_tls.S[1][2] -0.3117 _pdbx_refine_tls.S[1][2]_esd ? _pdbx_refine_tls.S[1][3] -0.5248 _pdbx_refine_tls.S[1][3]_esd ? _pdbx_refine_tls.S[2][1] 0.2182 _pdbx_refine_tls.S[2][1]_esd ? _pdbx_refine_tls.S[2][2] 0.0633 _pdbx_refine_tls.S[2][2]_esd ? _pdbx_refine_tls.S[2][3] 0.0825 _pdbx_refine_tls.S[2][3]_esd ? _pdbx_refine_tls.S[3][1] -0.2013 _pdbx_refine_tls.S[3][1]_esd ? _pdbx_refine_tls.S[3][2] -0.0973 _pdbx_refine_tls.S[3][2]_esd ? _pdbx_refine_tls.S[3][3] -0.0173 _pdbx_refine_tls.S[3][3]_esd ? # _pdbx_refine_tls_group.id 1 _pdbx_refine_tls_group.pdbx_refine_id 'X-RAY DIFFRACTION' _pdbx_refine_tls_group.refine_tls_id 1 _pdbx_refine_tls_group.beg_label_asym_id ? _pdbx_refine_tls_group.beg_label_seq_id ? _pdbx_refine_tls_group.beg_auth_asym_id ? _pdbx_refine_tls_group.beg_auth_seq_id ? _pdbx_refine_tls_group.beg_PDB_ins_code ? _pdbx_refine_tls_group.end_label_asym_id ? _pdbx_refine_tls_group.end_label_seq_id ? _pdbx_refine_tls_group.end_auth_asym_id ? _pdbx_refine_tls_group.end_auth_seq_id ? _pdbx_refine_tls_group.end_PDB_ins_code ? _pdbx_refine_tls_group.selection ? _pdbx_refine_tls_group.selection_details all # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 GTP PG P N N 111 GTP O1G O N N 112 GTP O2G O N N 113 GTP O3G O N N 114 GTP O3B O N N 115 GTP PB P N N 116 GTP O1B O N N 117 GTP O2B O N N 118 GTP O3A O N N 119 GTP PA P N N 120 GTP O1A O N N 121 GTP O2A O N N 122 GTP "O5'" O N N 123 GTP "C5'" C N N 124 GTP "C4'" C N R 125 GTP "O4'" O N N 126 GTP "C3'" C N S 127 GTP "O3'" O N N 128 GTP "C2'" C N R 129 GTP "O2'" O N N 130 GTP "C1'" C N R 131 GTP N9 N Y N 132 GTP C8 C Y N 133 GTP N7 N Y N 134 GTP C5 C Y N 135 GTP C6 C N N 136 GTP O6 O N N 137 GTP N1 N N N 138 GTP C2 C N N 139 GTP N2 N N N 140 GTP N3 N N N 141 GTP C4 C Y N 142 GTP HOG2 H N N 143 GTP HOG3 H N N 144 GTP HOB2 H N N 145 GTP HOA2 H N N 146 GTP "H5'" H N N 147 GTP "H5''" H N N 148 GTP "H4'" H N N 149 GTP "H3'" H N N 150 GTP "HO3'" H N N 151 GTP "H2'" H N N 152 GTP "HO2'" H N N 153 GTP "H1'" H N N 154 GTP H8 H N N 155 GTP HN1 H N N 156 GTP HN21 H N N 157 GTP HN22 H N N 158 HOH O O N N 159 HOH H1 H N N 160 HOH H2 H N N 161 MG MG MG N N 162 U OP3 O N N 163 U P P N N 164 U OP1 O N N 165 U OP2 O N N 166 U "O5'" O N N 167 U "C5'" C N N 168 U "C4'" C N R 169 U "O4'" O N N 170 U "C3'" C N S 171 U "O3'" O N N 172 U "C2'" C N R 173 U "O2'" O N N 174 U "C1'" C N R 175 U N1 N N N 176 U C2 C N N 177 U O2 O N N 178 U N3 N N N 179 U C4 C N N 180 U O4 O N N 181 U C5 C N N 182 U C6 C N N 183 U HOP3 H N N 184 U HOP2 H N N 185 U "H5'" H N N 186 U "H5''" H N N 187 U "H4'" H N N 188 U "H3'" H N N 189 U "HO3'" H N N 190 U "H2'" H N N 191 U "HO2'" H N N 192 U "H1'" H N N 193 U H3 H N N 194 U H5 H N N 195 U H6 H N N 196 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 GTP PG O1G doub N N 116 GTP PG O2G sing N N 117 GTP PG O3G sing N N 118 GTP PG O3B sing N N 119 GTP O2G HOG2 sing N N 120 GTP O3G HOG3 sing N N 121 GTP O3B PB sing N N 122 GTP PB O1B doub N N 123 GTP PB O2B sing N N 124 GTP PB O3A sing N N 125 GTP O2B HOB2 sing N N 126 GTP O3A PA sing N N 127 GTP PA O1A doub N N 128 GTP PA O2A sing N N 129 GTP PA "O5'" sing N N 130 GTP O2A HOA2 sing N N 131 GTP "O5'" "C5'" sing N N 132 GTP "C5'" "C4'" sing N N 133 GTP "C5'" "H5'" sing N N 134 GTP "C5'" "H5''" sing N N 135 GTP "C4'" "O4'" sing N N 136 GTP "C4'" "C3'" sing N N 137 GTP "C4'" "H4'" sing N N 138 GTP "O4'" "C1'" sing N N 139 GTP "C3'" "O3'" sing N N 140 GTP "C3'" "C2'" sing N N 141 GTP "C3'" "H3'" sing N N 142 GTP "O3'" "HO3'" sing N N 143 GTP "C2'" "O2'" sing N N 144 GTP "C2'" "C1'" sing N N 145 GTP "C2'" "H2'" sing N N 146 GTP "O2'" "HO2'" sing N N 147 GTP "C1'" N9 sing N N 148 GTP "C1'" "H1'" sing N N 149 GTP N9 C8 sing Y N 150 GTP N9 C4 sing Y N 151 GTP C8 N7 doub Y N 152 GTP C8 H8 sing N N 153 GTP N7 C5 sing Y N 154 GTP C5 C6 sing N N 155 GTP C5 C4 doub Y N 156 GTP C6 O6 doub N N 157 GTP C6 N1 sing N N 158 GTP N1 C2 sing N N 159 GTP N1 HN1 sing N N 160 GTP C2 N2 sing N N 161 GTP C2 N3 doub N N 162 GTP N2 HN21 sing N N 163 GTP N2 HN22 sing N N 164 GTP N3 C4 sing N N 165 HOH O H1 sing N N 166 HOH O H2 sing N N 167 U OP3 P sing N N 168 U OP3 HOP3 sing N N 169 U P OP1 doub N N 170 U P OP2 sing N N 171 U P "O5'" sing N N 172 U OP2 HOP2 sing N N 173 U "O5'" "C5'" sing N N 174 U "C5'" "C4'" sing N N 175 U "C5'" "H5'" sing N N 176 U "C5'" "H5''" sing N N 177 U "C4'" "O4'" sing N N 178 U "C4'" "C3'" sing N N 179 U "C4'" "H4'" sing N N 180 U "O4'" "C1'" sing N N 181 U "C3'" "O3'" sing N N 182 U "C3'" "C2'" sing N N 183 U "C3'" "H3'" sing N N 184 U "O3'" "HO3'" sing N N 185 U "C2'" "O2'" sing N N 186 U "C2'" "C1'" sing N N 187 U "C2'" "H2'" sing N N 188 U "O2'" "HO2'" sing N N 189 U "C1'" N1 sing N N 190 U "C1'" "H1'" sing N N 191 U N1 C2 sing N N 192 U N1 C6 sing N N 193 U C2 O2 doub N N 194 U C2 N3 sing N N 195 U N3 C4 sing N N 196 U N3 H3 sing N N 197 U C4 O4 doub N N 198 U C4 C5 sing N N 199 U C5 C6 doub N N 200 U C5 H5 sing N N 201 U C6 H6 sing N N 202 # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 9XAN 'double helix' 9XAN 'a-form double helix' 9XAN 'hairpin loop' 9XAN tetraloop 9XAN 'bulge loop' 9XAN 'mismatched base pair' 9XAN 'three-way junction' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A GTP 1 1_555 A C 57 1_555 -0.518 -0.173 0.135 -2.669 -9.823 2.413 1 B_GTP1:C57_B B 1 ? B 57 ? 19 1 1 A G 2 1_555 A C 56 1_555 0.115 0.058 0.008 -4.487 -18.691 5.353 2 B_G2:C56_B B 2 ? B 56 ? 19 1 1 A A 3 1_555 A U 55 1_555 0.032 -0.239 0.210 -0.707 -14.697 2.341 3 B_A3:U55_B B 3 ? B 55 ? 20 1 1 A A 4 1_555 A U 54 1_555 -0.049 -0.047 0.013 -1.893 -16.953 2.089 4 B_A4:U54_B B 4 ? B 54 ? 20 1 1 A C 5 1_555 A G 53 1_555 0.215 -0.163 0.230 -0.949 -21.074 5.717 5 B_C5:G53_B B 5 ? B 53 ? 19 1 1 A C 6 1_555 A G 52 1_555 0.405 -0.175 0.620 -11.898 -13.499 -0.570 6 B_C6:G52_B B 6 ? B 52 ? 19 1 1 A U 7 1_555 A A 51 1_555 0.049 -0.048 0.352 5.016 -6.849 -1.166 7 B_U7:A51_B B 7 ? B 51 ? 20 1 1 A G 29 1_555 A C 50 1_555 -0.204 -0.172 -0.098 2.632 -5.571 2.330 8 B_G29:C50_B B 29 ? B 50 ? 19 1 1 A A 30 1_555 A U 49 1_555 -0.399 -0.141 -0.074 -14.661 -11.948 9.778 9 B_A30:U49_B B 30 ? B 49 ? 20 1 1 A G 31 1_555 A C 48 1_555 -0.094 -0.183 -0.063 -12.438 -12.387 -1.095 10 B_G31:C48_B B 31 ? B 48 ? 19 1 1 A G 32 1_555 A C 47 1_555 0.051 -0.039 -0.286 -12.472 -10.817 2.328 11 B_G32:C47_B B 32 ? B 47 ? 19 1 1 A C 33 1_555 A G 46 1_555 0.405 -0.337 0.144 -0.128 -14.092 -1.155 12 B_C33:G46_B B 33 ? B 46 ? 19 1 1 A G 34 1_555 A C 45 1_555 -0.142 -0.222 -0.125 -2.048 -12.738 5.491 13 B_G34:C45_B B 34 ? B 45 ? 19 1 1 A C 35 1_555 A G 27 1_555 0.492 -0.244 -0.408 -7.181 -1.313 2.843 14 B_C35:G27_B B 35 ? B 27 ? 19 1 1 A A 16 1_555 A G 13 1_555 -6.989 -4.849 1.190 -12.625 1.336 -10.457 15 B_A16:G13_B B 16 ? B 13 ? 11 10 1 A G 17 1_555 A C 12 1_555 -0.624 -0.201 0.151 0.361 -3.090 2.763 16 B_G17:C12_B B 17 ? B 12 ? 19 1 1 A G 18 1_555 A C 11 1_555 -0.564 -0.020 0.097 2.123 -13.532 6.704 17 B_G18:C11_B B 18 ? B 11 ? 19 1 1 A C 19 1_555 A G 10 1_555 0.198 -0.224 0.242 1.380 -14.532 1.938 18 B_C19:G10_B B 19 ? B 10 ? 19 1 1 A G 20 1_555 A C 9 1_555 -0.243 -0.284 0.121 -6.342 -17.795 2.159 19 B_G20:C9_B B 20 ? B 9 ? 19 1 1 A G 21 1_555 A C 8 1_555 0.119 0.080 -0.085 -13.786 -18.638 2.795 20 B_G21:C8_B B 21 ? B 8 ? 19 1 1 A U 22 1_555 A A 28 1_555 -0.138 0.072 0.190 -14.617 -7.661 0.662 21 B_U22:A28_B B 22 ? B 28 ? 20 1 1 A G 23 1_555 A C 44 1_555 -0.572 -0.195 -0.271 -13.301 7.098 -1.421 22 B_G23:C44_B B 23 ? B 44 ? 19 1 1 A G 26 1_555 A A 43 1_555 6.703 -4.174 0.135 -17.346 -21.795 2.092 23 B_G26:A43_B B 26 ? B 43 ? 11 10 1 A A 24 1_555 A A 42 1_555 4.223 1.240 0.427 1.834 -4.346 -109.373 24 B_A24:A42_B B 24 ? B 42 ? 5 4 1 A G 39 1_555 A U 41 1_555 3.133 1.246 -1.259 3.738 52.354 77.099 25 B_G39:U41_B B 39 ? B 41 ? ? ? # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A GTP 1 1_555 A C 57 1_555 A G 2 1_555 A C 56 1_555 0.052 -1.377 3.165 -0.393 14.299 38.753 -3.343 -0.112 2.524 20.709 0.569 41.214 1 BB_GTP1G2:C56C57_BB B 1 ? B 57 ? B 2 ? B 56 ? 1 A G 2 1_555 A C 56 1_555 A A 3 1_555 A U 55 1_555 -0.011 -1.366 3.078 0.021 7.227 30.649 -3.727 0.024 2.694 13.439 -0.040 31.469 2 BB_G2A3:U55C56_BB B 2 ? B 56 ? B 3 ? B 55 ? 1 A A 3 1_555 A U 55 1_555 A A 4 1_555 A U 54 1_555 -0.270 -1.041 3.169 1.881 10.163 33.546 -3.136 0.710 2.729 17.110 -3.166 35.059 3 BB_A3A4:U54U55_BB B 3 ? B 55 ? B 4 ? B 54 ? 1 A A 4 1_555 A U 54 1_555 A C 5 1_555 A G 53 1_555 0.877 -1.384 3.207 1.571 6.685 31.735 -3.586 -1.308 2.902 12.050 -2.832 32.451 4 BB_A4C5:G53U54_BB B 4 ? B 54 ? B 5 ? B 53 ? 1 A C 5 1_555 A G 53 1_555 A C 6 1_555 A G 52 1_555 -0.242 -1.575 3.383 -1.472 11.652 35.996 -3.878 0.191 2.767 18.265 2.308 37.803 5 BB_C5C6:G52G53_BB B 5 ? B 53 ? B 6 ? B 52 ? 1 A C 6 1_555 A G 52 1_555 A U 7 1_555 A A 51 1_555 0.041 -1.131 2.754 3.741 7.332 28.498 -3.451 0.553 2.381 14.516 -7.407 29.640 6 BB_C6U7:A51G52_BB B 6 ? B 52 ? B 7 ? B 51 ? 1 A U 7 1_555 A A 51 1_555 A G 29 1_555 A C 50 1_555 -1.142 -1.596 3.162 0.387 14.385 40.958 -3.410 1.581 2.481 19.833 -0.534 43.310 7 BB_U7G29:C50A51_BB B 7 ? B 51 ? B 29 ? B 50 ? 1 A G 29 1_555 A C 50 1_555 A A 30 1_555 A U 49 1_555 0.127 -2.186 3.465 -0.974 10.724 36.257 -4.715 -0.318 2.728 16.782 1.524 37.770 8 BB_G29A30:U49C50_BB B 29 ? B 50 ? B 30 ? B 49 ? 1 A A 30 1_555 A U 49 1_555 A G 31 1_555 A C 48 1_555 -1.171 -1.593 3.068 -0.438 6.712 31.885 -3.884 2.020 2.700 12.051 0.786 32.569 9 BB_A30G31:C48U49_BB B 30 ? B 49 ? B 31 ? B 48 ? 1 A G 31 1_555 A C 48 1_555 A G 32 1_555 A C 47 1_555 -0.155 -1.103 3.283 2.100 10.213 33.292 -3.325 0.564 2.818 17.306 -3.558 34.842 10 BB_G31G32:C47C48_BB B 31 ? B 48 ? B 32 ? B 47 ? 1 A G 32 1_555 A C 47 1_555 A C 33 1_555 A G 46 1_555 0.410 -1.132 2.933 -1.915 6.067 29.711 -3.207 -1.114 2.625 11.663 3.682 30.370 11 BB_G32C33:G46C47_BB B 32 ? B 47 ? B 33 ? B 46 ? 1 A C 33 1_555 A G 46 1_555 A G 34 1_555 A C 45 1_555 0.934 -1.550 3.236 3.043 8.784 28.105 -4.777 -1.227 2.722 17.493 -6.060 29.573 12 BB_C33G34:C45G46_BB B 33 ? B 46 ? B 34 ? B 45 ? 1 A G 34 1_555 A C 45 1_555 A C 35 1_555 A G 27 1_555 2.067 -1.008 3.329 6.709 -4.392 53.586 -0.820 -1.832 3.610 -4.841 -7.395 54.139 13 BB_G34C35:G27C45_BB B 34 ? B 45 ? B 35 ? B 27 ? 1 A A 16 1_555 A G 13 1_555 A G 17 1_555 A C 12 1_555 2.210 -1.055 2.829 3.078 9.905 46.972 -1.963 -2.507 2.698 12.252 -3.808 48.040 14 BB_A16G17:C12G13_BB B 16 ? B 13 ? B 17 ? B 12 ? 1 A G 17 1_555 A C 12 1_555 A G 18 1_555 A C 11 1_555 -0.362 -1.587 3.180 -1.305 2.976 31.681 -3.410 0.433 3.034 5.434 2.382 31.843 15 BB_G17G18:C11C12_BB B 17 ? B 12 ? B 18 ? B 11 ? 1 A G 18 1_555 A C 11 1_555 A C 19 1_555 A G 10 1_555 -0.041 -1.100 3.294 -0.666 5.729 36.234 -2.518 -0.024 3.090 9.140 1.063 36.675 16 BB_G18C19:G10C11_BB B 18 ? B 11 ? B 19 ? B 10 ? 1 A C 19 1_555 A G 10 1_555 A G 20 1_555 A C 9 1_555 0.438 -1.716 3.320 2.394 10.783 26.395 -5.736 -0.385 2.472 22.407 -4.975 28.575 17 BB_C19G20:C9G10_BB B 19 ? B 10 ? B 20 ? B 9 ? 1 A G 20 1_555 A C 9 1_555 A G 21 1_555 A C 8 1_555 0.233 -1.733 3.318 3.042 7.466 36.456 -3.664 0.024 2.929 11.758 -4.791 37.308 18 BB_G20G21:C8C9_BB B 20 ? B 9 ? B 21 ? B 8 ? 1 A G 21 1_555 A C 8 1_555 A U 22 1_555 A A 28 1_555 -0.735 -0.943 3.284 -0.230 -2.639 30.476 -1.257 1.347 3.357 -5.008 0.437 30.588 19 BB_G21U22:A28C8_BB B 21 ? B 8 ? B 22 ? B 28 ? 1 A U 22 1_555 A A 28 1_555 A G 23 1_555 A C 44 1_555 2.241 0.365 3.163 14.578 3.064 43.108 0.179 -1.506 3.712 4.029 -19.170 45.493 20 BB_U22G23:C44A28_BB B 22 ? B 28 ? B 23 ? B 44 ? 1 A G 23 1_555 A C 44 1_555 A G 26 1_555 A A 43 1_555 -0.149 -0.019 3.857 9.386 27.170 68.225 -1.063 0.486 3.599 23.211 -8.018 73.352 21 BB_G23G26:A43C44_BB B 23 ? B 44 ? B 26 ? B 43 ? 1 A G 26 1_555 A A 43 1_555 A A 24 1_555 A A 42 1_555 -1.696 0.222 3.047 -0.461 6.187 -16.007 -4.324 -5.952 2.719 -21.209 -1.581 -17.160 22 BB_G26A24:A42A43_BB B 26 ? B 43 ? B 24 ? B 42 ? # _pdbx_audit_support.funding_organization 'National Natural Science Foundation of China (NSFC)' _pdbx_audit_support.country China _pdbx_audit_support.grant_number ? _pdbx_audit_support.ordinal 1 # _pdbx_initial_refinement_model.id 1 _pdbx_initial_refinement_model.entity_id_list ? _pdbx_initial_refinement_model.type 'experimental model' _pdbx_initial_refinement_model.source_name PDB _pdbx_initial_refinement_model.accession_code 9L8F _pdbx_initial_refinement_model.details ? # _atom_sites.entry_id 9XAN _atom_sites.Cartn_transf_matrix[1][1] ? _atom_sites.Cartn_transf_matrix[1][2] ? _atom_sites.Cartn_transf_matrix[1][3] ? _atom_sites.Cartn_transf_matrix[2][1] ? _atom_sites.Cartn_transf_matrix[2][2] ? _atom_sites.Cartn_transf_matrix[2][3] ? _atom_sites.Cartn_transf_matrix[3][1] ? _atom_sites.Cartn_transf_matrix[3][2] ? _atom_sites.Cartn_transf_matrix[3][3] ? _atom_sites.Cartn_transf_vector[1] ? _atom_sites.Cartn_transf_vector[2] ? _atom_sites.Cartn_transf_vector[3] ? _atom_sites.Cartn_transform_axes ? _atom_sites.fract_transf_matrix[1][1] 0.012040 _atom_sites.fract_transf_matrix[1][2] 0.006951 _atom_sites.fract_transf_matrix[1][3] 0.000000 _atom_sites.fract_transf_matrix[2][1] 0.000000 _atom_sites.fract_transf_matrix[2][2] 0.013902 _atom_sites.fract_transf_matrix[2][3] 0.000000 _atom_sites.fract_transf_matrix[3][1] 0.000000 _atom_sites.fract_transf_matrix[3][2] 0.000000 _atom_sites.fract_transf_matrix[3][3] 0.009806 _atom_sites.fract_transf_vector[1] 0.00000 _atom_sites.fract_transf_vector[2] 0.00000 _atom_sites.fract_transf_vector[3] 0.00000 _atom_sites.solution_primary ? _atom_sites.solution_secondary ? _atom_sites.solution_hydrogens ? _atom_sites.special_details ? # loop_ _atom_type.symbol C MG N O P # loop_ # loop_ #