data_8UYG # _entry.id 8UYG # _audit_conform.dict_name mmcif_pdbx.dic _audit_conform.dict_version 5.388 _audit_conform.dict_location http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic # loop_ _database_2.database_id _database_2.database_code _database_2.pdbx_database_accession _database_2.pdbx_DOI PDB 8UYG pdb_00008uyg 10.2210/pdb8uyg/pdb WWPDB D_1000279143 ? ? EMDB EMD-42805 ? ? # loop_ _pdbx_audit_revision_history.ordinal _pdbx_audit_revision_history.data_content_type _pdbx_audit_revision_history.major_revision _pdbx_audit_revision_history.minor_revision _pdbx_audit_revision_history.revision_date 1 'Structure model' 1 0 2023-12-06 2 'Structure model' 1 1 2023-12-27 3 'Structure model' 1 2 2024-03-13 # _pdbx_audit_revision_details.ordinal 1 _pdbx_audit_revision_details.revision_ordinal 1 _pdbx_audit_revision_details.data_content_type 'Structure model' _pdbx_audit_revision_details.provider repository _pdbx_audit_revision_details.type 'Initial release' _pdbx_audit_revision_details.description ? _pdbx_audit_revision_details.details ? # loop_ _pdbx_audit_revision_group.ordinal _pdbx_audit_revision_group.revision_ordinal _pdbx_audit_revision_group.data_content_type _pdbx_audit_revision_group.group 1 2 'Structure model' 'Database references' 2 3 'Structure model' 'Database references' # loop_ _pdbx_audit_revision_category.ordinal _pdbx_audit_revision_category.revision_ordinal _pdbx_audit_revision_category.data_content_type _pdbx_audit_revision_category.category 1 2 'Structure model' citation 2 3 'Structure model' citation 3 3 'Structure model' citation_author # loop_ _pdbx_audit_revision_item.ordinal _pdbx_audit_revision_item.revision_ordinal _pdbx_audit_revision_item.data_content_type _pdbx_audit_revision_item.item 1 2 'Structure model' '_citation.pdbx_database_id_PubMed' 2 2 'Structure model' '_citation.title' # _pdbx_database_status.status_code REL _pdbx_database_status.status_code_sf ? _pdbx_database_status.status_code_mr ? _pdbx_database_status.entry_id 8UYG _pdbx_database_status.recvd_initial_deposition_date 2023-11-13 _pdbx_database_status.SG_entry N _pdbx_database_status.deposit_site RCSB _pdbx_database_status.process_site RCSB _pdbx_database_status.status_code_cs ? _pdbx_database_status.status_code_nmr_data ? _pdbx_database_status.methods_development_category ? _pdbx_database_status.pdb_format_compatible Y # loop_ _pdbx_database_related.db_name _pdbx_database_related.details _pdbx_database_related.db_id _pdbx_database_related.content_type EMDB . EMD-42801 'other EM volume' EMDB . EMD-42802 'other EM volume' EMDB . EMD-42803 'other EM volume' PDB . 8UYE unspecified EMDB ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 2 ; EMD-42805 'associated EM volume' # loop_ _pdbx_contact_author.id _pdbx_contact_author.email _pdbx_contact_author.name_first _pdbx_contact_author.name_last _pdbx_contact_author.name_mi _pdbx_contact_author.role _pdbx_contact_author.identifier_ORCID 2 rhiju@stanford.edu Rhiju Das ? 'principal investigator/group leader' 0000-0001-7497-0972 3 wahc@stanford.edu Wah Chiu ? 'principal investigator/group leader' 0000-0002-8910-3078 # loop_ _audit_author.name _audit_author.pdbx_ordinal _audit_author.identifier_ORCID 'Kretsch, R.C.' 1 0000-0002-6935-518X 'Xu, L.' 2 0000-0002-1200-8937 'Zheludev, I.N.' 3 0000-0002-9572-0574 'Zhou, X.' 4 0000-0002-0722-7334 'Huang, R.' 5 0009-0009-6136-8013 'Nye, G.' 6 0009-0001-6698-9988 'Li, S.' 7 0000-0002-7041-5960 'Zhang, K.' 8 0000-0003-0414-4776 'Chiu, W.' 9 0000-0002-8910-3078 'Das, R.' 10 0000-0001-7497-0972 # loop_ _citation.abstract _citation.abstract_id_CAS _citation.book_id_ISBN _citation.book_publisher _citation.book_publisher_city _citation.book_title _citation.coordinate_linkage _citation.country _citation.database_id_Medline _citation.details _citation.id _citation.journal_abbrev _citation.journal_id_ASTM _citation.journal_id_CSD _citation.journal_id_ISSN _citation.journal_full _citation.journal_issue _citation.journal_volume _citation.language _citation.page_first _citation.page_last _citation.title _citation.year _citation.database_id_CSD _citation.pdbx_database_id_DOI _citation.pdbx_database_id_PubMed _citation.pdbx_database_id_patent _citation.unpublished_flag ? ? ? ? ? ? ? US ? ? primary Proc.Natl.Acad.Sci.USA PNASA6 0040 1091-6490 ? ? 121 ? e2320493121 e2320493121 ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2024 ? 10.1073/pnas.2320493121 38427602 ? ? ? ? ? ? ? ? ? US ? ? 1 Biorxiv ? ? 2692-8205 ? ? ? ? ? ? ;Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. ; 2023 ? 10.1101/2023.11.22.567964 38076883 ? ? # loop_ _citation_author.citation_id _citation_author.name _citation_author.ordinal _citation_author.identifier_ORCID primary 'Kretsch, R.C.' 1 0000-0002-6935-518X primary 'Xu, L.' 2 0000-0002-1200-8937 primary 'Zheludev, I.N.' 3 ? primary 'Zhou, X.' 4 0000-0002-0722-7334 primary 'Huang, R.' 5 ? primary 'Nye, G.' 6 ? primary 'Li, S.' 7 ? primary 'Zhang, K.' 8 ? primary 'Chiu, W.' 9 0000-0002-8910-3078 primary 'Das, R.' 10 0000-0001-7497-0972 1 'Kretsch, R.C.' 11 ? 1 'Xu, L.' 12 ? 1 'Zheludev, I.N.' 13 ? 1 'Zhou, X.' 14 ? 1 'Huang, R.' 15 ? 1 'Nye, G.' 16 ? 1 'Li, S.' 17 ? 1 'Zhang, K.' 18 ? 1 'Chiu, W.' 19 ? 1 'Das, R.' 20 ? # _entity.id 1 _entity.type polymer _entity.src_method syn _entity.pdbx_description 'RNA (135-MER)' _entity.formula_weight 43510.676 _entity.pdbx_number_of_molecules 1 _entity.pdbx_ec ? _entity.pdbx_mutation ? _entity.pdbx_fragment ? _entity.details ? # _entity_poly.entity_id 1 _entity_poly.type polyribonucleotide _entity_poly.nstd_linkage no _entity_poly.nstd_monomer no _entity_poly.pdbx_seq_one_letter_code ;GGAGCAUCGUGUCUCAAGUGCUUCACGGUCACAAUAUACCGUUUCGUCGGGUGCGUGGCAAUUCGGUGCACAUCAUGUCU UUCGUGGCUGGUGUGGCUCCUCAAGGUGCGAGGGGCAAGUAUAGAGCAGAGCUCC ; _entity_poly.pdbx_seq_one_letter_code_can ;GGAGCAUCGUGUCUCAAGUGCUUCACGGUCACAAUAUACCGUUUCGUCGGGUGCGUGGCAAUUCGGUGCACAUCAUGUCU UUCGUGGCUGGUGUGGCUCCUCAAGGUGCGAGGGGCAAGUAUAGAGCAGAGCUCC ; _entity_poly.pdbx_strand_id A _entity_poly.pdbx_target_identifier ? # loop_ _entity_poly_seq.entity_id _entity_poly_seq.num _entity_poly_seq.mon_id _entity_poly_seq.hetero 1 1 G n 1 2 G n 1 3 A n 1 4 G n 1 5 C n 1 6 A n 1 7 U n 1 8 C n 1 9 G n 1 10 U n 1 11 G n 1 12 U n 1 13 C n 1 14 U n 1 15 C n 1 16 A n 1 17 A n 1 18 G n 1 19 U n 1 20 G n 1 21 C n 1 22 U n 1 23 U n 1 24 C n 1 25 A n 1 26 C n 1 27 G n 1 28 G n 1 29 U n 1 30 C n 1 31 A n 1 32 C n 1 33 A n 1 34 A n 1 35 U n 1 36 A n 1 37 U n 1 38 A n 1 39 C n 1 40 C n 1 41 G n 1 42 U n 1 43 U n 1 44 U n 1 45 C n 1 46 G n 1 47 U n 1 48 C n 1 49 G n 1 50 G n 1 51 G n 1 52 U n 1 53 G n 1 54 C n 1 55 G n 1 56 U n 1 57 G n 1 58 G n 1 59 C n 1 60 A n 1 61 A n 1 62 U n 1 63 U n 1 64 C n 1 65 G n 1 66 G n 1 67 U n 1 68 G n 1 69 C n 1 70 A n 1 71 C n 1 72 A n 1 73 U n 1 74 C n 1 75 A n 1 76 U n 1 77 G n 1 78 U n 1 79 C n 1 80 U n 1 81 U n 1 82 U n 1 83 C n 1 84 G n 1 85 U n 1 86 G n 1 87 G n 1 88 C n 1 89 U n 1 90 G n 1 91 G n 1 92 U n 1 93 G n 1 94 U n 1 95 G n 1 96 G n 1 97 C n 1 98 U n 1 99 C n 1 100 C n 1 101 U n 1 102 C n 1 103 A n 1 104 A n 1 105 G n 1 106 G n 1 107 U n 1 108 G n 1 109 C n 1 110 G n 1 111 A n 1 112 G n 1 113 G n 1 114 G n 1 115 G n 1 116 C n 1 117 A n 1 118 A n 1 119 G n 1 120 U n 1 121 A n 1 122 U n 1 123 A n 1 124 G n 1 125 A n 1 126 G n 1 127 C n 1 128 A n 1 129 G n 1 130 A n 1 131 G n 1 132 C n 1 133 U n 1 134 C n 1 135 C n # _pdbx_entity_src_syn.entity_id 1 _pdbx_entity_src_syn.pdbx_src_id 1 _pdbx_entity_src_syn.pdbx_alt_source_flag sample _pdbx_entity_src_syn.pdbx_beg_seq_num 1 _pdbx_entity_src_syn.pdbx_end_seq_num 135 _pdbx_entity_src_syn.organism_scientific 'Pipistrellus bat coronavirus HKU5' _pdbx_entity_src_syn.organism_common_name ? _pdbx_entity_src_syn.ncbi_taxonomy_id 694008 _pdbx_entity_src_syn.details ? # loop_ _chem_comp.id _chem_comp.type _chem_comp.mon_nstd_flag _chem_comp.name _chem_comp.pdbx_synonyms _chem_comp.formula _chem_comp.formula_weight A 'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 C 'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P' 323.197 G 'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 U 'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P' 324.181 # loop_ _pdbx_poly_seq_scheme.asym_id _pdbx_poly_seq_scheme.entity_id _pdbx_poly_seq_scheme.seq_id _pdbx_poly_seq_scheme.mon_id _pdbx_poly_seq_scheme.ndb_seq_num _pdbx_poly_seq_scheme.pdb_seq_num _pdbx_poly_seq_scheme.auth_seq_num _pdbx_poly_seq_scheme.pdb_mon_id _pdbx_poly_seq_scheme.auth_mon_id _pdbx_poly_seq_scheme.pdb_strand_id _pdbx_poly_seq_scheme.pdb_ins_code _pdbx_poly_seq_scheme.hetero A 1 1 G 1 187 187 G G A . n A 1 2 G 2 188 188 G G A . n A 1 3 A 3 189 189 A A A . n A 1 4 G 4 190 190 G G A . n A 1 5 C 5 191 191 C C A . n A 1 6 A 6 192 192 A A A . n A 1 7 U 7 193 193 U U A . n A 1 8 C 8 194 194 C C A . n A 1 9 G 9 195 195 G G A . n A 1 10 U 10 196 196 U U A . n A 1 11 G 11 197 197 G G A . n A 1 12 U 12 198 198 U U A . n A 1 13 C 13 199 199 C C A . n A 1 14 U 14 200 200 U U A . n A 1 15 C 15 201 201 C C A . n A 1 16 A 16 202 202 A A A . n A 1 17 A 17 203 203 A A A . n A 1 18 G 18 204 204 G G A . n A 1 19 U 19 205 205 U U A . n A 1 20 G 20 206 206 G G A . n A 1 21 C 21 207 207 C C A . n A 1 22 U 22 208 208 U U A . n A 1 23 U 23 209 209 U U A . n A 1 24 C 24 210 210 C C A . n A 1 25 A 25 211 211 A A A . n A 1 26 C 26 212 212 C C A . n A 1 27 G 27 213 213 G G A . n A 1 28 G 28 214 214 G G A . n A 1 29 U 29 215 215 U U A . n A 1 30 C 30 216 216 C C A . n A 1 31 A 31 217 217 A A A . n A 1 32 C 32 218 218 C C A . n A 1 33 A 33 219 219 A A A . n A 1 34 A 34 220 220 A A A . n A 1 35 U 35 221 221 U U A . n A 1 36 A 36 222 222 A A A . n A 1 37 U 37 223 223 U U A . n A 1 38 A 38 224 224 A A A . n A 1 39 C 39 225 225 C C A . n A 1 40 C 40 226 226 C C A . n A 1 41 G 41 227 227 G G A . n A 1 42 U 42 228 228 U U A . n A 1 43 U 43 229 229 U U A . n A 1 44 U 44 230 230 U U A . n A 1 45 C 45 231 231 C C A . n A 1 46 G 46 232 232 G G A . n A 1 47 U 47 233 233 U U A . n A 1 48 C 48 234 234 C C A . n A 1 49 G 49 235 235 G G A . n A 1 50 G 50 236 236 G G A . n A 1 51 G 51 237 237 G G A . n A 1 52 U 52 238 238 U U A . n A 1 53 G 53 239 239 G G A . n A 1 54 C 54 240 240 C C A . n A 1 55 G 55 241 241 G G A . n A 1 56 U 56 242 242 U U A . n A 1 57 G 57 243 243 G G A . n A 1 58 G 58 244 244 G G A . n A 1 59 C 59 245 245 C C A . n A 1 60 A 60 246 246 A A A . n A 1 61 A 61 247 247 A A A . n A 1 62 U 62 248 248 U U A . n A 1 63 U 63 249 249 U U A . n A 1 64 C 64 250 250 C C A . n A 1 65 G 65 251 251 G G A . n A 1 66 G 66 252 252 G G A . n A 1 67 U 67 253 253 U U A . n A 1 68 G 68 254 254 G G A . n A 1 69 C 69 255 255 C C A . n A 1 70 A 70 256 256 A A A . n A 1 71 C 71 257 257 C C A . n A 1 72 A 72 258 258 A A A . n A 1 73 U 73 259 259 U U A . n A 1 74 C 74 260 260 C C A . n A 1 75 A 75 261 261 A A A . n A 1 76 U 76 262 262 U U A . n A 1 77 G 77 263 263 G G A . n A 1 78 U 78 264 264 U U A . n A 1 79 C 79 265 265 C C A . n A 1 80 U 80 266 266 U U A . n A 1 81 U 81 267 267 U U A . n A 1 82 U 82 268 268 U U A . n A 1 83 C 83 269 269 C C A . n A 1 84 G 84 270 270 G G A . n A 1 85 U 85 271 271 U U A . n A 1 86 G 86 272 272 G G A . n A 1 87 G 87 273 273 G G A . n A 1 88 C 88 274 274 C C A . n A 1 89 U 89 275 275 U U A . n A 1 90 G 90 276 276 G G A . n A 1 91 G 91 277 277 G G A . n A 1 92 U 92 278 278 U U A . n A 1 93 G 93 279 279 G G A . n A 1 94 U 94 280 280 U U A . n A 1 95 G 95 281 281 G G A . n A 1 96 G 96 282 282 G G A . n A 1 97 C 97 283 283 C C A . n A 1 98 U 98 284 284 U U A . n A 1 99 C 99 285 285 C C A . n A 1 100 C 100 286 286 C C A . n A 1 101 U 101 287 287 U U A . n A 1 102 C 102 288 288 C C A . n A 1 103 A 103 289 289 A A A . n A 1 104 A 104 290 290 A A A . n A 1 105 G 105 291 291 G G A . n A 1 106 G 106 292 292 G G A . n A 1 107 U 107 293 293 U U A . n A 1 108 G 108 294 294 G G A . n A 1 109 C 109 295 295 C C A . n A 1 110 G 110 296 296 G G A . n A 1 111 A 111 297 297 A A A . n A 1 112 G 112 298 298 G G A . n A 1 113 G 113 299 299 G G A . n A 1 114 G 114 300 300 G G A . n A 1 115 G 115 301 301 G G A . n A 1 116 C 116 302 302 C C A . n A 1 117 A 117 303 303 A A A . n A 1 118 A 118 304 304 A A A . n A 1 119 G 119 305 305 G G A . n A 1 120 U 120 306 306 U U A . n A 1 121 A 121 307 307 A A A . n A 1 122 U 122 308 308 U U A . n A 1 123 A 123 309 309 A A A . n A 1 124 G 124 310 310 G G A . n A 1 125 A 125 311 311 A A A . n A 1 126 G 126 312 312 G G A . n A 1 127 C 127 313 313 C C A . n A 1 128 A 128 314 314 A A A . n A 1 129 G 129 315 315 G G A . n A 1 130 A 130 316 316 A A A . n A 1 131 G 131 317 317 G G A . n A 1 132 C 132 318 318 C C A . n A 1 133 U 133 319 319 U U A . n A 1 134 C 134 320 320 C C A . n A 1 135 C 135 321 321 C C A . n # _exptl.absorpt_coefficient_mu ? _exptl.absorpt_correction_T_max ? _exptl.absorpt_correction_T_min ? _exptl.absorpt_correction_type ? _exptl.absorpt_process_details ? _exptl.entry_id 8UYG _exptl.crystals_number ? _exptl.details ? _exptl.method 'ELECTRON MICROSCOPY' _exptl.method_details ? # _struct.entry_id 8UYG _struct.title ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 2 ; _struct.pdbx_model_details ? _struct.pdbx_formula_weight ? _struct.pdbx_formula_weight_method ? _struct.pdbx_model_type_details ? _struct.pdbx_CASP_flag N # _struct_keywords.entry_id 8UYG _struct_keywords.text ;SL5, coronavirus, 5' UTR, RNA ; _struct_keywords.pdbx_keywords RNA # _struct_asym.id A _struct_asym.pdbx_blank_PDB_chainid_flag N _struct_asym.pdbx_modified N _struct_asym.entity_id 1 _struct_asym.details ? # _struct_ref.id 1 _struct_ref.db_name PDB _struct_ref.db_code 8UYG _struct_ref.pdbx_db_accession 8UYG _struct_ref.pdbx_db_isoform ? _struct_ref.entity_id 1 _struct_ref.pdbx_seq_one_letter_code ? _struct_ref.pdbx_align_begin 1 # _struct_ref_seq.align_id 1 _struct_ref_seq.ref_id 1 _struct_ref_seq.pdbx_PDB_id_code 8UYG _struct_ref_seq.pdbx_strand_id A _struct_ref_seq.seq_align_beg 1 _struct_ref_seq.pdbx_seq_align_beg_ins_code ? _struct_ref_seq.seq_align_end 135 _struct_ref_seq.pdbx_seq_align_end_ins_code ? _struct_ref_seq.pdbx_db_accession 8UYG _struct_ref_seq.db_align_beg 187 _struct_ref_seq.pdbx_db_align_beg_ins_code ? _struct_ref_seq.db_align_end 321 _struct_ref_seq.pdbx_db_align_end_ins_code ? _struct_ref_seq.pdbx_auth_seq_align_beg 187 _struct_ref_seq.pdbx_auth_seq_align_end 321 # _pdbx_struct_assembly.id 1 _pdbx_struct_assembly.details author_defined_assembly _pdbx_struct_assembly.method_details ? _pdbx_struct_assembly.oligomeric_details monomeric _pdbx_struct_assembly.oligomeric_count 1 # _pdbx_struct_assembly_gen.assembly_id 1 _pdbx_struct_assembly_gen.oper_expression 1 _pdbx_struct_assembly_gen.asym_id_list A # _pdbx_struct_assembly_auth_evidence.id 1 _pdbx_struct_assembly_auth_evidence.assembly_id 1 _pdbx_struct_assembly_auth_evidence.experimental_support 'electron microscopy' _pdbx_struct_assembly_auth_evidence.details 'not applicable' # _pdbx_struct_oper_list.id 1 _pdbx_struct_oper_list.type 'identity operation' _pdbx_struct_oper_list.name 1_555 _pdbx_struct_oper_list.symmetry_operation ? _pdbx_struct_oper_list.matrix[1][1] 1.0000000000 _pdbx_struct_oper_list.matrix[1][2] 0.0000000000 _pdbx_struct_oper_list.matrix[1][3] 0.0000000000 _pdbx_struct_oper_list.vector[1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][1] 0.0000000000 _pdbx_struct_oper_list.matrix[2][2] 1.0000000000 _pdbx_struct_oper_list.matrix[2][3] 0.0000000000 _pdbx_struct_oper_list.vector[2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][1] 0.0000000000 _pdbx_struct_oper_list.matrix[3][2] 0.0000000000 _pdbx_struct_oper_list.matrix[3][3] 1.0000000000 _pdbx_struct_oper_list.vector[3] 0.0000000000 # loop_ _struct_conn.id _struct_conn.conn_type_id _struct_conn.pdbx_leaving_atom_flag _struct_conn.pdbx_PDB_id _struct_conn.ptnr1_label_asym_id _struct_conn.ptnr1_label_comp_id _struct_conn.ptnr1_label_seq_id _struct_conn.ptnr1_label_atom_id _struct_conn.pdbx_ptnr1_label_alt_id _struct_conn.pdbx_ptnr1_PDB_ins_code _struct_conn.pdbx_ptnr1_standard_comp_id _struct_conn.ptnr1_symmetry _struct_conn.ptnr2_label_asym_id _struct_conn.ptnr2_label_comp_id _struct_conn.ptnr2_label_seq_id _struct_conn.ptnr2_label_atom_id _struct_conn.pdbx_ptnr2_label_alt_id _struct_conn.pdbx_ptnr2_PDB_ins_code _struct_conn.ptnr1_auth_asym_id _struct_conn.ptnr1_auth_comp_id _struct_conn.ptnr1_auth_seq_id _struct_conn.ptnr2_auth_asym_id _struct_conn.ptnr2_auth_comp_id _struct_conn.ptnr2_auth_seq_id _struct_conn.ptnr2_symmetry _struct_conn.pdbx_ptnr3_label_atom_id _struct_conn.pdbx_ptnr3_label_seq_id _struct_conn.pdbx_ptnr3_label_comp_id _struct_conn.pdbx_ptnr3_label_asym_id _struct_conn.pdbx_ptnr3_label_alt_id _struct_conn.pdbx_ptnr3_PDB_ins_code _struct_conn.details _struct_conn.pdbx_dist_value _struct_conn.pdbx_value_order _struct_conn.pdbx_role hydrog1 hydrog ? ? A G 1 N1 ? ? ? 1_555 A C 135 N3 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog2 hydrog ? ? A G 1 N2 ? ? ? 1_555 A C 135 O2 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog3 hydrog ? ? A G 1 O6 ? ? ? 1_555 A C 135 N4 ? ? A G 187 A C 321 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog4 hydrog ? ? A G 2 N1 ? ? ? 1_555 A C 134 N3 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog5 hydrog ? ? A G 2 N2 ? ? ? 1_555 A C 134 O2 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog6 hydrog ? ? A G 2 O6 ? ? ? 1_555 A C 134 N4 ? ? A G 188 A C 320 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog7 hydrog ? ? A A 3 N1 ? ? ? 1_555 A U 133 N3 ? ? A A 189 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog8 hydrog ? ? A A 3 N6 ? ? ? 1_555 A U 133 O4 ? ? A A 189 A U 319 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog9 hydrog ? ? A G 4 N1 ? ? ? 1_555 A C 132 N3 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog10 hydrog ? ? A G 4 N2 ? ? ? 1_555 A C 132 O2 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog11 hydrog ? ? A G 4 O6 ? ? ? 1_555 A C 132 N4 ? ? A G 190 A C 318 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog12 hydrog ? ? A C 5 N3 ? ? ? 1_555 A G 131 N1 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog13 hydrog ? ? A C 5 N4 ? ? ? 1_555 A G 131 O6 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog14 hydrog ? ? A C 5 O2 ? ? ? 1_555 A G 131 N2 ? ? A C 191 A G 317 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog15 hydrog ? ? A A 6 N1 ? ? ? 1_555 A A 130 N6 ? ? A A 192 A A 316 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog16 hydrog ? ? A U 7 N3 ? ? ? 1_555 A A 130 N1 ? ? A U 193 A A 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog17 hydrog ? ? A U 7 O4 ? ? ? 1_555 A A 130 N6 ? ? A U 193 A A 316 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog18 hydrog ? ? A C 8 N3 ? ? ? 1_555 A G 129 N1 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog19 hydrog ? ? A C 8 N4 ? ? ? 1_555 A G 129 O6 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog20 hydrog ? ? A C 8 O2 ? ? ? 1_555 A G 129 N2 ? ? A C 194 A G 315 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog21 hydrog ? ? A G 9 N1 ? ? ? 1_555 A A 128 N1 ? ? A G 195 A A 314 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog22 hydrog ? ? A G 9 O6 ? ? ? 1_555 A A 128 N6 ? ? A G 195 A A 314 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog23 hydrog ? ? A U 10 N3 ? ? ? 1_555 A A 128 N1 ? ? A U 196 A A 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog24 hydrog ? ? A U 10 O4 ? ? ? 1_555 A A 128 N6 ? ? A U 196 A A 314 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog25 hydrog ? ? A G 11 N1 ? ? ? 1_555 A C 127 N3 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog26 hydrog ? ? A G 11 N2 ? ? ? 1_555 A C 127 O2 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog27 hydrog ? ? A G 11 O6 ? ? ? 1_555 A C 127 N4 ? ? A G 197 A C 313 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog28 hydrog ? ? A C 13 N3 ? ? ? 1_555 A G 126 N1 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog29 hydrog ? ? A C 13 N4 ? ? ? 1_555 A G 126 O6 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog30 hydrog ? ? A C 13 O2 ? ? ? 1_555 A G 126 N2 ? ? A C 199 A G 312 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog31 hydrog ? ? A U 14 N3 ? ? ? 1_555 A A 125 N1 ? ? A U 200 A A 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog32 hydrog ? ? A U 14 O4 ? ? ? 1_555 A A 125 N6 ? ? A U 200 A A 311 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog33 hydrog ? ? A C 15 N3 ? ? ? 1_555 A G 124 N1 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog34 hydrog ? ? A C 15 N4 ? ? ? 1_555 A G 124 O6 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog35 hydrog ? ? A C 15 O2 ? ? ? 1_555 A G 124 N2 ? ? A C 201 A G 310 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog36 hydrog ? ? A A 16 N1 ? ? ? 1_555 A A 123 N6 ? ? A A 202 A A 309 1_555 ? ? ? ? ? ? 'A-A MISPAIR' ? ? ? hydrog37 hydrog ? ? A G 18 N1 ? ? ? 1_555 A U 122 O2 ? ? A G 204 A U 308 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog38 hydrog ? ? A G 18 O6 ? ? ? 1_555 A U 122 N3 ? ? A G 204 A U 308 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog39 hydrog ? ? A U 19 N3 ? ? ? 1_555 A A 121 N1 ? ? A U 205 A A 307 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog40 hydrog ? ? A U 19 O4 ? ? ? 1_555 A A 121 N6 ? ? A U 205 A A 307 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog41 hydrog ? ? A G 20 N1 ? ? ? 1_555 A U 120 O2 ? ? A G 206 A U 306 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog42 hydrog ? ? A G 20 O6 ? ? ? 1_555 A U 120 N3 ? ? A G 206 A U 306 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog43 hydrog ? ? A C 21 N3 ? ? ? 1_555 A G 119 N1 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog44 hydrog ? ? A C 21 N4 ? ? ? 1_555 A G 119 O6 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog45 hydrog ? ? A C 21 O2 ? ? ? 1_555 A G 119 N2 ? ? A C 207 A G 305 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog46 hydrog ? ? A U 22 N3 ? ? ? 1_555 A A 118 N1 ? ? A U 208 A A 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog47 hydrog ? ? A U 22 O4 ? ? ? 1_555 A A 118 N6 ? ? A U 208 A A 304 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog48 hydrog ? ? A U 23 N3 ? ? ? 1_555 A A 117 N1 ? ? A U 209 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog49 hydrog ? ? A U 23 O4 ? ? ? 1_555 A A 117 N6 ? ? A U 209 A A 303 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog50 hydrog ? ? A C 24 N3 ? ? ? 1_555 A G 68 N1 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog51 hydrog ? ? A C 24 N4 ? ? ? 1_555 A G 68 O6 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog52 hydrog ? ? A C 24 O2 ? ? ? 1_555 A G 68 N2 ? ? A C 210 A G 254 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog53 hydrog ? ? A A 25 N1 ? ? ? 1_555 A G 66 N1 ? ? A A 211 A G 252 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog54 hydrog ? ? A A 25 N6 ? ? ? 1_555 A G 66 O6 ? ? A A 211 A G 252 1_555 ? ? ? ? ? ? TYPE_8_PAIR ? ? ? hydrog55 hydrog ? ? A A 25 N1 ? ? ? 1_555 A U 67 N3 ? ? A A 211 A U 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog56 hydrog ? ? A A 25 N6 ? ? ? 1_555 A U 67 O4 ? ? A A 211 A U 253 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog57 hydrog ? ? A C 26 N3 ? ? ? 1_555 A G 65 N1 ? ? A C 212 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog58 hydrog ? ? A C 26 N4 ? ? ? 1_555 A G 65 O6 ? ? A C 212 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog59 hydrog ? ? A C 26 O2 ? ? ? 1_555 A G 65 N2 ? ? A C 212 A G 251 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog60 hydrog ? ? A G 27 N1 ? ? ? 1_555 A C 64 N3 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog61 hydrog ? ? A G 27 N2 ? ? ? 1_555 A C 64 O2 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog62 hydrog ? ? A G 27 O6 ? ? ? 1_555 A C 64 N4 ? ? A G 213 A C 250 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog63 hydrog ? ? A G 28 N1 ? ? ? 1_555 A C 59 N3 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog64 hydrog ? ? A G 28 N2 ? ? ? 1_555 A C 59 O2 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog65 hydrog ? ? A G 28 O6 ? ? ? 1_555 A C 59 N4 ? ? A G 214 A C 245 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog66 hydrog ? ? A U 29 N3 ? ? ? 1_555 A G 58 O6 ? ? A U 215 A G 244 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog67 hydrog ? ? A U 29 O2 ? ? ? 1_555 A G 58 N1 ? ? A U 215 A G 244 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog68 hydrog ? ? A C 30 N3 ? ? ? 1_555 A G 57 N1 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog69 hydrog ? ? A C 30 N4 ? ? ? 1_555 A G 57 O6 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog70 hydrog ? ? A C 30 O2 ? ? ? 1_555 A G 57 N2 ? ? A C 216 A G 243 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog71 hydrog ? ? A A 31 N1 ? ? ? 1_555 A U 56 N3 ? ? A A 217 A U 242 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog72 hydrog ? ? A A 31 N6 ? ? ? 1_555 A U 56 O4 ? ? A A 217 A U 242 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog73 hydrog ? ? A C 32 N3 ? ? ? 1_555 A G 55 N1 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog74 hydrog ? ? A C 32 N4 ? ? ? 1_555 A G 55 O6 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog75 hydrog ? ? A C 32 O2 ? ? ? 1_555 A G 55 N2 ? ? A C 218 A G 241 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog76 hydrog ? ? A A 33 N1 ? ? ? 1_555 A C 54 N4 ? ? A A 219 A C 240 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog77 hydrog ? ? A A 34 N6 ? ? ? 1_555 A C 54 N3 ? ? A A 220 A C 240 1_555 ? ? ? ? ? ? 'A-C MISPAIR' ? ? ? hydrog78 hydrog ? ? A U 35 N3 ? ? ? 1_555 A C 54 N3 ? ? A U 221 A C 240 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog79 hydrog ? ? A U 35 O4 ? ? ? 1_555 A C 54 N4 ? ? A U 221 A C 240 1_555 ? ? ? ? ? ? TYPE_18_PAIR ? ? ? hydrog80 hydrog ? ? A A 36 N1 ? ? ? 1_555 A U 52 N3 ? ? A A 222 A U 238 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog81 hydrog ? ? A A 36 N6 ? ? ? 1_555 A U 52 O4 ? ? A A 222 A U 238 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog82 hydrog ? ? A U 37 N3 ? ? ? 1_555 A G 51 O6 ? ? A U 223 A G 237 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog83 hydrog ? ? A U 37 O2 ? ? ? 1_555 A G 51 N1 ? ? A U 223 A G 237 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog84 hydrog ? ? A C 39 N3 ? ? ? 1_555 A G 50 N1 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog85 hydrog ? ? A C 39 N4 ? ? ? 1_555 A G 50 O6 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog86 hydrog ? ? A C 39 O2 ? ? ? 1_555 A G 50 N2 ? ? A C 225 A G 236 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog87 hydrog ? ? A C 40 N3 ? ? ? 1_555 A G 49 N1 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog88 hydrog ? ? A C 40 N4 ? ? ? 1_555 A G 49 O6 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog89 hydrog ? ? A C 40 O2 ? ? ? 1_555 A G 49 N2 ? ? A C 226 A G 235 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog90 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 45 N4 ? ? A G 227 A C 231 1_555 ? ? ? ? ? ? 'G-C PAIR' ? ? ? hydrog91 hydrog ? ? A G 41 N1 ? ? ? 1_555 A C 48 N3 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog92 hydrog ? ? A G 41 N2 ? ? ? 1_555 A C 48 O2 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog93 hydrog ? ? A G 41 O6 ? ? ? 1_555 A C 48 N4 ? ? A G 227 A C 234 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog94 hydrog ? ? A C 69 N3 ? ? ? 1_555 A G 95 N1 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog95 hydrog ? ? A C 69 N4 ? ? ? 1_555 A G 95 O6 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog96 hydrog ? ? A C 69 O2 ? ? ? 1_555 A G 95 N2 ? ? A C 255 A G 281 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog97 hydrog ? ? A A 70 N1 ? ? ? 1_555 A U 94 N3 ? ? A A 256 A U 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog98 hydrog ? ? A A 70 N6 ? ? ? 1_555 A U 94 O4 ? ? A A 256 A U 280 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog99 hydrog ? ? A C 71 N3 ? ? ? 1_555 A G 93 N1 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog100 hydrog ? ? A C 71 N4 ? ? ? 1_555 A G 93 O6 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog101 hydrog ? ? A C 71 O2 ? ? ? 1_555 A G 93 N2 ? ? A C 257 A G 279 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog102 hydrog ? ? A A 72 N1 ? ? ? 1_555 A U 92 N3 ? ? A A 258 A U 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog103 hydrog ? ? A A 72 N6 ? ? ? 1_555 A U 92 O4 ? ? A A 258 A U 278 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog104 hydrog ? ? A U 73 N3 ? ? ? 1_555 A G 91 O6 ? ? A U 259 A G 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog105 hydrog ? ? A U 73 O2 ? ? ? 1_555 A G 91 N1 ? ? A U 259 A G 277 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog106 hydrog ? ? A C 74 N3 ? ? ? 1_555 A G 90 N1 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog107 hydrog ? ? A C 74 N4 ? ? ? 1_555 A G 90 O6 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog108 hydrog ? ? A C 74 O2 ? ? ? 1_555 A G 90 N2 ? ? A C 260 A G 276 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog109 hydrog ? ? A A 75 N1 ? ? ? 1_555 A U 89 N3 ? ? A A 261 A U 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog110 hydrog ? ? A A 75 N6 ? ? ? 1_555 A U 89 O4 ? ? A A 261 A U 275 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog111 hydrog ? ? A G 77 N1 ? ? ? 1_555 A C 88 N3 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog112 hydrog ? ? A G 77 N2 ? ? ? 1_555 A C 88 O2 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog113 hydrog ? ? A G 77 O6 ? ? ? 1_555 A C 88 N4 ? ? A G 263 A C 274 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog114 hydrog ? ? A U 78 N3 ? ? ? 1_555 A G 87 O6 ? ? A U 264 A G 273 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog115 hydrog ? ? A U 78 O2 ? ? ? 1_555 A G 87 N1 ? ? A U 264 A G 273 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog116 hydrog ? ? A C 79 N3 ? ? ? 1_555 A G 86 N1 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog117 hydrog ? ? A C 79 N4 ? ? ? 1_555 A G 86 O6 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog118 hydrog ? ? A C 79 O2 ? ? ? 1_555 A G 86 N2 ? ? A C 265 A G 272 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog119 hydrog ? ? A U 80 N3 ? ? ? 1_555 A U 85 O4 ? ? A U 266 A U 271 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? ? hydrog120 hydrog ? ? A G 96 N1 ? ? ? 1_555 A C 116 N3 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog121 hydrog ? ? A G 96 N2 ? ? ? 1_555 A C 116 O2 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog122 hydrog ? ? A G 96 O6 ? ? ? 1_555 A C 116 N4 ? ? A G 282 A C 302 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog123 hydrog ? ? A C 97 N3 ? ? ? 1_555 A G 115 N1 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog124 hydrog ? ? A C 97 N4 ? ? ? 1_555 A G 115 O6 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog125 hydrog ? ? A C 97 O2 ? ? ? 1_555 A G 115 N2 ? ? A C 283 A G 301 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog126 hydrog ? ? A U 98 N3 ? ? ? 1_555 A G 114 O6 ? ? A U 284 A G 300 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog127 hydrog ? ? A U 98 O2 ? ? ? 1_555 A G 114 N1 ? ? A U 284 A G 300 1_555 ? ? ? ? ? ? TYPE_28_PAIR ? ? ? hydrog128 hydrog ? ? A C 99 N3 ? ? ? 1_555 A G 113 N1 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog129 hydrog ? ? A C 99 N4 ? ? ? 1_555 A G 113 O6 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog130 hydrog ? ? A C 99 O2 ? ? ? 1_555 A G 113 N2 ? ? A C 285 A G 299 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog131 hydrog ? ? A C 100 N3 ? ? ? 1_555 A G 112 N1 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog132 hydrog ? ? A C 100 N4 ? ? ? 1_555 A G 112 O6 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog133 hydrog ? ? A C 100 O2 ? ? ? 1_555 A G 112 N2 ? ? A C 286 A G 298 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog134 hydrog ? ? A U 101 N3 ? ? ? 1_555 A A 111 N1 ? ? A U 287 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog135 hydrog ? ? A U 101 O4 ? ? ? 1_555 A A 111 N6 ? ? A U 287 A A 297 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog136 hydrog ? ? A C 102 N3 ? ? ? 1_555 A G 110 N1 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog137 hydrog ? ? A C 102 N4 ? ? ? 1_555 A G 110 O6 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? hydrog138 hydrog ? ? A C 102 O2 ? ? ? 1_555 A G 110 N2 ? ? A C 288 A G 296 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? # _struct_conn_type.id hydrog _struct_conn_type.criteria ? _struct_conn_type.reference ? # _em_3d_fitting.id 1 _em_3d_fitting.entry_id 8UYG _em_3d_fitting.method ? _em_3d_fitting.target_criteria ? _em_3d_fitting.details ? _em_3d_fitting.overall_b_value ? _em_3d_fitting.ref_space REAL _em_3d_fitting.ref_protocol OTHER # _em_3d_reconstruction.entry_id 8UYG _em_3d_reconstruction.id 1 _em_3d_reconstruction.method ? _em_3d_reconstruction.algorithm 'FOURIER SPACE' _em_3d_reconstruction.citation_id ? _em_3d_reconstruction.details ? _em_3d_reconstruction.resolution 6.4 _em_3d_reconstruction.resolution_method 'FSC 0.143 CUT-OFF' _em_3d_reconstruction.magnification_calibration ? _em_3d_reconstruction.nominal_pixel_size ? _em_3d_reconstruction.actual_pixel_size ? _em_3d_reconstruction.num_particles 189981 _em_3d_reconstruction.euler_angles_details ? _em_3d_reconstruction.num_class_averages 1 _em_3d_reconstruction.refinement_type ? _em_3d_reconstruction.image_processing_id 1 _em_3d_reconstruction.symmetry_type POINT # _em_buffer.id 1 _em_buffer.specimen_id 1 _em_buffer.name ? _em_buffer.details ? _em_buffer.pH 8.0 # _em_entity_assembly.id 1 _em_entity_assembly.parent_id 0 _em_entity_assembly.source RECOMBINANT _em_entity_assembly.type COMPLEX _em_entity_assembly.name ;BtCoV-HKU5 5' proximal stem-loop 5, conformation 2 ; _em_entity_assembly.details ? _em_entity_assembly.synonym ? _em_entity_assembly.oligomeric_details ? _em_entity_assembly.entity_id_list 1 # _em_image_scans.entry_id 8UYG _em_image_scans.id 1 _em_image_scans.number_digital_images ? _em_image_scans.details ? _em_image_scans.scanner_model ? _em_image_scans.sampling_size ? _em_image_scans.od_range ? _em_image_scans.quant_bit_size ? _em_image_scans.citation_id ? _em_image_scans.dimension_height 4096 _em_image_scans.dimension_width 4096 _em_image_scans.frames_per_image ? _em_image_scans.image_recording_id 1 _em_image_scans.used_frames_per_image ? # _em_imaging.entry_id 8UYG _em_imaging.id 1 _em_imaging.astigmatism ? _em_imaging.electron_beam_tilt_params ? _em_imaging.residual_tilt ? _em_imaging.microscope_model 'TFS KRIOS' _em_imaging.specimen_holder_type ? _em_imaging.specimen_holder_model 'FEI TITAN KRIOS AUTOGRID HOLDER' _em_imaging.details ? _em_imaging.date ? _em_imaging.accelerating_voltage 300 _em_imaging.illumination_mode 'FLOOD BEAM' _em_imaging.mode 'BRIGHT FIELD' _em_imaging.nominal_cs 2.7 _em_imaging.nominal_defocus_min 1000 _em_imaging.nominal_defocus_max 2000 _em_imaging.calibrated_defocus_min ? _em_imaging.calibrated_defocus_max ? _em_imaging.tilt_angle_min ? _em_imaging.tilt_angle_max ? _em_imaging.nominal_magnification 96000 _em_imaging.calibrated_magnification ? _em_imaging.electron_source 'FIELD EMISSION GUN' _em_imaging.citation_id ? _em_imaging.temperature ? _em_imaging.detector_distance ? _em_imaging.recording_temperature_minimum ? _em_imaging.recording_temperature_maximum ? _em_imaging.alignment_procedure 'COMA FREE' _em_imaging.c2_aperture_diameter 70 _em_imaging.specimen_id 1 _em_imaging.cryogen NITROGEN # _em_sample_support.id 1 _em_sample_support.film_material ? _em_sample_support.method ? _em_sample_support.grid_material COPPER _em_sample_support.grid_mesh_size 300 _em_sample_support.grid_type 'Quantifoil R1.2/1.3' _em_sample_support.details ? _em_sample_support.specimen_id 1 _em_sample_support.citation_id ? # _em_vitrification.entry_id 8UYG _em_vitrification.id 1 _em_vitrification.specimen_id 1 _em_vitrification.cryogen_name ETHANE _em_vitrification.humidity 100 _em_vitrification.temp ? _em_vitrification.chamber_temperature 278 _em_vitrification.instrument 'FEI VITROBOT MARK IV' _em_vitrification.method ? _em_vitrification.time_resolved_state ? _em_vitrification.citation_id ? _em_vitrification.details ? # _em_experiment.entry_id 8UYG _em_experiment.id 1 _em_experiment.reconstruction_method 'SINGLE PARTICLE' _em_experiment.aggregation_state PARTICLE _em_experiment.entity_assembly_id 1 # _em_single_particle_entity.entry_id 8UYG _em_single_particle_entity.id 1 _em_single_particle_entity.image_processing_id 1 _em_single_particle_entity.point_symmetry C1 # loop_ _chem_comp_atom.comp_id _chem_comp_atom.atom_id _chem_comp_atom.type_symbol _chem_comp_atom.pdbx_aromatic_flag _chem_comp_atom.pdbx_stereo_config _chem_comp_atom.pdbx_ordinal A OP3 O N N 1 A P P N N 2 A OP1 O N N 3 A OP2 O N N 4 A "O5'" O N N 5 A "C5'" C N N 6 A "C4'" C N R 7 A "O4'" O N N 8 A "C3'" C N S 9 A "O3'" O N N 10 A "C2'" C N R 11 A "O2'" O N N 12 A "C1'" C N R 13 A N9 N Y N 14 A C8 C Y N 15 A N7 N Y N 16 A C5 C Y N 17 A C6 C Y N 18 A N6 N N N 19 A N1 N Y N 20 A C2 C Y N 21 A N3 N Y N 22 A C4 C Y N 23 A HOP3 H N N 24 A HOP2 H N N 25 A "H5'" H N N 26 A "H5''" H N N 27 A "H4'" H N N 28 A "H3'" H N N 29 A "HO3'" H N N 30 A "H2'" H N N 31 A "HO2'" H N N 32 A "H1'" H N N 33 A H8 H N N 34 A H61 H N N 35 A H62 H N N 36 A H2 H N N 37 C OP3 O N N 38 C P P N N 39 C OP1 O N N 40 C OP2 O N N 41 C "O5'" O N N 42 C "C5'" C N N 43 C "C4'" C N R 44 C "O4'" O N N 45 C "C3'" C N S 46 C "O3'" O N N 47 C "C2'" C N R 48 C "O2'" O N N 49 C "C1'" C N R 50 C N1 N N N 51 C C2 C N N 52 C O2 O N N 53 C N3 N N N 54 C C4 C N N 55 C N4 N N N 56 C C5 C N N 57 C C6 C N N 58 C HOP3 H N N 59 C HOP2 H N N 60 C "H5'" H N N 61 C "H5''" H N N 62 C "H4'" H N N 63 C "H3'" H N N 64 C "HO3'" H N N 65 C "H2'" H N N 66 C "HO2'" H N N 67 C "H1'" H N N 68 C H41 H N N 69 C H42 H N N 70 C H5 H N N 71 C H6 H N N 72 G OP3 O N N 73 G P P N N 74 G OP1 O N N 75 G OP2 O N N 76 G "O5'" O N N 77 G "C5'" C N N 78 G "C4'" C N R 79 G "O4'" O N N 80 G "C3'" C N S 81 G "O3'" O N N 82 G "C2'" C N R 83 G "O2'" O N N 84 G "C1'" C N R 85 G N9 N Y N 86 G C8 C Y N 87 G N7 N Y N 88 G C5 C Y N 89 G C6 C N N 90 G O6 O N N 91 G N1 N N N 92 G C2 C N N 93 G N2 N N N 94 G N3 N N N 95 G C4 C Y N 96 G HOP3 H N N 97 G HOP2 H N N 98 G "H5'" H N N 99 G "H5''" H N N 100 G "H4'" H N N 101 G "H3'" H N N 102 G "HO3'" H N N 103 G "H2'" H N N 104 G "HO2'" H N N 105 G "H1'" H N N 106 G H8 H N N 107 G H1 H N N 108 G H21 H N N 109 G H22 H N N 110 U OP3 O N N 111 U P P N N 112 U OP1 O N N 113 U OP2 O N N 114 U "O5'" O N N 115 U "C5'" C N N 116 U "C4'" C N R 117 U "O4'" O N N 118 U "C3'" C N S 119 U "O3'" O N N 120 U "C2'" C N R 121 U "O2'" O N N 122 U "C1'" C N R 123 U N1 N N N 124 U C2 C N N 125 U O2 O N N 126 U N3 N N N 127 U C4 C N N 128 U O4 O N N 129 U C5 C N N 130 U C6 C N N 131 U HOP3 H N N 132 U HOP2 H N N 133 U "H5'" H N N 134 U "H5''" H N N 135 U "H4'" H N N 136 U "H3'" H N N 137 U "HO3'" H N N 138 U "H2'" H N N 139 U "HO2'" H N N 140 U "H1'" H N N 141 U H3 H N N 142 U H5 H N N 143 U H6 H N N 144 # loop_ _chem_comp_bond.comp_id _chem_comp_bond.atom_id_1 _chem_comp_bond.atom_id_2 _chem_comp_bond.value_order _chem_comp_bond.pdbx_aromatic_flag _chem_comp_bond.pdbx_stereo_config _chem_comp_bond.pdbx_ordinal A OP3 P sing N N 1 A OP3 HOP3 sing N N 2 A P OP1 doub N N 3 A P OP2 sing N N 4 A P "O5'" sing N N 5 A OP2 HOP2 sing N N 6 A "O5'" "C5'" sing N N 7 A "C5'" "C4'" sing N N 8 A "C5'" "H5'" sing N N 9 A "C5'" "H5''" sing N N 10 A "C4'" "O4'" sing N N 11 A "C4'" "C3'" sing N N 12 A "C4'" "H4'" sing N N 13 A "O4'" "C1'" sing N N 14 A "C3'" "O3'" sing N N 15 A "C3'" "C2'" sing N N 16 A "C3'" "H3'" sing N N 17 A "O3'" "HO3'" sing N N 18 A "C2'" "O2'" sing N N 19 A "C2'" "C1'" sing N N 20 A "C2'" "H2'" sing N N 21 A "O2'" "HO2'" sing N N 22 A "C1'" N9 sing N N 23 A "C1'" "H1'" sing N N 24 A N9 C8 sing Y N 25 A N9 C4 sing Y N 26 A C8 N7 doub Y N 27 A C8 H8 sing N N 28 A N7 C5 sing Y N 29 A C5 C6 sing Y N 30 A C5 C4 doub Y N 31 A C6 N6 sing N N 32 A C6 N1 doub Y N 33 A N6 H61 sing N N 34 A N6 H62 sing N N 35 A N1 C2 sing Y N 36 A C2 N3 doub Y N 37 A C2 H2 sing N N 38 A N3 C4 sing Y N 39 C OP3 P sing N N 40 C OP3 HOP3 sing N N 41 C P OP1 doub N N 42 C P OP2 sing N N 43 C P "O5'" sing N N 44 C OP2 HOP2 sing N N 45 C "O5'" "C5'" sing N N 46 C "C5'" "C4'" sing N N 47 C "C5'" "H5'" sing N N 48 C "C5'" "H5''" sing N N 49 C "C4'" "O4'" sing N N 50 C "C4'" "C3'" sing N N 51 C "C4'" "H4'" sing N N 52 C "O4'" "C1'" sing N N 53 C "C3'" "O3'" sing N N 54 C "C3'" "C2'" sing N N 55 C "C3'" "H3'" sing N N 56 C "O3'" "HO3'" sing N N 57 C "C2'" "O2'" sing N N 58 C "C2'" "C1'" sing N N 59 C "C2'" "H2'" sing N N 60 C "O2'" "HO2'" sing N N 61 C "C1'" N1 sing N N 62 C "C1'" "H1'" sing N N 63 C N1 C2 sing N N 64 C N1 C6 sing N N 65 C C2 O2 doub N N 66 C C2 N3 sing N N 67 C N3 C4 doub N N 68 C C4 N4 sing N N 69 C C4 C5 sing N N 70 C N4 H41 sing N N 71 C N4 H42 sing N N 72 C C5 C6 doub N N 73 C C5 H5 sing N N 74 C C6 H6 sing N N 75 G OP3 P sing N N 76 G OP3 HOP3 sing N N 77 G P OP1 doub N N 78 G P OP2 sing N N 79 G P "O5'" sing N N 80 G OP2 HOP2 sing N N 81 G "O5'" "C5'" sing N N 82 G "C5'" "C4'" sing N N 83 G "C5'" "H5'" sing N N 84 G "C5'" "H5''" sing N N 85 G "C4'" "O4'" sing N N 86 G "C4'" "C3'" sing N N 87 G "C4'" "H4'" sing N N 88 G "O4'" "C1'" sing N N 89 G "C3'" "O3'" sing N N 90 G "C3'" "C2'" sing N N 91 G "C3'" "H3'" sing N N 92 G "O3'" "HO3'" sing N N 93 G "C2'" "O2'" sing N N 94 G "C2'" "C1'" sing N N 95 G "C2'" "H2'" sing N N 96 G "O2'" "HO2'" sing N N 97 G "C1'" N9 sing N N 98 G "C1'" "H1'" sing N N 99 G N9 C8 sing Y N 100 G N9 C4 sing Y N 101 G C8 N7 doub Y N 102 G C8 H8 sing N N 103 G N7 C5 sing Y N 104 G C5 C6 sing N N 105 G C5 C4 doub Y N 106 G C6 O6 doub N N 107 G C6 N1 sing N N 108 G N1 C2 sing N N 109 G N1 H1 sing N N 110 G C2 N2 sing N N 111 G C2 N3 doub N N 112 G N2 H21 sing N N 113 G N2 H22 sing N N 114 G N3 C4 sing N N 115 U OP3 P sing N N 116 U OP3 HOP3 sing N N 117 U P OP1 doub N N 118 U P OP2 sing N N 119 U P "O5'" sing N N 120 U OP2 HOP2 sing N N 121 U "O5'" "C5'" sing N N 122 U "C5'" "C4'" sing N N 123 U "C5'" "H5'" sing N N 124 U "C5'" "H5''" sing N N 125 U "C4'" "O4'" sing N N 126 U "C4'" "C3'" sing N N 127 U "C4'" "H4'" sing N N 128 U "O4'" "C1'" sing N N 129 U "C3'" "O3'" sing N N 130 U "C3'" "C2'" sing N N 131 U "C3'" "H3'" sing N N 132 U "O3'" "HO3'" sing N N 133 U "C2'" "O2'" sing N N 134 U "C2'" "C1'" sing N N 135 U "C2'" "H2'" sing N N 136 U "O2'" "HO2'" sing N N 137 U "C1'" N1 sing N N 138 U "C1'" "H1'" sing N N 139 U N1 C2 sing N N 140 U N1 C6 sing N N 141 U C2 O2 doub N N 142 U C2 N3 sing N N 143 U N3 C4 sing N N 144 U N3 H3 sing N N 145 U C4 O4 doub N N 146 U C4 C5 sing N N 147 U C5 C6 doub N N 148 U C5 H5 sing N N 149 U C6 H6 sing N N 150 # loop_ _em_buffer_component.buffer_id _em_buffer_component.concentration _em_buffer_component.concentration_units _em_buffer_component.formula _em_buffer_component.id _em_buffer_component.name 1 50 mM Na-C8H18N2O4S 1 'Sodium HEPES' 1 10 mM MgCl2 2 'Magnesium Chloride' # _em_ctf_correction.details ? _em_ctf_correction.em_image_processing_id 1 _em_ctf_correction.id 1 _em_ctf_correction.type 'PHASE FLIPPING AND AMPLITUDE CORRECTION' # _em_entity_assembly_molwt.entity_assembly_id 1 _em_entity_assembly_molwt.experimental_flag NO _em_entity_assembly_molwt.id 1 _em_entity_assembly_molwt.units MEGADALTONS _em_entity_assembly_molwt.value 0.04373 # _em_entity_assembly_naturalsource.cell ? _em_entity_assembly_naturalsource.cellular_location ? _em_entity_assembly_naturalsource.entity_assembly_id 1 _em_entity_assembly_naturalsource.id 2 _em_entity_assembly_naturalsource.ncbi_tax_id 694008 _em_entity_assembly_naturalsource.organism 'Pipistrellus bat coronavirus HKU5' _em_entity_assembly_naturalsource.organelle ? _em_entity_assembly_naturalsource.organ ? _em_entity_assembly_naturalsource.strain ? _em_entity_assembly_naturalsource.tissue ? _em_entity_assembly_naturalsource.details ? # _em_entity_assembly_recombinant.cell ? _em_entity_assembly_recombinant.entity_assembly_id 1 _em_entity_assembly_recombinant.id 2 _em_entity_assembly_recombinant.ncbi_tax_id 32630 _em_entity_assembly_recombinant.organism 'synthetic construct' _em_entity_assembly_recombinant.plasmid ? _em_entity_assembly_recombinant.strain ? # _em_image_processing.details ? _em_image_processing.id 1 _em_image_processing.image_recording_id 1 # _em_image_recording.average_exposure_time 4.10 _em_image_recording.avg_electron_dose_per_subtomogram ? _em_image_recording.avg_electron_dose_per_image 50.0 _em_image_recording.details ;Data was collected in two session, 5,728 images were collected with a 4.74s exposure time, 12,411 images where collected with a 3.81s exposure time. ; _em_image_recording.detector_mode ? _em_image_recording.film_or_detector_model 'FEI FALCON IV (4k x 4k)' _em_image_recording.id 1 _em_image_recording.imaging_id 1 _em_image_recording.num_diffraction_images ? _em_image_recording.num_grids_imaged 2 _em_image_recording.num_real_images 18139 # _em_particle_selection.details ? _em_particle_selection.id 1 _em_particle_selection.image_processing_id 1 _em_particle_selection.method ? _em_particle_selection.num_particles_selected 5109283 _em_particle_selection.reference_model ? # loop_ _em_software.category _em_software.details _em_software.id _em_software.image_processing_id _em_software.fitting_id _em_software.imaging_id _em_software.name _em_software.version 'PARTICLE SELECTION' Template 1 1 ? ? cryoSPARC 3.2.0 'IMAGE ACQUISITION' ? 2 ? ? 1 EPU ? MASKING ? 3 ? ? ? ? ? 'CTF CORRECTION' 'Patch CTF Estimation' 4 1 ? ? cryoSPARC 3.2.0 'LAYERLINE INDEXING' ? 5 ? ? ? ? ? 'DIFFRACTION INDEXING' ? 6 ? ? ? ? ? 'MODEL FITTING' auto-DRRAFTER 7 ? 1 ? Rosetta 2020.42 OTHER ? 8 ? ? ? ? ? 'MODEL REFINEMENT' phenix.real_space_refine 9 ? 1 ? ERRASER 2 'INITIAL EULER ASSIGNMENT' 'Ab initio reconstruction multi-class' 10 1 ? ? cryoSPARC 3.2.0 'FINAL EULER ASSIGNMENT' 'Non-uniform Refinement' 11 1 ? ? cryoSPARC 3.2.0 CLASSIFICATION '3D variability' 12 1 ? ? cryoSPARC 3.2.0 RECONSTRUCTION 'Non-uniform Refinement' 13 1 ? ? cryoSPARC 3.2.0 'VOLUME SELECTION' ? 14 1 1 1 ? ? 'SERIES ALIGNMENT' ? 15 1 1 1 ? ? 'MOLECULAR REPLACEMENT' ? 16 1 1 1 ? ? 'LATTICE DISTORTION CORRECTION' ? 17 1 1 1 ? ? 'SYMMETRY DETERMINATION' ? 18 1 1 1 ? ? 'CRYSTALLOGRAPHY MERGING' ? 19 1 1 1 ? ? # _em_specimen.concentration 1.31 _em_specimen.details ? _em_specimen.embedding_applied NO _em_specimen.experiment_id 1 _em_specimen.id 1 _em_specimen.shadowing_applied NO _em_specimen.staining_applied NO _em_specimen.vitrification_applied YES # loop_ _ndb_struct_conf_na.entry_id _ndb_struct_conf_na.feature 8UYG 'double helix' 8UYG 'a-form double helix' 8UYG 'hairpin loop' 8UYG 'bulge loop' 8UYG 'mismatched base pair' 8UYG 'internal loop' 8UYG 'triple helix' 8UYG 'quadruple helix' # loop_ _ndb_struct_na_base_pair.model_number _ndb_struct_na_base_pair.i_label_asym_id _ndb_struct_na_base_pair.i_label_comp_id _ndb_struct_na_base_pair.i_label_seq_id _ndb_struct_na_base_pair.i_symmetry _ndb_struct_na_base_pair.j_label_asym_id _ndb_struct_na_base_pair.j_label_comp_id _ndb_struct_na_base_pair.j_label_seq_id _ndb_struct_na_base_pair.j_symmetry _ndb_struct_na_base_pair.shear _ndb_struct_na_base_pair.stretch _ndb_struct_na_base_pair.stagger _ndb_struct_na_base_pair.buckle _ndb_struct_na_base_pair.propeller _ndb_struct_na_base_pair.opening _ndb_struct_na_base_pair.pair_number _ndb_struct_na_base_pair.pair_name _ndb_struct_na_base_pair.i_auth_asym_id _ndb_struct_na_base_pair.i_auth_seq_id _ndb_struct_na_base_pair.i_PDB_ins_code _ndb_struct_na_base_pair.j_auth_asym_id _ndb_struct_na_base_pair.j_auth_seq_id _ndb_struct_na_base_pair.j_PDB_ins_code _ndb_struct_na_base_pair.hbond_type_28 _ndb_struct_na_base_pair.hbond_type_12 1 A G 1 1_555 A C 135 1_555 -0.162 -0.074 0.117 4.564 -3.412 -4.456 1 A_G187:C321_A A 187 ? A 321 ? 19 1 1 A G 2 1_555 A C 134 1_555 -0.275 -0.205 -0.161 2.037 -12.229 -0.227 2 A_G188:C320_A A 188 ? A 320 ? 19 1 1 A A 3 1_555 A U 133 1_555 -0.084 -0.165 -0.305 -3.526 -13.364 -3.210 3 A_A189:U319_A A 189 ? A 319 ? 20 1 1 A G 4 1_555 A C 132 1_555 -0.129 -0.165 -0.086 -5.227 -11.787 -2.913 4 A_G190:C318_A A 190 ? A 318 ? 19 1 1 A C 5 1_555 A G 131 1_555 -0.068 -0.015 0.153 1.705 -4.370 -8.809 5 A_C191:G317_A A 191 ? A 317 ? 19 1 1 A U 7 1_555 A A 130 1_555 0.047 -0.211 0.620 -6.180 -7.110 -3.894 6 A_U193:A316_A A 193 ? A 316 ? 20 1 1 A C 8 1_555 A G 129 1_555 -0.090 -0.034 0.209 5.502 -7.071 -9.215 7 A_C194:G315_A A 194 ? A 315 ? 19 1 1 A U 10 1_555 A A 128 1_555 0.018 -0.342 0.997 -4.009 -5.811 0.641 8 A_U196:A314_A A 196 ? A 314 ? 20 1 1 A G 11 1_555 A C 127 1_555 -0.058 -0.093 -0.148 -2.184 -14.992 -4.790 9 A_G197:C313_A A 197 ? A 313 ? 19 1 1 A C 13 1_555 A G 126 1_555 -0.084 -0.024 0.078 9.489 -6.058 -2.100 10 A_C199:G312_A A 199 ? A 312 ? 19 1 1 A U 14 1_555 A A 125 1_555 -0.029 -0.138 -0.331 6.859 -13.671 -2.102 11 A_U200:A311_A A 200 ? A 311 ? 20 1 1 A C 15 1_555 A G 124 1_555 -0.104 -0.006 -0.126 -0.061 -6.326 -4.244 12 A_C201:G310_A A 201 ? A 310 ? 19 1 1 A A 16 1_555 A A 123 1_555 1.964 1.323 -1.150 -20.572 -13.038 -10.091 13 A_A202:A309_A A 202 ? A 309 ? ? 1 1 A G 18 1_555 A U 122 1_555 -2.088 -0.672 0.818 4.400 -8.966 -19.694 14 A_G204:U308_A A 204 ? A 308 ? 28 1 1 A U 19 1_555 A A 121 1_555 -0.113 -0.114 0.386 5.693 -10.559 -9.905 15 A_U205:A307_A A 205 ? A 307 ? 20 1 1 A G 20 1_555 A U 120 1_555 -1.837 -0.379 0.187 8.981 -10.532 -5.759 16 A_G206:U306_A A 206 ? A 306 ? 28 1 1 A C 21 1_555 A G 119 1_555 0.060 -0.115 -0.112 8.984 -14.462 -2.711 17 A_C207:G305_A A 207 ? A 305 ? 19 1 1 A U 22 1_555 A A 118 1_555 0.063 -0.161 -0.182 0.015 -18.893 -4.479 18 A_U208:A304_A A 208 ? A 304 ? 20 1 1 A U 23 1_555 A A 117 1_555 -0.019 -0.044 0.201 -8.863 -16.587 -8.279 19 A_U209:A303_A A 209 ? A 303 ? 20 1 1 A G 96 1_555 A C 116 1_555 -0.029 -0.124 -0.326 2.462 -8.656 -5.250 20 A_G282:C302_A A 282 ? A 302 ? 19 1 1 A C 97 1_555 A G 115 1_555 0.171 -0.268 -0.417 -1.898 -11.085 -0.351 21 A_C283:G301_A A 283 ? A 301 ? 19 1 1 A U 98 1_555 A G 114 1_555 1.927 -0.434 -0.126 -5.021 -3.896 -3.880 22 A_U284:G300_A A 284 ? A 300 ? 28 1 1 A C 99 1_555 A G 113 1_555 0.186 -0.196 -0.363 1.623 -4.997 -1.482 23 A_C285:G299_A A 285 ? A 299 ? 19 1 1 A C 100 1_555 A G 112 1_555 0.036 -0.151 -0.403 3.005 -4.232 -3.650 24 A_C286:G298_A A 286 ? A 298 ? 19 1 1 A U 101 1_555 A A 111 1_555 0.030 -0.098 -0.416 4.444 -3.401 -7.007 25 A_U287:A297_A A 287 ? A 297 ? 20 1 1 A C 102 1_555 A G 110 1_555 0.292 -0.188 -0.346 5.300 -4.824 -5.172 26 A_C288:G296_A A 288 ? A 296 ? 19 1 1 A C 64 1_555 A G 27 1_555 0.122 -0.153 0.117 9.385 -19.814 -6.140 27 A_C250:G213_A A 250 ? A 213 ? 19 1 1 A G 65 1_555 A C 26 1_555 -0.108 -0.091 -0.307 -4.149 -7.718 -5.421 28 A_G251:C212_A A 251 ? A 212 ? 19 1 1 A U 67 1_555 A A 25 1_555 -0.091 -0.365 1.069 -1.618 -11.483 -0.822 29 A_U253:A211_A A 253 ? A 211 ? 20 1 1 A G 68 1_555 A C 24 1_555 -0.050 -0.053 -0.106 -6.839 -20.081 -5.769 30 A_G254:C210_A A 254 ? A 210 ? 19 1 1 A C 69 1_555 A G 95 1_555 -0.143 -0.158 0.338 12.724 -18.225 -6.072 31 A_C255:G281_A A 255 ? A 281 ? 19 1 1 A A 70 1_555 A U 94 1_555 -0.142 -0.136 -0.284 2.651 -12.781 -4.326 32 A_A256:U280_A A 256 ? A 280 ? 20 1 1 A C 71 1_555 A G 93 1_555 0.099 -0.177 -0.115 4.261 -11.128 -2.061 33 A_C257:G279_A A 257 ? A 279 ? 19 1 1 A A 72 1_555 A U 92 1_555 0.065 -0.086 -0.138 -5.591 -12.988 -4.795 34 A_A258:U278_A A 258 ? A 278 ? 20 1 1 A U 73 1_555 A G 91 1_555 1.821 -0.419 0.036 -4.321 -12.293 -5.990 35 A_U259:G277_A A 259 ? A 277 ? 28 1 1 A C 74 1_555 A G 90 1_555 0.118 -0.197 0.094 -0.560 -12.784 -3.388 36 A_C260:G276_A A 260 ? A 276 ? 19 1 1 A A 75 1_555 A U 89 1_555 0.089 -0.084 0.104 0.416 -8.923 -9.075 37 A_A261:U275_A A 261 ? A 275 ? 20 1 1 A G 77 1_555 A C 88 1_555 -0.007 -0.110 -0.324 -1.396 -14.030 -1.924 38 A_G263:C274_A A 263 ? A 274 ? 19 1 1 A U 78 1_555 A G 87 1_555 1.989 -0.486 -0.247 -3.102 -13.871 -0.393 39 A_U264:G273_A A 264 ? A 273 ? 28 1 1 A C 79 1_555 A G 86 1_555 0.375 -0.302 -0.501 -7.179 4.209 -4.958 40 A_C265:G272_A A 265 ? A 272 ? 19 1 1 A U 80 1_555 A U 85 1_555 3.867 -1.439 -0.236 -6.806 12.923 -44.088 41 A_U266:U271_A A 266 ? A 271 ? ? ? 1 A G 28 1_555 A C 59 1_555 -0.318 -0.184 0.211 -4.102 -10.056 -2.083 42 A_G214:C245_A A 214 ? A 245 ? 19 1 1 A U 29 1_555 A G 58 1_555 1.828 -0.402 0.104 -3.081 -10.481 -3.486 43 A_U215:G244_A A 215 ? A 244 ? 28 1 1 A C 30 1_555 A G 57 1_555 0.142 -0.192 -0.095 2.525 -9.803 -1.383 44 A_C216:G243_A A 216 ? A 243 ? 19 1 1 A A 31 1_555 A U 56 1_555 0.040 -0.095 -0.046 -1.057 -9.461 -5.423 45 A_A217:U242_A A 217 ? A 242 ? 20 1 1 A C 32 1_555 A G 55 1_555 0.040 -0.041 0.021 5.442 -7.794 -7.740 46 A_C218:G241_A A 218 ? A 241 ? 19 1 1 A U 35 1_555 A C 54 1_555 -0.535 -1.510 2.045 -7.809 -4.420 14.071 47 A_U221:C240_A A 221 ? A 240 ? 18 1 1 A A 36 1_555 A U 52 1_555 0.079 -0.242 0.532 -10.773 -13.669 -9.663 48 A_A222:U238_A A 222 ? A 238 ? 20 1 1 A U 37 1_555 A G 51 1_555 2.155 -0.578 0.983 -9.922 -2.192 -5.733 49 A_U223:G237_A A 223 ? A 237 ? 28 1 1 A C 39 1_555 A G 50 1_555 -0.002 -0.091 -0.532 14.399 -10.309 -3.377 50 A_C225:G236_A A 225 ? A 236 ? 19 1 1 A C 40 1_555 A G 49 1_555 0.210 -0.179 -0.409 3.729 -9.537 1.967 51 A_C226:G235_A A 226 ? A 235 ? 19 1 1 A G 41 1_555 A C 48 1_555 0.020 -0.063 -0.348 -10.513 -3.351 -2.487 52 A_G227:C234_A A 227 ? A 234 ? 19 1 # loop_ _ndb_struct_na_base_pair_step.model_number _ndb_struct_na_base_pair_step.i_label_asym_id_1 _ndb_struct_na_base_pair_step.i_label_comp_id_1 _ndb_struct_na_base_pair_step.i_label_seq_id_1 _ndb_struct_na_base_pair_step.i_symmetry_1 _ndb_struct_na_base_pair_step.j_label_asym_id_1 _ndb_struct_na_base_pair_step.j_label_comp_id_1 _ndb_struct_na_base_pair_step.j_label_seq_id_1 _ndb_struct_na_base_pair_step.j_symmetry_1 _ndb_struct_na_base_pair_step.i_label_asym_id_2 _ndb_struct_na_base_pair_step.i_label_comp_id_2 _ndb_struct_na_base_pair_step.i_label_seq_id_2 _ndb_struct_na_base_pair_step.i_symmetry_2 _ndb_struct_na_base_pair_step.j_label_asym_id_2 _ndb_struct_na_base_pair_step.j_label_comp_id_2 _ndb_struct_na_base_pair_step.j_label_seq_id_2 _ndb_struct_na_base_pair_step.j_symmetry_2 _ndb_struct_na_base_pair_step.shift _ndb_struct_na_base_pair_step.slide _ndb_struct_na_base_pair_step.rise _ndb_struct_na_base_pair_step.tilt _ndb_struct_na_base_pair_step.roll _ndb_struct_na_base_pair_step.twist _ndb_struct_na_base_pair_step.x_displacement _ndb_struct_na_base_pair_step.y_displacement _ndb_struct_na_base_pair_step.helical_rise _ndb_struct_na_base_pair_step.inclination _ndb_struct_na_base_pair_step.tip _ndb_struct_na_base_pair_step.helical_twist _ndb_struct_na_base_pair_step.step_number _ndb_struct_na_base_pair_step.step_name _ndb_struct_na_base_pair_step.i_auth_asym_id_1 _ndb_struct_na_base_pair_step.i_auth_seq_id_1 _ndb_struct_na_base_pair_step.i_PDB_ins_code_1 _ndb_struct_na_base_pair_step.j_auth_asym_id_1 _ndb_struct_na_base_pair_step.j_auth_seq_id_1 _ndb_struct_na_base_pair_step.j_PDB_ins_code_1 _ndb_struct_na_base_pair_step.i_auth_asym_id_2 _ndb_struct_na_base_pair_step.i_auth_seq_id_2 _ndb_struct_na_base_pair_step.i_PDB_ins_code_2 _ndb_struct_na_base_pair_step.j_auth_asym_id_2 _ndb_struct_na_base_pair_step.j_auth_seq_id_2 _ndb_struct_na_base_pair_step.j_PDB_ins_code_2 1 A G 1 1_555 A C 135 1_555 A G 2 1_555 A C 134 1_555 0.043 -1.865 3.494 0.324 10.236 31.524 -4.970 -0.022 2.770 18.248 -0.578 33.106 1 AA_G187G188:C320C321_AA A 187 ? A 321 ? A 188 ? A 320 ? 1 A G 2 1_555 A C 134 1_555 A A 3 1_555 A U 133 1_555 -0.331 -1.665 3.510 -0.319 12.954 33.032 -4.610 0.499 2.692 21.769 0.535 35.417 2 AA_G188A189:U319C320_AA A 188 ? A 320 ? A 189 ? A 319 ? 1 A A 3 1_555 A U 133 1_555 A G 4 1_555 A C 132 1_555 -0.032 -1.669 3.378 -1.596 12.646 31.566 -4.758 -0.185 2.540 22.150 2.795 33.982 3 AA_A189G190:C318U319_AA A 189 ? A 319 ? A 190 ? A 318 ? 1 A G 4 1_555 A C 132 1_555 A C 5 1_555 A G 131 1_555 -0.245 -1.729 3.275 -1.111 5.736 32.282 -4.007 0.251 2.939 10.212 1.979 32.793 4 AA_G190C191:G317C318_AA A 190 ? A 318 ? A 191 ? A 317 ? 1 A C 5 1_555 A G 131 1_555 A U 7 1_555 A A 130 1_555 -0.885 -2.558 5.813 22.082 15.755 45.291 -4.582 3.366 3.986 18.626 -26.106 52.423 5 AA_C191U193:A316G317_AA A 191 ? A 317 ? A 193 ? A 316 ? 1 A U 7 1_555 A A 130 1_555 A C 8 1_555 A G 129 1_555 0.038 -1.638 3.085 3.265 5.554 30.482 -4.005 0.490 2.740 10.418 -6.125 31.140 6 AA_U193C194:G315A316_AA A 193 ? A 316 ? A 194 ? A 315 ? 1 A C 8 1_555 A G 129 1_555 A U 10 1_555 A A 128 1_555 -0.689 -2.564 5.832 18.549 12.672 45.860 -4.472 2.973 4.455 15.236 -22.301 50.798 7 AA_C194U196:A314G315_AA A 194 ? A 315 ? A 196 ? A 314 ? 1 A U 10 1_555 A A 128 1_555 A G 11 1_555 A C 127 1_555 -0.152 -1.670 3.242 7.937 10.906 31.088 -4.465 1.422 2.427 19.252 -14.011 33.822 8 AA_U196G197:C313A314_AA A 196 ? A 314 ? A 197 ? A 313 ? 1 A G 11 1_555 A C 127 1_555 A C 13 1_555 A G 126 1_555 -1.293 -1.655 4.329 15.371 23.211 43.240 -3.798 2.744 2.614 28.287 -18.732 51.063 9 AA_G197C199:G312C313_AA A 197 ? A 313 ? A 199 ? A 312 ? 1 A C 13 1_555 A G 126 1_555 A U 14 1_555 A A 125 1_555 -0.038 -1.848 3.473 1.961 10.367 31.277 -4.976 0.392 2.731 18.578 -3.513 32.966 10 AA_C199U200:A311G312_AA A 199 ? A 312 ? A 200 ? A 311 ? 1 A U 14 1_555 A A 125 1_555 A C 15 1_555 A G 124 1_555 -0.026 -1.893 3.603 -0.762 11.074 32.759 -4.921 -0.076 2.833 18.968 1.305 34.539 11 AA_U200C201:G310A311_AA A 200 ? A 311 ? A 201 ? A 310 ? 1 A C 15 1_555 A G 124 1_555 A A 16 1_555 A A 123 1_555 -0.121 -1.865 4.086 10.072 15.967 38.295 -4.421 1.334 2.993 22.734 -14.340 42.538 12 AA_C201A202:A309G310_AA A 201 ? A 310 ? A 202 ? A 309 ? 1 A A 16 1_555 A A 123 1_555 A G 18 1_555 A U 122 1_555 -2.570 -2.733 4.083 9.717 13.155 30.631 -6.567 5.777 1.906 22.963 -16.962 34.632 13 AA_A202G204:U308A309_AA A 202 ? A 309 ? A 204 ? A 308 ? 1 A G 18 1_555 A U 122 1_555 A U 19 1_555 A A 121 1_555 0.682 -1.465 3.570 0.214 13.990 38.473 -3.668 -0.953 2.891 20.425 -0.313 40.847 14 AA_G204U205:A307U308_AA A 204 ? A 308 ? A 205 ? A 307 ? 1 A U 19 1_555 A A 121 1_555 A G 20 1_555 A U 120 1_555 0.328 -1.934 3.138 -2.185 11.128 25.642 -6.202 -1.111 2.097 23.654 4.644 27.999 15 AA_U205G206:U306A307_AA A 205 ? A 307 ? A 206 ? A 306 ? 1 A G 20 1_555 A U 120 1_555 A C 21 1_555 A G 119 1_555 0.102 -1.561 3.520 0.180 5.038 38.480 -2.993 -0.130 3.298 7.604 -0.272 38.797 16 AA_G206C207:G305U306_AA A 206 ? A 306 ? A 207 ? A 305 ? 1 A C 21 1_555 A G 119 1_555 A U 22 1_555 A A 118 1_555 -0.139 -1.737 3.646 1.104 10.201 32.128 -4.718 0.426 2.965 17.871 -1.934 33.686 17 AA_C207U208:A304G305_AA A 207 ? A 305 ? A 208 ? A 304 ? 1 A U 22 1_555 A A 118 1_555 A U 23 1_555 A A 117 1_555 -0.084 -1.659 3.673 -0.777 9.846 33.664 -4.316 0.016 3.082 16.562 1.308 35.043 18 AA_U208U209:A303A304_AA A 208 ? A 304 ? A 209 ? A 303 ? 1 A U 23 1_555 A A 117 1_555 A G 96 1_555 A C 116 1_555 0.200 -1.928 3.257 9.736 16.226 33.238 -4.763 0.780 2.105 25.921 -15.554 38.114 19 AA_U209G282:C302A303_AA A 209 ? A 303 ? A 282 ? A 302 ? 1 A G 96 1_555 A C 116 1_555 A C 97 1_555 A G 115 1_555 0.005 -2.001 3.500 -0.374 6.688 35.421 -4.199 -0.063 3.083 10.872 0.608 36.029 20 AA_G282C283:G301C302_AA A 282 ? A 302 ? A 283 ? A 301 ? 1 A C 97 1_555 A G 115 1_555 A U 98 1_555 A G 114 1_555 -0.069 -1.549 3.564 0.721 10.050 37.372 -3.615 0.196 3.060 15.345 -1.100 38.659 21 AA_C283U284:G300G301_AA A 283 ? A 301 ? A 284 ? A 300 ? 1 A U 98 1_555 A G 114 1_555 A C 99 1_555 A G 113 1_555 0.247 -2.017 3.190 4.583 9.045 23.365 -6.844 0.587 2.270 21.106 -10.693 25.443 22 AA_U284C285:G299G300_AA A 284 ? A 300 ? A 285 ? A 299 ? 1 A C 99 1_555 A G 113 1_555 A C 100 1_555 A G 112 1_555 -0.091 -1.797 3.431 0.828 11.429 28.895 -5.442 0.321 2.549 21.849 -1.583 31.039 23 AA_C285C286:G298G299_AA A 285 ? A 299 ? A 286 ? A 298 ? 1 A C 100 1_555 A G 112 1_555 A U 101 1_555 A A 111 1_555 -0.149 -1.782 3.456 0.408 12.457 29.992 -5.281 0.335 2.533 22.869 -0.749 32.424 24 AA_C286U287:A297G298_AA A 286 ? A 298 ? A 287 ? A 297 ? 1 A U 101 1_555 A A 111 1_555 A C 102 1_555 A G 110 1_555 0.310 -1.792 3.450 0.673 11.000 32.046 -4.799 -0.427 2.711 19.229 -1.177 33.841 25 AA_U287C288:G296A297_AA A 287 ? A 297 ? A 288 ? A 296 ? 1 A C 64 1_555 A G 27 1_555 A G 65 1_555 A C 26 1_555 0.019 -1.827 3.781 1.011 11.371 34.698 -4.609 0.120 3.052 18.458 -1.642 36.473 26 AA_C250G251:C212G213_AA A 250 ? A 213 ? A 251 ? A 212 ? 1 A G 65 1_555 A C 26 1_555 A U 67 1_555 A A 25 1_555 -1.130 -2.316 5.508 16.962 4.266 44.351 -3.425 3.594 4.580 5.408 -21.504 47.513 27 AA_G251U253:A211C212_AA A 251 ? A 212 ? A 253 ? A 211 ? 1 A U 67 1_555 A A 25 1_555 A G 68 1_555 A C 24 1_555 -0.157 -1.693 3.431 7.645 7.162 33.140 -3.927 1.426 2.907 12.183 -13.005 34.712 28 AA_U253G254:C210A211_AA A 253 ? A 211 ? A 254 ? A 210 ? 1 A G 68 1_555 A C 24 1_555 A C 69 1_555 A G 95 1_555 1.721 -1.122 3.261 -11.188 7.004 44.737 -1.958 -3.037 2.589 8.973 14.334 46.548 29 AA_G254C255:G281C210_AA A 254 ? A 210 ? A 255 ? A 281 ? 1 A C 69 1_555 A G 95 1_555 A A 70 1_555 A U 94 1_555 -0.156 -1.709 3.730 0.858 10.153 32.229 -4.693 0.417 3.061 17.745 -1.500 33.761 30 AA_C255A256:U280G281_AA A 255 ? A 281 ? A 256 ? A 280 ? 1 A A 70 1_555 A U 94 1_555 A C 71 1_555 A G 93 1_555 0.028 -1.672 3.432 -1.314 7.050 31.768 -4.208 -0.279 2.998 12.678 2.363 32.547 31 AA_A256C257:G279U280_AA A 256 ? A 280 ? A 257 ? A 279 ? 1 A C 71 1_555 A G 93 1_555 A A 72 1_555 A U 92 1_555 -0.091 -1.785 3.576 0.677 15.319 31.664 -5.201 0.250 2.475 26.237 -1.160 35.096 32 AA_C257A258:U278G279_AA A 257 ? A 279 ? A 258 ? A 278 ? 1 A A 72 1_555 A U 92 1_555 A U 73 1_555 A G 91 1_555 -0.055 -1.541 3.434 0.693 7.306 37.794 -3.253 0.170 3.093 11.150 -1.057 38.474 33 AA_A258U259:G277U278_AA A 258 ? A 278 ? A 259 ? A 277 ? 1 A U 73 1_555 A G 91 1_555 A C 74 1_555 A G 90 1_555 0.135 -1.899 3.119 3.109 10.983 25.296 -6.196 0.348 2.126 23.605 -6.683 27.714 34 AA_U259C260:G276G277_AA A 259 ? A 277 ? A 260 ? A 276 ? 1 A C 74 1_555 A G 90 1_555 A A 75 1_555 A U 89 1_555 -0.334 -1.576 3.284 0.359 14.858 31.234 -4.734 0.614 2.315 25.843 -0.625 34.511 35 AA_C260A261:U275G276_AA A 260 ? A 276 ? A 261 ? A 275 ? 1 A A 75 1_555 A U 89 1_555 A G 77 1_555 A C 88 1_555 -0.971 -1.262 3.393 0.982 8.794 42.571 -2.555 1.407 3.064 11.957 -1.335 43.439 36 AA_A261G263:C274U275_AA A 261 ? A 275 ? A 263 ? A 274 ? 1 A G 77 1_555 A C 88 1_555 A U 78 1_555 A G 87 1_555 0.126 -1.630 3.454 0.797 4.322 40.980 -2.797 -0.091 3.275 6.152 -1.134 41.205 37 AA_G263U264:G273C274_AA A 263 ? A 274 ? A 264 ? A 273 ? 1 A U 78 1_555 A G 87 1_555 A C 79 1_555 A G 86 1_555 -0.290 -2.166 3.514 3.936 9.839 25.966 -6.690 1.485 2.474 20.827 -8.332 28.011 38 AA_U264C265:G272G273_AA A 264 ? A 273 ? A 265 ? A 272 ? 1 A C 79 1_555 A G 86 1_555 A U 80 1_555 A U 85 1_555 -2.080 -1.947 3.814 6.051 15.804 44.781 -3.716 3.072 2.730 19.923 -7.628 47.718 39 AA_C265U266:U271G272_AA A 265 ? A 272 ? A 266 ? A 271 ? 1 A G 28 1_555 A C 59 1_555 A U 29 1_555 A G 58 1_555 -0.095 -1.574 3.484 1.558 6.519 39.420 -3.072 0.323 3.188 9.581 -2.289 39.964 40 AA_G214U215:G244C245_AA A 214 ? A 245 ? A 215 ? A 244 ? 1 A U 29 1_555 A G 58 1_555 A C 30 1_555 A G 57 1_555 0.134 -1.980 3.133 3.959 8.333 24.229 -6.411 0.649 2.326 18.994 -9.025 25.901 41 AA_U215C216:G243G244_AA A 215 ? A 244 ? A 216 ? A 243 ? 1 A C 30 1_555 A G 57 1_555 A A 31 1_555 A U 56 1_555 -0.175 -1.720 3.505 0.115 11.565 30.184 -5.105 0.334 2.680 21.253 -0.212 32.276 42 AA_C216A217:U242G243_AA A 216 ? A 243 ? A 217 ? A 242 ? 1 A A 31 1_555 A U 56 1_555 A C 32 1_555 A G 55 1_555 0.007 -1.816 3.358 0.043 1.409 30.955 -3.675 -0.005 3.274 2.638 -0.080 30.987 43 AA_A217C218:G241U242_AA A 217 ? A 242 ? A 218 ? A 241 ? 1 A U 35 1_555 A C 54 1_555 A A 36 1_555 A U 52 1_555 0.386 -2.050 4.914 -12.622 22.981 53.119 -3.741 -1.301 3.656 24.115 13.245 58.812 44 AA_U221A222:U238C240_AA A 221 ? A 240 ? A 222 ? A 238 ? 1 A A 36 1_555 A U 52 1_555 A U 37 1_555 A G 51 1_555 0.324 -1.573 3.563 -0.333 8.281 39.474 -3.259 -0.509 3.179 12.099 0.486 40.301 45 AA_A222U223:G237U238_AA A 222 ? A 238 ? A 223 ? A 237 ? 1 A U 37 1_555 A G 51 1_555 A C 39 1_555 A G 50 1_555 -1.443 -1.281 2.664 10.795 0.310 34.716 -2.088 3.447 2.124 0.504 -17.573 36.308 46 AA_U223C225:G236G237_AA A 223 ? A 237 ? A 225 ? A 236 ? 1 A C 39 1_555 A G 50 1_555 A C 40 1_555 A G 49 1_555 0.175 -2.010 3.727 -0.991 10.721 32.892 -5.117 -0.454 2.941 18.332 1.694 34.563 47 AA_C225C226:G235G236_AA A 225 ? A 236 ? A 226 ? A 235 ? 1 A C 40 1_555 A G 49 1_555 A G 41 1_555 A C 48 1_555 -0.305 -2.043 3.855 0.325 14.485 30.362 -6.021 0.583 2.632 25.886 -0.581 33.568 48 AA_C226G227:C234G235_AA A 226 ? A 235 ? A 227 ? A 234 ? # loop_ _pdbx_audit_support.funding_organization _pdbx_audit_support.country _pdbx_audit_support.grant_number _pdbx_audit_support.ordinal 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' R35GM122579 1 'Howard Hughes Medical Institute (HHMI)' 'United States' ? 2 'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' U24GM129541 3 'National Science Foundation (NSF, United States)' 'United States' GRFPDGE1656518 4 'Other government' ? 'National Key R&D Program of China 2022YFC2303700' 5 'Other government' ? 'National Key R&